Correction: Li, et al. Conserved miR396b-GRF Regulation Is Involved in Abiotic Stress Responses in Pitaya (Hylocereus polyrhizus). Int. J. Mol. Sci. 2019, 20, 2501

A-Li Li; Zhuang Wen; Kun Yang; Xiao-Peng Wen

doi:10.3390/ijms20194795

Correction to Int. J. Mol. Sci. 2019, 20(10), 2501.

Correction

27 September 2019

Correction: Li, et al. Conserved miR396b-GRF Regulation Is Involved in Abiotic Stress Responses in Pitaya (Hylocereus polyrhizus). Int. J. Mol. Sci. 2019, 20, 2501

and

The Key Laboratory of Plant Resources Conservation and Germplasm Innovation in Mountainous Region (Ministry of Education), Institute of Agro-Bioengineering and College of Life Sciences, Guizhou University, Guiyang 550025, China

Author to whom correspondence should be addressed.

Int. J. Mol. Sci.2019, 20(19), 4795;https://doi.org/10.3390/ijms20194795

This article belongs to the Section Molecular Plant Sciences

Version Notes

Order Reprints

The authors wish to make the following corrections to this paper [1]: In Table A2, of the Appendix, in line 4 of page 14, for the primer of the hpo-miR396b stem-loop RT sequence “GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTCAAGA” the bold part should be changed to “AAGTTC”.

The authors would like to apologize for any inconvenience caused to the readers by these changes. The changes do not affect the scientific results.

Conflicts of Interest

The authors declare no conflict of interest.

Reference

Li, A.-L.; Wen, Z.; Yang, K.; Wen, X.-P. Conserved miR396b-GRF Regulation Is Involved in Abiotic Stress Responses in Pitaya (Hylocereus polyrhizus). Int. J. Mol. Sci. 2019, 20, 2501. [Google Scholar] [CrossRef] [PubMed]

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).

Article Metrics

Citations

Article Access Statistics

Journal Statistics

Multiple requests from the same IP address are counted as one view.

Lysyl Oxidase-Like 2 Protects against Progressive and Aging Related Knee Joint Osteoarthritis in Mice

Extracellular miRNAs as Biomarkers of Head and Neck Cancer Progression and Metastasis