MKP-5 Relieves Lipotoxicity-Induced Islet β-Cell Dysfunction and Apoptosis via Regulation of Autophagy
Abstract
:1. Introduction
2. Results
2.1. Overexpression of MKP-5 Reduces PA-Induced Growth Inhibition and Apoptosis in Rin-m5f Cells
2.2. MKP-5 Regulates PA-Induced Inflammation, Oxidative Stress, and Impairment of Insulin Secretion in Rin-m5f Cells
2.3. Knockdown of MKP-5 Exacerbates Lipotoxicity-Induced Apoptosis and Dysfunction in Rin-m5f Cells
2.4. MKP-5 Alleviates ERS and Autophagy Inhibition in PA-Stressed Rin-m5f Cells
2.5. Overexpression of MKP-5 Enhances PA-Impaired Autophagic Flux in Rin-m5f Cells
2.6. MKP-5 Protects Primary Islet Cells against HFD-Induced ERS, Apoptosis, Dysfunction, and Autophagy Inhibition
2.7. MKP-5 Regulates the Apoptosis and Dysfunction of Islet Cells through the JNK and P38 Pathways
2.8. MKP-5 Protects Rin-m5f Cells from Lipotoxicity via the Autophagy Pathway
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Stimulation
4.2. Generation of Stable MKP-5-Expressing Rin-m5f Cells
4.3. Construction of a Recombinant Adenovirus
4.4. Small Interfering RNA (siRNA) Transfection
4.5. Cell Proliferation Assay
4.6. Annexin-V-FLUOS/Propidium Iodide (PI) Analysis
4.7. Caspase-3 Activity Analysis
4.8. Measurement of Glucose Stimulated Insulin Secretion (GSIS)
4.9. Measurement of Intracellular Reactive Oxygen Species (ROS)
4.10. RNA Preparation and Quantitative Real-Time PCR
4.11. Western Blotting
4.12. Mouse Models and Mouse Primary Islets Isolation
4.13. Laser Scanning Confocal Microscopy Analysis
4.14. Transmission Electron Microscopic Observation
4.15. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
Abbreviations
Bax | Bcl-2 associated X protein; |
Bcl-2 | B-cell lymphoma-2; |
CHOP | C/EBP homologous protein; |
EIF2α | eukaryotic initiation factor 2α; |
ERK | extracellular-regulated kinase; |
ERS | endoplasmic reticulum stress; |
FFA | free fatty acids; |
GAPDH | glyceraldehyde-3-phosphate dehydrogenase; |
Glut-2 | glucose transporter-2; |
GRP-78 | glucose-regulated protein-78; |
GSIS | glucose-stimulated insulin secretion test; |
HFD | high-fat diet; |
IL-6 | interleukin-6; |
iNOS | inducible nitric oxide synthase; |
IRE1 | inositol-requiring enzyme 1; |
LC3 | microtubule associated protein 1 light chain 3; |
JNK | c-Jun amino-terminal kinase; |
MAPK | mitogen-activated protein kinase; |
MCP-1 | monocyte chemotactic protein-1; |
MKP-5 | mitogen-activated protein kinase phosphatase-5; |
PA | palmitic acid; |
PARP-1 | poly (ADP-ribose) polymerase-1; |
PDX-1 | pancreatic duodenal homeobox-1; |
ROS | reactive oxygen species; |
T2DM | type 2 diabetes mellitus; |
TEM | transmission electron microscope |
References
- Vincent, C.M.; Hall, P.A. Cognitive effects of a 30-min aerobic exercise bout on adults with overweight/obesity and type 2 diabetes. Obes. Sci. Pract. 2017, 3, 289–297. [Google Scholar] [CrossRef]
- Solinas, G.; Becattini, B. JNK at the crossroad of obesity, insulin resistance, and cell stress response. Mol. Metab. 2017, 6, 174–184. [Google Scholar] [CrossRef]
- Gehrmann, W.; Elsner, M.; Lenzen, S. Role of metabolically generated reactive oxygen species for lipotoxicity in pancreatic beta-cells. Diabetes Obes. Metab. 2010, 12 (Suppl. S2), 149–158. [Google Scholar] [CrossRef]
- Prentki, M.; Nolan, C.J. Islet beta cell failure in type 2 diabetes. J. Clin. Investig. 2006, 116, 1802–1812. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boden, G. Obesity, insulin resistance and free fatty acids. Curr. Opin. Endocrinol. Diabetes Obes. 2011, 18, 139–143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Engin, A.B. What Is Lipotoxicity? Adv. Exp. Med. Biol. 2017, 960, 197–220. [Google Scholar]
- Yu, C.; Cui, S.; Zong, C.; Gao, W.; Xu, T.; Gao, P.; Chen, J.; Qin, D.; Guan, Q.; Liu, Y.; et al. The Orphan Nuclear Receptor NR4A1 Protects Pancreatic beta-Cells from Endoplasmic Reticulum (ER) Stress-mediated Apoptosis. J. Biol. Chem. 2015, 290, 20687–20699. [Google Scholar] [CrossRef] [Green Version]
- Eguchi, K.; Manabe, I.; Oishi-Tanaka, Y.; Ohsugi, M.; Kono, N.; Ogata, F.; Yagi, N.; Ohto, U.; Kimoto, M.; Miyake, K.; et al. Saturated fatty acid and TLR signaling link beta cell dysfunction and islet inflammation. Cell Metab. 2012, 15, 518–533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mir, S.U.; George, N.M.; Zahoor, L.; Harms, R.; Guinn, Z.; Sarvetnick, N.E. Inhibition of autophagic turnover in beta-cells by fatty acids and glucose leads to apoptotic cell death. J. Biol. Chem. 2015, 290, 6071–6085. [Google Scholar] [CrossRef] [Green Version]
- Lytrivi, M.; Anne-Laure, C.; Poitout, V.; Cnop, M. Recent insights into mechanisms of beta-cell lipo- and glucolipotoxicity in type 2 diabetes. J. Mol. Biol. 2020, 432, 1514–1534. [Google Scholar] [CrossRef] [PubMed]
- Ebato, C.; Uchida, T.; Arakawa, M.; Komatsu, M.; Ueno, T.; Komiya, K.; Azuma, K.; Hirose, T.; Tanaka, K.; Kominami, E.; et al. Autophagy is important in islet homeostasis and compensatory increase of beta cell mass in response to high-fat diet. Cell Metab. 2008, 8, 325–332. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, S.E.; Lee, S.M.; Lee, Y.J.; Li, L.J.; Lee, S.J.; Lee, J.H.; Kim, Y.; Jun, H.S.; Lee, K.W.; Kang, Y. Protective role of autophagy in palmitate-induced INS-1 beta-cell death. Endocrinology 2009, 150, 126–134. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Li, Y.B.; Yin, J.J.; Wang, Y.; Zhu, L.B.; Xie, G.Y.; Pan, S.H. Autophagy regulates inflammation following oxidative injury in diabetes. Autophagy 2013, 9, 272–277. [Google Scholar] [CrossRef] [PubMed]
- Xia, G.; Zhu, T.; Li, X.; Jin, Y.; Zhou, J.; Xiao, J. ROSmediated autophagy through the AMPK signaling pathway protects INS1 cells from human islet amyloid polypeptideinduced cytotoxicity. Mol. Med. Rep. 2018, 18, 2744–2752. [Google Scholar] [PubMed] [Green Version]
- Tanemura, M.; Ohmura, Y.; Deguchi, T.; Machida, T.; Tsukamoto, R.; Wada, H.; Kobayashi, S.; Marubashi, S.; Eguchi, H.; Ito, T.; et al. Rapamycin causes upregulation of autophagy and impairs islets function both in vitro and in vivo. Am. J. Transpl. 2012, 12, 102–114. [Google Scholar] [CrossRef]
- Lee, B.C.; Lee, J. Cellular and molecular players in adipose tissue inflammation in the development of obesity-induced insulin resistance. Biochim. Biophys. Acta 2014, 1842, 446–462. [Google Scholar] [CrossRef] [Green Version]
- Kim, E.K.; Choi, E.J. Compromised MAPK signaling in human diseases: An update. Arch. Toxicol. 2015, 89, 867–882. [Google Scholar] [CrossRef]
- Fujishiro, M.; Gotoh, Y.; Katagiri, H.; Sakoda, H.; Ogihara, T.; Anai, M.; Onishi, Y.; Ono, H.; Abe, M.; Shojima, N.; et al. Three mitogen-activated protein kinases inhibit insulin signaling by different mechanisms in 3T3-L1 adipocytes. Mol. Endocrinol. 2003, 17, 487–497. [Google Scholar] [CrossRef]
- Darling, N.J.; Cook, S.J. The role of MAPK signalling pathways in the response to endoplasmic reticulum stress. Biochim. Biophys. Acta 2014, 1843, 2150–2163. [Google Scholar] [CrossRef] [Green Version]
- Zhou, Y.Y.; Li, Y.; Jiang, W.Q.; Zhou, L.F. MAPK/JNK signalling: A potential autophagy regulation pathway. Biosci. Rep. 2015, 35, e00199. [Google Scholar] [CrossRef]
- Liu, J.; Chang, F.; Li, F.; Fu, H.; Wang, J.; Zhang, S.; Zhao, J.; Yin, D. Palmitate promotes autophagy and apoptosis through ROS-dependent JNK and p38 MAPK. Biochem. Biophys. Res. Commun. 2015, 463, 262–267. [Google Scholar] [CrossRef] [PubMed]
- Caunt, C.J.; Keyse, S.M. Dual-specificity MAP kinase phosphatases (MKPs): Shaping the outcome of MAP kinase signalling. FEBS J. 2013, 280, 489–504. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiao, P.; Feng, B.; Xu, H. Mapping MKP-3/FOXO1 interaction and evaluating the effect on gluconeogenesis. PLoS ONE 2012, 7, e41168. [Google Scholar] [CrossRef] [Green Version]
- Emanuelli, B.; Eberle, D.; Suzuki, R.; Kahn, C.R. Overexpression of the dual-specificity phosphatase MKP-4/DUSP-9 protects against stress-induced insulin resistance. Proc. Natl. Acad. Sci. USA 2008, 105, 3545–3550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, H.; Dembski, M.; Yang, Q.; Yang, D.; Moriarty, A.; Tayber, O.; Chen, H.; Kapeller, R.; Tartaglia, L.A. Dual specificity mitogen-activated protein (MAP) kinase phosphatase-4 plays a potential role in insulin resistance. J. Biol. Chem. 2003, 278, 30187–30192. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, J.; Zhou, J.Y.; Kho, D.; Reiners, J.J., Jr.; Wu, G.S. Role for DUSP1 (dual-specificity protein phosphatase 1) in the regulation of autophagy. Autophagy 2016, 12, 1791–1803. [Google Scholar] [CrossRef]
- Qian, F.; Deng, J.; Cheng, N.; Welch, E.J.; Zhang, Y.; Malik, A.B.; Flavell, R.A.; Dong, C.; Ye, R.D. A non-redundant role for MKP5 in limiting ROS production and preventing LPS-induced vascular injury. EMBO J. 2009, 28, 2896–2907. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Nguyen, T.; Tang, P.; Kennedy, N.J.; Jiao, H.; Zhang, M.; Reynolds, J.M.; Jaeschke, A.; Martin-Orozco, N.; Chung, Y.; et al. Regulation of Adipose Tissue Inflammation and Insulin Resistance by MAPK Phosphatase 5. J. Biol. Chem. 2015, 290, 14875–14883. [Google Scholar] [CrossRef] [Green Version]
- Wu, J.; Mei, C.; Vlassara, H.; Striker, G.E.; Zheng, F. Oxidative stress-induced JNK activation contributes to proinflammatory phenotype of aging diabetic mesangial cells. Am. J. Physiol. Ren. Physiol. 2009, 297, F1622–F1631. [Google Scholar] [CrossRef] [Green Version]
- Zheng, S.; Ren, X.; Han, T.; Chen, Y.; Qiu, H.; Liu, W.; Hu, Y. Fenofibrate attenuates fatty acid-induced islet beta-cell dysfunction and apoptosis via inhibiting the NF-kappaB/MIF dependent inflammatory pathway. Metabolism 2017, 77, 23–38. [Google Scholar] [CrossRef]
- Del Guerra, S.; Lupi, R.; Marselli, L.; Masini, M.; Bugliani, M.; Sbrana, S.; Torri, S.; Pollera, M.; Boggi, U.; Mosca, F.; et al. Functional and molecular defects of pancreatic islets in human type 2 diabetes. Diabetes 2005, 54, 727–735. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lai, E.; Bikopoulos, G.; Wheeler, M.B.; Rozakis-Adcock, M.; Volchuk, A. Differential activation of ER stress and apoptosis in response to chronically elevated free fatty acids in pancreatic beta-cells. Am. J. Physiol Endocrinol. Metab. 2008, 294, E540–E550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kang, R.; Zeh, H.J.; Lotze, M.T.; Tang, D. The Beclin 1 network regulates autophagy and apoptosis. Cell Death Differ. 2011, 18, 571–580. [Google Scholar] [CrossRef] [PubMed]
- Park, J.M.; Seo, M.; Jung, C.H.; Grunwald, D.; Stone, M.; Otto, N.M.; Toso, E.; Ahn, Y.; Kyba, M.; Griffin, T.J.; et al. ULK1 phosphorylates Ser30 of BECN1 in association with ATG14 to stimulate autophagy induction. Autophagy 2018, 14, 584–597. [Google Scholar] [CrossRef] [Green Version]
- Huang, R.; Liu, W. Identifying an essential role of nuclear LC3 for autophagy. Autophagy 2015, 11, 852–853. [Google Scholar] [CrossRef]
- Agrotis, A.; Pengo, N. Redundancy of human ATG4 protease isoforms in autophagy and LC3/GABARAP processing revealed in cells. Autophagy 2019, 15, 976–997. [Google Scholar] [CrossRef] [Green Version]
- Liu, W.J.; Ye, L.; Huang, W.F.; Guo, L.J.; Xu, Z.G.; Wu, H.L.; Yang, C.; Liu, H.F. p62 links the autophagy pathway and the ubiqutin-proteasome system upon ubiquitinated protein degradation. Cell. Mol. Biol. Lett. 2016, 21, 29. [Google Scholar] [CrossRef] [Green Version]
- Lamark, T.; Svenning, S.; Johansen, T. Regulation of selective autophagy: The p62/SQSTM1 paradigm. Essays Biochem. 2017, 61, 609–624. [Google Scholar]
- Kimura, S.; Noda, T.; Yoshimori, T. Dissection of the autophagosome maturation process by a novel reporter protein, tandem fluorescent-tagged LC3. Autophagy 2007, 3, 452–460. [Google Scholar] [CrossRef] [Green Version]
- Wu, Y.T.; Tan, H.L.; Shui, G.; Bauvy, C.; Huang, Q.; Wenk, M.R.; Ong, C.N.; Codogno, P.; Shen, H.M. Dual role of 3-methyladenine in modulation of autophagy via different temporal patterns of inhibition on class I and III phosphoinositide 3-kinase. J. Biol. Chem. 2010, 285, 10850–10861. [Google Scholar] [CrossRef] [Green Version]
- Yoshii, S.R.; Mizushima, N. Monitoring and Measuring Autophagy. Int. J. Mol. Sci. 2017, 18, 1865. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Bailo, B.; El-Sohemy, A.; Haddad, P.S.; Arora, P.; Benzaied, F.; Karmali, M.; Badawi, A. Vitamins D, C, and E in the prevention of type 2 diabetes mellitus: Modulation of inflammation and oxidative stress. Biologics 2011, 5, 7–19. [Google Scholar] [PubMed] [Green Version]
- Chen, Z.F.; Li, Y.B.; Han, J.Y.; Wang, J.; Yin, J.J.; Li, J.B.; Tian, H. The double-edged effect of autophagy in pancreatic beta cells and diabetes. Autophagy 2011, 7, 12–16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, X.; Bao, Y.; Ke, L.; Yu, Y. Elevated circulating free fatty acids levels causing pancreatic islet cell dysfunction through oxidative stress. J. Endocrinol. Investig. 2010, 33, 388–394. [Google Scholar] [CrossRef] [PubMed]
- Kharroubi, I.; Ladriere, L.; Cardozo, A.K.; Dogusan, Z.; Cnop, M.; Eizirik, D.L. Free fatty acids and cytokines induce pancreatic beta-cell apoptosis by different mechanisms: Role of nuclear factor-kappaB and endoplasmic reticulum stress. Endocrinology 2004, 145, 5087–5096. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Hai, B.; Niu, X.; Ai, L.; Cao, Y.; Li, R.; Li, Y. Chronic intermittent hypoxia disturbs insulin secretion and causes pancreatic injury via the MAPK signaling pathway. Biochem. Cell Biol. 2017, 95, 415–420. [Google Scholar] [CrossRef] [Green Version]
- Brozzi, F.; Gerlo, S.; Grieco, F.A.; Juusola, M.; Balhuizen, A.; Lievens, S.; Gysemans, C.; Bugliani, M.; Mathieu, C.; Marchetti, P.; et al. Ubiquitin D Regulates IRE1alpha/c-Jun N-terminal Kinase (JNK) Protein-dependent Apoptosis in Pancreatic Beta Cells. J. Biol. Chem. 2016, 291, 12040–12056. [Google Scholar] [CrossRef] [Green Version]
- Zhang, B.; Lai, G.; Wu, J.; Sun, R.; Xu, R.; Yang, X.; Qi, Y.; Zhao, Y. 20-HETE attenuates the response of glucose-stimulated insulin secretion through the AKT/GSK-3beta/Glut2 pathway. Endocrine 2016, 54, 371–382. [Google Scholar] [CrossRef]
- Shao, S.; Liu, Z.; Yang, Y.; Zhang, M.; Yu, X. SREBP-1c, Pdx-1, and GLP-1R involved in palmitate-EPA regulated glucose-stimulated insulin secretion in INS-1 cells. J. Cell. Biochem. 2010, 111, 634–642. [Google Scholar] [CrossRef]
- Yang, Y.; Tong, Y.; Gong, M.; Lu, Y.; Wang, C.; Zhou, M.; Yang, Q.; Mao, T.; Tong, N. Activation of PPARbeta/delta protects pancreatic beta cells from palmitate-induced apoptosis by upregulating the expression of GLP-1 receptor. Cell. Signal. 2014, 26, 268–278. [Google Scholar] [CrossRef]
- Blaser, H.; Dostert, C.; Mak, T.W.; Brenner, D. TNF and ROS Crosstalk in Inflammation. Trends Cell Biol. 2016, 26, 249–261. [Google Scholar] [CrossRef] [PubMed]
- Park, J.; Min, J.S.; Kim, B.; Chae, U.B.; Yun, J.W.; Choi, M.S.; Kong, I.K.; Chang, K.T.; Lee, D.S. Mitochondrial ROS govern the LPS-induced pro-inflammatory response in microglia cells by regulating MAPK and NF-kappaB pathways. Neurosci. Lett. 2015, 584, 191–196. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.C.; Su, S.L.; Lin, W.C.; Lin, A.H.; Yang, Y.C.; Lii, C.K.; Chen, H.W. Andrographolide inhibits hypoxia-induced hypoxia-inducible factor 1alpha and endothelin 1 expression through the heme oxygenase 1/CO/cGMP/MKP-5 pathways in EA.hy926 cells. Environ. Toxicol. 2018, 33, 269–279. [Google Scholar] [CrossRef] [PubMed]
- Li, X.L.; Wong, Y.S.; Xu, G.; Chan, J.C. Selenium-enriched Spirulina protects INS-1E pancreatic beta cells from human islet amyloid polypeptide-induced apoptosis through suppression of ROS-mediated mitochondrial dysfunction and PI3/AKT pathway. Eur. J. Nutr. 2015, 54, 509–522. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.H.; Kim, J.; Park, K.; Lee, M.S. Beta-cell autophagy: Mechanism and role in beta-cell dysfunction. Mol. Metab. 2019, 27, S92–S103. [Google Scholar] [CrossRef]
- Yamamoto, T.; Takabatake, Y.; Takahashi, A.; Kimura, T.; Namba, T.; Matsuda, J.; Minami, S.; Kaimori, J.Y.; Matsui, I.; Matsusaka, T.; et al. High-Fat Diet-Induced Lysosomal Dysfunction and Impaired Autophagic Flux Contribute to Lipotoxicity in the Kidney. J. Am. Soc. Nephrol. 2017, 28, 1534–1551. [Google Scholar] [CrossRef]
- Chu, K.Y.; O’Reilly, L.; Ramm, G.; Biden, T.J. High-fat diet increases autophagic flux in pancreatic beta cells in vivo and ex vivo in mice. Diabetologia 2015, 58, 2074–2078. [Google Scholar] [CrossRef] [Green Version]
Genes | Forward Primers(5′ to 3′) | Reverse Primers(5′ to 3′) |
---|---|---|
MKP-5 | TTAGACGACAGGGTAGTAGT | GCTGGATGAGGGCATATA |
Bcl-2 | AGGATTGTGGCCTTCTTTGA | TCAGGTACTCAGTCATCCAC |
BAX | GGCAACTTCAACTGGGGC | CCACCCTGGTCTTGGATCC |
PDX-1 | AGCAGTACTACGCGGCCAC | GAGCGGGGGCACTTCGT |
GLP-1R | ATCGCTTCAGCCATCCTTG | GCCGTGCTATACATCCACT |
CHOP | ACGGAAACAGAGTGGTCA | CGCTCGATTTCCTGCTTG |
GRP-78 | ACCAAGAAGTCTCAGATCTT | TTGTCTTCAGCTGTCACTCG |
IL-6 | TTCACAAGTCCGGAGAGGA | GAATTGCCATTGCACAACTC |
MCP-1 | CAGCCAGATGCAGTTAATGCC | AGCCGACTCATTGGGATCAT |
iNOS | ATCTGCAGACACATACTTTA | GCCAGCGTACCGGATGAGC |
p22phox | GCCATTGCCAGTGTGATCTA | AATGGGAGTCCACTGCTCAC |
NOX-4 | ACAACTGTTCCGGGCCTGAC | TCAACAAGCCACCCGAAACA |
GAPDH | GCACCACCAACTGCTTAG | GCAGGGATGATGTTCTGG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, T.; Ma, J.; Li, L.; Teng, W.; Tian, Y.; Ma, Y.; Wang, W.; Yan, W.; Jiao, P. MKP-5 Relieves Lipotoxicity-Induced Islet β-Cell Dysfunction and Apoptosis via Regulation of Autophagy. Int. J. Mol. Sci. 2020, 21, 7161. https://doi.org/10.3390/ijms21197161
Zhao T, Ma J, Li L, Teng W, Tian Y, Ma Y, Wang W, Yan W, Jiao P. MKP-5 Relieves Lipotoxicity-Induced Islet β-Cell Dysfunction and Apoptosis via Regulation of Autophagy. International Journal of Molecular Sciences. 2020; 21(19):7161. https://doi.org/10.3390/ijms21197161
Chicago/Turabian StyleZhao, Tongjian, Jie Ma, Lulu Li, Wenjing Teng, Yafei Tian, Yongjun Ma, Wei Wang, Weiqun Yan, and Ping Jiao. 2020. "MKP-5 Relieves Lipotoxicity-Induced Islet β-Cell Dysfunction and Apoptosis via Regulation of Autophagy" International Journal of Molecular Sciences 21, no. 19: 7161. https://doi.org/10.3390/ijms21197161