The Effect of Orally Supplemented Melatonin on Larval Performance and Skeletal Deformities in Farmed Gilthead Seabream (Sparus aurata)
Abstract
1. Introduction
2. Results
2.1. Effect of Orally Supplemented Melatonin on Growth Rate
2.2. Effect of Exogenous Melatonin on Insulin-Like Growth Factor 1 Concentration
2.3. Effects of Melatonin Oral Supplementation on the Ossification Pattern
2.4. Opercular Complex Deformity: Gross Anatomy
2.5. Opercular Complex Anomalies under Scanning Electron Microscope
2.6. Skeletal Deformities
2.7. Effects of Exogenous Melatonin on Gene Expression
3. Discussion
4. Materials and Methods
4.1. Larval Rearing
4.2. Experimental Design
4.3. Sampling
4.4. Morphological Studies
4.4.1. Scanning Electron Microscopy
4.4.2. Acid-Free Double Staining
4.5. IGF-1 Quantification
4.6. Gene Expression Analyses
4.7. Statistics
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Bardon, A.; Vandeputte, M.; Dupont-Nivet, M.; Chavanne, H.; Haffray, P.; Vergnet, A.; Chatain, B. What is the heritable component of spinal deformities in the European sea bass (Dicentrarchus labrax)? Aquaculture 2009, 294, 194–201. [Google Scholar] [CrossRef][Green Version]
- Beraldo, P.; Canavese, B. Recovery of opercular anomalies in gilthead sea bream, Sparus aurata L.: Morphological and morphometric analysis. J. Fish Dis. 2011, 34, 21–30. [Google Scholar] [CrossRef] [PubMed]
- Negrín-Báez, D.; Navarro, A.; Lee-Montero, I.; Soula, M.; Afonso, J.M.; Zamorano, M.J. Inheritance of skeletal deformities in gilthead seabream (Sparus aurata)–lack of operculum, lordosis, vertebral fusion and LSK complex1. J. Anim. Sci. 2015, 93, 53–61. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Verhaegen, Y.; Adriaens, D.; Wolf, T.D.; Dhert, P.; Sorgeloos, P. Deformities in larval gilthead sea bream (Sparus aurata): A qualitative and quantitative analysis using geometric morphometrics. Aquaculture 2007, 268, 156–168. [Google Scholar] [CrossRef]
- Thuong, N.P.; Verstraeten, B.; Kegel, B.D.; Christiaens, J.; Wolf, T.D.; Sorgeloos, P.; Bonte, D.; Adriaens, D. Ontogenesis of opercular deformities in gilthead sea bream Sparus aurata: A histological description. J. Fish Biol. 2017, 91, 1419–1434. [Google Scholar] [CrossRef]
- Peruzzi, S.; Westgaard, J.-I.; Chatain, B. Genetic investigation of swimbladder inflation anomalies in the European sea bass, Dicentrarchus labrax L. Aquaculture 2007, 265, 102–108. [Google Scholar] [CrossRef]
- Fernández, I.; Hontoria, F.; Ortiz-Delgado, J.B.; Kotzamanis, Y.; Estévez, A.; Zambonino-Infante, J.L.; Gisbert, E. Larval performance and skeletal deformities in farmed gilthead sea bream (Sparus aurata) fed with graded levels of Vitamin A enriched rotifers (Brachionus plicatilis). Aquaculture 2008, 283, 102–115. [Google Scholar] [CrossRef]
- Georgakopoulou, E.; Katharios, P.; Divanach, P.; Koumoundouros, G. Effect of temperature on the development of skeletal deformities in Gilthead seabream (Sparus aurata Linnaeus, 1758). Aquaculture 2010, 308, 13–19. [Google Scholar] [CrossRef]
- Ortiz-Delgado, J.B.; Fernández, I.; Sarasquete, C.; Gisbert, E. Normal and histopathological organization of the opercular bone and vertebrae in gilthead sea bream Sparus aurata. Aquat. Biol. 2014, 21, 67–84. [Google Scholar] [CrossRef]
- Berillis, P. Skeletal Deformities in Seabreams. Understanding the Genetic Origin Can-Improve Production? J. FisheriesSciences.com 2017, 11, 57–59. [Google Scholar] [CrossRef]
- Villamizar, N.; Blanco-Vives, B.; Migaud, H.; Davie, A.; Carboni, S.; Sánchez-Vázquez, F.J. Effects of light during early larval development of some aquacultured teleosts: A review. Aquaculture 2011, 315, 86–94. [Google Scholar] [CrossRef]
- Villamizar, N.; García-Alcazar, A.; Sánchez-Vázquez, F.J. Effect of light spectrum and photoperiod on the growth, development and survival of European sea bass (Dicentrarchus labrax) larvae. Aquaculture 2009, 292, 80–86. [Google Scholar] [CrossRef]
- Falcón, J.; Besseau, L.; Sauzet, S.; Boeuf, G. Melatonin effects on the hypothalamo-pituitary axis in fish. Trends Endocrinol. Metab. 2007, 18, 81–88. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Vázquez, F.J.; López-Olmeda, J.F.; Vera, L.M.; Migaud, H.; López-Patiño, M.A.; Míguez, J.M. Environmental Cycles, Melatonin, and Circadian Control of Stress Response in Fish. Front. Endocrinol. 2019, 10, 279. [Google Scholar] [CrossRef]
- Tordjman, S.; Chokron, S.; Delorme, R.; Charrier, A.; Bellissant, E.; Jaafari, N.; Fougerou, C. Melatonin: Pharmacology, Functions and Therapeutic Benefits. Curr. Neuropharmacol. 2017, 15, 434–443. [Google Scholar] [CrossRef]
- Velarde, E.; Cerdá-Reverter, J.M.; Alonso-Gómez, A.L.; Sánchez, E.; Isorna, E.; Delgado, M.J. Melatonin-synthesizing enzymes in pineal, retina, liver, and gut of the goldfish (Carassius): mRNA expression pattern and regulation of daily rhythms by lighting conditions. Chronobiol. Int. 2010, 27, 1178–1201. [Google Scholar] [CrossRef]
- Falcón, J.; Migaud, H.; Muñoz-Cueto, J.A.; Carrillo, M. Current knowledge on the melatonin system in teleost fish. Gen. Comp. Endocrinol. 2010, 165, 469–482. [Google Scholar] [CrossRef]
- Danilova, N.; Krupnik, V.E.; Sugden, D.; Zhdanova, I.V. Melatonin stimulates cell proliferation in zebrafish embryo and accelerates its development. FASEB J. 2004, 18, 751–753. [Google Scholar] [CrossRef]
- Fjelldal, P.G.; Grotmol, S.; Kryvi, H.; Gjerdet, N.R.; Taranger, G.L.; Hansen, T.; Porter, M.J.R.; Totland, G.K. Pinealectomy induces malformation of the spine and reduces the mechanical strength of the vertebrae in Atlantic salmon, Salmo salar. J. Pineal Res. 2004, 36, 132–139. [Google Scholar] [CrossRef]
- Maria, S.; Samsonraj, R.M.; Munmun, F.; Glas, J.; Silvestros, M.; Kotlarczyk, M.P.; Rylands, R.; Dudakovic, A.; van Wijnen, A.J.; Enderby, L.T.; et al. Biological effects of melatonin on osteoblast/osteoclast cocultures, bone, and quality of life: Implications of a role for MT2 melatonin receptors, MEK1/2, and MEK5 in melatonin-mediated osteoblastogenesis. J. Pineal Res. 2018, 64. [Google Scholar] [CrossRef]
- Zhu, G.; Ma, B.; Dong, P.; Shang, J.; Gu, X.; Zi, Y. Melatonin promotes osteoblastic differentiation and regulates PDGF/AKT signaling pathway. Cell Biol. Int. 2020, 44, 402–411. [Google Scholar] [CrossRef] [PubMed]
- Sun, T.; Li, J.; Xing, H.L.; Tao, Z.S.; Yang, M. Melatonin improves the osseointegration of hydroxyapatite-coated titanium implants in senile female rats. Z. Gerontol. Geriat. 2019, 53, 770–777. [Google Scholar] [CrossRef] [PubMed]
- Kalamarz, H.; Nietrzeba, M.; Fuentes, J.; Martinez-Rodriguez, G.; Mancera, J.M.; Kulczykowska, E. Melatonin concentrations during larval and postlarval development of gilthead sea bream Sparus auratus: More than a time-keeping molecule? J. Fish Biol. 2009, 75, 142–155. [Google Scholar] [CrossRef]
- Herrero-Turrión, M.J.; Rodríguez, R.E.; Velasco, A.; González-Sarmiento, R.; Aijón, J.; Lara, J.M. Growth hormone expression in ontogenic development in gilthead sea bream. Cell Tissue Res. 2003, 313, 81–91. [Google Scholar] [CrossRef]
- Herrero-Turrion, M.J.; Rodriguez, R.E.; Aijon, J.; Lara, J.M. Transient expression pattern of prolactin in Sparus aurata. J. Mol. Endocrinol. 2003, 30, 69–84. [Google Scholar] [CrossRef][Green Version]
- Deane, E.E.; Kelly, S.P.; Collins, P.M.; Woo, N.Y.S. Larval development of silver sea bream (Sparus sarba): Ontogeny of RNA-DNA ratio, GH, IGF-I, and Na+-K+-ATPase. Mar. Biotechnol. 2003, 5, 79–91. [Google Scholar] [CrossRef]
- Izquierdo, M.S.; Scolamacchia, M.; Betancor, M.; Roo, J.; Caballero, M.J.; Terova, G.; Witten, P.E. Effects of dietary DHA and α-tocopherol on bone development, early mineralisation and oxidative stress in Sparus aurata (Linnaeus, 1758) larvae. Br. J. Nutr. 2013, 109, 1796–1805. [Google Scholar] [CrossRef]
- Roo, J.; Hernandez-Cruz, C.M.; Socorro, J.; Fernández-Palacios, H.; Izquierdo, M. Effect of rearing techniques on skeletal deformities and osteological development in red porgy Pagrus pagrus (Linnaeus, 1758) larvae. J. Fish Biol. 2010, 77, 1309–1324. [Google Scholar] [CrossRef]
- Galeotti, M.; Beraldo, P.; de Dominis, S.; D’Angelo, L.; Ballestrazzi, R.; Musetti, R.; Pizzolito, S.; Pinosa, M. A preliminary histological and ultrastructural study of opercular anomalies in gilthead sea bream larvae (Sparus aurata). Fish Physiol. Biochem. 2000, 22, 151–157. [Google Scholar] [CrossRef]
- Beraldo, P.; Pinosa, M.; Tibaldi, E.; Canavese, B. Abnormalities of the operculum in gilthead sea bream (Sparus aurata): Morphological description. Aquaculture 2003, 220, 89–99. [Google Scholar] [CrossRef]
- Sajan, S.; Anna-Mercy, T.V. Morphological and osteological malformations in hatchery bred redline torpedo fish, Sahyadria denisonii (Day 1865) (Cyprinidae). Anales Biol. 2016, 38, 73–80. [Google Scholar] [CrossRef]
- Andrades, J.A.; Becerra, J.; Fernández-Llebrez, P. Skeletal deformities in larval, juvenile and adult stages of cultured gilthead sea bream (Sparus aurata L.). Aquaculture 1996, 141, 1–11. [Google Scholar] [CrossRef]
- Boglione, C.; Gagliardi, F.; Scardi, M.; Cataudella, S. Skeletal descriptors and quality assessment in larvae and post-larvae of wild-caught and hatchery-reared gilthead sea bream (Sparus aurata L. 1758). Aquaculture 2001, 192, 1–22. [Google Scholar] [CrossRef]
- Prestinicola, L.; Boglione, C.; Makridis, P.; Spanò, A.; Rimatori, V.; Palamara, E.; Scardi, M.; Cataudella, S. Environmental conditioning of skeletal anomalies typology and frequency in gilthead seabream (Sparus aurata L., 1758) juveniles. PLoS ONE 2013, 8, e55736. [Google Scholar] [CrossRef] [PubMed]
- Faustino, M.; Power, D.M. Development of osteological structures in the sea bream: Vertebral column and caudal fin complex. J. Fish Biol. 1998, 52, 11–22. [Google Scholar] [CrossRef]
- Gavaia, P.J.; Sarasquete, C.; Cancela, M.L. Detection of mineralized structures in early stages of development of marine teleostei using a modified alcian blue-alizarin red double staining technique for bone and cartilage. Biotech. Histochem. 2000, 75, 79–84. [Google Scholar] [CrossRef] [PubMed]
- Faustino, M.; Power, D.M. Osteologic development of the viscerocranial skeleton in sea bream: Alternative ossification strategies in teleost fish. J. Fish Biol. 2001, 58, 537–572. [Google Scholar] [CrossRef]
- Saka, Ş.; Çoban, D.; Kamacı, H.O.; Süzer, C.; Fırat, K. Early development of cephalic skeleton in hatchery-reared gilthead seabream, Sparus aurata. Turk. J. Fish. Aquat. Sci. 2008, 8, 341–345. [Google Scholar]
- Can, E. Effects of Intensive and Semi-Intensive Rearing on Growth, Survival, and V-Shaped (Lordotic) Skeletal Deformities in Juvenile Gilthead Sea Bream (Sparus aurata). Isr. J. Aquac. Bamidgeh 2013, 65, 1–7, IJA_65.2013.798. [Google Scholar]
- Castillo, J.; Codina, M.; Martínez, M.L.; Navarro, I.; Gutiérrez, J. Metabolic and mitogenic effects of IGF-I and insulin on muscle cells of rainbow trout. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2004, 286, R935–R941. [Google Scholar] [CrossRef]
- Wood, A.; Duan, C.; Bern, H. Insulin-like growth factor signaling in fish. Int. Rev. Cytol. 2005, 243, 215. [Google Scholar] [CrossRef] [PubMed]
- Beckman, B.R.; Shimizu, M.; Gadberry, B.A.; Cooper, K.A. Response of the somatotropic axis of juvenile coho salmon to alterations in plane of nutrition with an analysis of the relationships among growth rate and circulating IGF-I and 41kDa IGFBP. Gen. Comp. Endocrinol. 2004, 135, 334–344. [Google Scholar] [CrossRef] [PubMed]
- Georgiou, S.; Makridis, P.; Dimopoulos, D.; Power, D.M.; Mamuris, Z.; Moutou, K.A. Myosin light chain 2 isoforms in gilthead sea bream (Sparus aurata L.): Molecular growth markers at early stages. Aquaculture 2014, 432, 434–442. [Google Scholar] [CrossRef]
- Lee, N.K.; Sowa, H.; Hinoi, E.; Ferron, M.; Ahn, J.D.; Confavreux, C.; Dacquin, R.; Mee, P.J.; McKee, M.D.; Jung, D.Y.; et al. Endocrine regulation of energy metabolism by the skeleton. Cell 2007, 130, 456–469. [Google Scholar] [CrossRef]
- Guerreiro, P.M.; Rotllant, J.; Fuentes, J.; Power, D.M.; Canario, A.V.M. Cortisol and parathyroid hormone-related peptide are reciprocally modulated by negative feedback. Gen. Comp. Endocrinol. 2006, 148, 227–235. [Google Scholar] [CrossRef]
- Kwong, R.W.M.; Perry, S.F. An essential role for parathyroid hormone in gill formation and differentiation of ion-transporting cells in developing Zebrafish. Endocrinology 2015, 156, 2384–2394. [Google Scholar] [CrossRef]
- Abbink, W.; Flik, G. Parathyroid hormone-related protein in teleost fish. Gen. Comp. Endocrinol. 2007, 152, 243–251. [Google Scholar] [CrossRef][Green Version]
- Karaplis, A.C.; Luz, A.; Glowacki, J.; Bronson, R.T.; Tybulewicz, V.L.; Kronenberg, H.M.; Mulligan, R.C. Lethal skeletal dysplasia from targeted disruption of the parathyroid hormone-related peptide gene. Genes Dev. 1994, 8, 277–289. [Google Scholar] [CrossRef]
- Abbink, W.; Kulczykowska, E.; Kalamarz, H.; Guerreiro, P.M.; Flik, G. Melatonin synthesis under calcium constraint in gilthead sea bream (Sparus auratus L.). Gen. Comp. Endocrinol. 2008, 155, 94–100. [Google Scholar] [CrossRef][Green Version]
- Shanqi, F.; Miho, K.; Yoko, U.; Sei, K.; Daichi, H.; Yuji, S.; Asami, T.; Takashi, N.; Yusuke, M.; Mika, I.; et al. Circadian production of melatonin in cartilage modifies rhythmic gene expression. J. Endocrinol. 2019, 241, 161–173. [Google Scholar] [CrossRef]
- Keenan, L.; Ingleton, P.; Danks, J.; Morton, J.; Brown, B.; Canario, A.; Power, D. Immunoreactive parathyroid hormone-related protein (irPTHrP) and PTHrP gene expression in normal and dystrophic sea bream. J. Endocrinol. 1998, 156, P10. [Google Scholar]
- Guardiola-Lemaître, B. Toxicology of melatonin. J. Biol. Rhythm. 1997, 12, 697–706. [Google Scholar] [CrossRef] [PubMed]
- Conde-Sieira, M.; Muñoz, J.L.P.; López-Patiño, M.A.; Gesto, M.; Soengas, J.L.; Míguez, J.M. Oral administration of melatonin counteracts several of the effects of chronic stress in rainbow trout. Domest. Anim. Endocrinol. 2014, 46, 26–36. [Google Scholar] [CrossRef] [PubMed]
- Amano, M.; Iigo, M.; Ikuta, K.; Kitamura, S.; Okuzawa, K.; Yamada, H.; Yamamori, K. Disturbance of plasma melatonin profile by high dose melatonin administration inhibits testicular maturation of precocious male masu salmon. Zool. Sci. 2004, 21, 79–85. [Google Scholar] [CrossRef]
- López-Olmeda, J.F.; Bayarri, M.J.; Rol de Lama, M.A.; Madrid, J.A.; Sánchez-Vázquez, F.J. Effects of melatonin administration on oxidative stress and daily locomotor activity patterns in goldfish. J. Physiol. Biochem. 2006, 62, 17–25. [Google Scholar] [CrossRef]
- Abbate, F.; Guerrera, M.C.; Cavallaro, M.; Montalbano, G.; Germanà, A.; Levanti, M. LM and SEM study on the swordfish (Xiphias gladius) tongue. Tissue Cell 2017, 49, 633–637. [Google Scholar] [CrossRef]
- Walker, M.B.; Kimmel, C.B. A two-color acid-free cartilage and bone stain for zebrafish larvae. Biotech. Histochem. 2007, 82, 23–28. [Google Scholar] [CrossRef]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
Ctrl | Mel1 | MEL2 | |
---|---|---|---|
Total abnormalities | 84.4%a | 92.2%ab | 96.7%b |
Vertebral abnormalities | 23.3% | 28.9% | 23.3% |
Hemal and neural spine abnormalities | 61.1% | 63.3% | 55.6% |
Caudal portion abnormalities | 45.6%a | 62.2%b | 77.8%c |
Gene | Primer Sequences (5′-3′) | Tm°C | Accession Number |
---|---|---|---|
bglap | F: AGT GAC AAC CCT GCT GAT GA | 58 | AF289506 |
R: TCC CTC AGT GTC CAT CAT GT | |||
PTHrP | F: CCC AGA GCC AAA CAT TCA GT | 58 | AF197904 |
R: CGG CCT AAC CTC ACC TTT TT | |||
mlc2 | F: TGG CAT CAT CAG CAA GGA | 54 | AF150904 |
R: TTG AAA GCG CTC ACG ATG | |||
ef1α | F: CTTCAACGCTCAGGTCATCA | 58 | AF184170 |
R: GTGGGTGCAGTTTGACAATG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mhalhel, K.; Germanà, A.; Abbate, F.; Guerrera, M.C.; Levanti, M.; Laurà, R.; Montalbano, G. The Effect of Orally Supplemented Melatonin on Larval Performance and Skeletal Deformities in Farmed Gilthead Seabream (Sparus aurata). Int. J. Mol. Sci. 2020, 21, 9597. https://doi.org/10.3390/ijms21249597
Mhalhel K, Germanà A, Abbate F, Guerrera MC, Levanti M, Laurà R, Montalbano G. The Effect of Orally Supplemented Melatonin on Larval Performance and Skeletal Deformities in Farmed Gilthead Seabream (Sparus aurata). International Journal of Molecular Sciences. 2020; 21(24):9597. https://doi.org/10.3390/ijms21249597
Chicago/Turabian StyleMhalhel, Kamel, Antonino Germanà, Francesco Abbate, Maria Cristina Guerrera, Maria Levanti, Rosaria Laurà, and Giuseppe Montalbano. 2020. "The Effect of Orally Supplemented Melatonin on Larval Performance and Skeletal Deformities in Farmed Gilthead Seabream (Sparus aurata)" International Journal of Molecular Sciences 21, no. 24: 9597. https://doi.org/10.3390/ijms21249597
APA StyleMhalhel, K., Germanà, A., Abbate, F., Guerrera, M. C., Levanti, M., Laurà, R., & Montalbano, G. (2020). The Effect of Orally Supplemented Melatonin on Larval Performance and Skeletal Deformities in Farmed Gilthead Seabream (Sparus aurata). International Journal of Molecular Sciences, 21(24), 9597. https://doi.org/10.3390/ijms21249597