Potent Inhibitory Effect of BJ-3105, a 6-Alkoxypyridin-3-ol Derivative, on Murine Colitis Is Mediated by Activating AMPK and Inhibiting NOX
Abstract
:1. Introduction
2. Results
2.1. BJ-3105 Blocked Inflammatory Cytokine-Induced Monocyte Adhesion to Colonic Epithelial Cells
2.2. Inhibitory Effects of BJ-3105 on the Expressions of Inflammatory Cytokines and Inflammasome Components
2.3. Inhibitory Effects of BJ-3105 on ROS Production and NOX Activity
2.4. BJ-3105 Ameliorated DSS-Induced Murine Colitis and Colitis-Associated Tumor Formation
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell Culture
4.3. AMPK Activity Measurement
4.4. Monocyte–Epithelial Cell Adhesion Assay
4.5. Cytotoxicity Measurement
4.6. Western Blotting
4.7. Intracellular ROS Measurement
4.8. NOX Activity Measurement
4.9. Induction of Colitis and Colitis-Associated Tumor Formation in Mice
4.10. Measurement of MPO
4.11. Enzyme-Linked Immunosorbent Assay (ELISA)
4.12. Statistics
Author Contributions
Funding
Conflicts of Interest
Abbreviations
AMPK | Adenosine monophosphate (AMP)-activated kinase |
AICAR | 5-Aminoimidazole-4-carboxamide ribonucleotide |
AOM | Azoxymethane |
CD | Crohn’s disease |
DSS | Dextran sulfate sodium |
GGPP | Gerynylgerynyl pyrophosphate |
IBD | inflammatory bowel disease |
IL | Interleukin |
JAK | Janus kinase 2 |
MPO | Myeloperoxidase |
MTT | 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide |
NF-κB | nuclear factor kappa B |
NOX | NADPH oxidase |
PRRs | pattern recognition receptors |
ROS | reactive oxygen species |
STAT3 | signal transducer and activator of transcription 3 |
TLRs | toll-like receptors |
TNF-α | tumor necrosis factor-alpha |
TPA | 12-O-Tetradecanoylphorbol-13-acetate |
UC | ulcerative colitis |
References
- Holleran, G.; Lopetuso, L.; Petito, V.; Graziani, C.; Ianiro, G.; McNamara, D.; Gasbarrini, A.; Scaldaferri, F. The innate and adaptive immune system as targets for biologic therapies in inflammatory bowel disease. Int. J. Mol. Sci. 2017, 18, 2020. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heinsbroek, S.E.; Gordon, S. The role of macrophages in inflammatory bowel diseases. Expert Rev. Mol. Med. 2009, 11, e14. [Google Scholar] [CrossRef] [PubMed]
- Mahida, Y.R. The key role of macrophages in the immunopathogenesis of inflammatory bowel disease. Inflamm. Bowel Dis. 2000, 6, 21–33. [Google Scholar] [CrossRef] [PubMed]
- Sica, A.; Mantovani, A. Macrophage plasticity and polarization: In vivo veritas. J. Clin. Investig. 2012, 122, 787–795. [Google Scholar] [CrossRef] [PubMed]
- Swann, J.B.; Vesely, M.D.; Silva, A.; Sharkey, J.; Akira, S.; Schreiber, R.D.; Smyth, M.J. Demonstration of inflammation-induced cancer and cancer immunoediting during primary tumorigenesis. Proc. Natl. Acad. Sci. USA 2008, 105, 652–656. [Google Scholar] [CrossRef] [Green Version]
- Reimund, J.; Wittersheim, C.; Dumont, S.; Muller, C.; Kenney, J.; Baumann, R.; Poindron, P.; Duclos, B. Increased production of tumour necrosis factor-alpha interleukin-1 beta, and interleukin-6 by morphologically normal intestinal biopsies from patients with Crohn’s disease. Gut 1996, 39, 684–689. [Google Scholar] [CrossRef] [Green Version]
- Adegbola, S.O.; Sahnan, K.; Warusavitarne, J.; Hart, A.; Tozer, P. Anti-TNF therapy in Crohn’s disease. Int. J. Mol. Sci. 2018, 19, 2244. [Google Scholar] [CrossRef] [Green Version]
- Lichtenstein, G.R. Comprehensive review: Antitumor necrosis factor agents in inflammatory bowel disease and factors implicated in treatment response. Ther. Adv. Gastroenter. 2013, 6, 269–293. [Google Scholar] [CrossRef] [Green Version]
- Olesen, C.M.; Coskun, M.; Peyrin-Biroulet, L.; Nielsen, O.H. Mechanisms behind efficacy of tumor necrosis factor inhibitors in inflammatory bowel diseases. Pharmacol. Therapeut. 2016, 159, 110–119. [Google Scholar] [CrossRef]
- Colombel, J.-F.; Sandborn, W.J.; Ghosh, S.; Wolf, D.C.; Panaccione, R.; Feagan, B.; Reinisch, W.; Robinson, A.M.; Lazar, A.; Kron, M. Four-year maintenance treatment with adalimumab in patients with moderately to severely active ulcerative colitis: Data from ULTRA 1, 2, and 3. Am. J. Gastroenterol. 2014, 109, 1771. [Google Scholar] [CrossRef] [Green Version]
- Műzes, G.; Molnár, B.; Tulassay, Z.; Sipos, F. Changes of the cytokine profile in inflammatory bowel diseases. World J. Gastroentero. 2012, 18, 5848. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yarur, A.J.; Jain, A.; Quintero, M.A.; Czul, F.; Deshpande, A.R.; Kerman, D.H.; Abreu, M.T. Inflammatory cytokine profile in crohn’s disease nonresponders to optimal antitumor necrosis factor therapy. J. Clin. Gastroenterol. 2019, 53, 210–215. [Google Scholar] [CrossRef] [PubMed]
- Coskun, M.; Salem, M.; Pedersen, J.; Nielsen, O.H. Involvement of JAK/STAT signaling in the pathogenesis of inflammatory bowel disease. Pharmacol. Res. 2013, 76, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Flamant, M.; Rigaill, J.; Paul, S.; Roblin, X. Advances in the development of Janus kinase inhibitors in inflammatory bowel disease: Future prospects. Drugs 2017, 77, 1057–1068. [Google Scholar] [CrossRef] [PubMed]
- Panés, J.; Sandborn, W.J.; Schreiber, S.; Sands, B.E.; Vermeire, S.; D’Haens, G.; Panaccione, R.; Higgins, P.D.; Colombel, J.-F.; Feagan, B.G. Tofacitinib for induction and maintenance therapy of Crohn’s disease: Results of two phase IIb randomised placebo-controlled trials. Gut 2017, 66, 1049–1059. [Google Scholar] [CrossRef] [PubMed]
- Mancini, S.J.; White, A.D.; Bijland, S.; Rutherford, C.; Graham, D.; Richter, E.A.; Viollet, B.; Touyz, R.M.; Palmer, T.M.; Salt, I.P. Activation of AMP-activated protein kinase rapidly suppresses multiple pro-inflammatory pathways in adipocytes including IL-1 receptor-associated kinase-4 phosphorylation. Mol. Cell. Endocrinol. 2017, 440, 44–56. [Google Scholar] [CrossRef]
- McCarty, M.F.; Barroso-Aranda, J.; Contreras, F. AMP-activated kinase may suppress NADPH oxidase activation in vascular tissues. Med. Hypotheses 2009, 72, 468–470. [Google Scholar] [CrossRef]
- O’Neill, H.M. AMPK and exercise: Glucose uptake and insulin sensitivity. Diabetes Metab. 2013, 37, 1–21. [Google Scholar] [CrossRef] [Green Version]
- Volt, H.; Garcia, J.A.; Doerrier, C.; Diaz-Casado, M.E.; Guerra-Librero, A.; Lopez, L.C.; Escames, G.; Tresguerres, J.A.; Acuna-Castroviejo, D. Same molecule but different expression: Aging and sepsis trigger NLRP3 inflammasome activation, a target of melatonin. J. Pineal Res. 2016, 60, 193–205. [Google Scholar] [CrossRef]
- Wang, Y.; Zhang, J.; Zhang, L.; Gao, P.; Wu, X. Adiponectin attenuates high glucose-induced apoptosis through the AMPK/p38 MAPK signaling pathway in NRK-52E cells. PLoS ONE 2017, 12, e0178215. [Google Scholar]
- Giri, S.; Khan, M.; Nath, N.; Singh, I.; Singh, A.K. The role of AMPK in psychosine mediated effects on oligodendrocytes and astrocytes: Implication for Krabbe disease. J. Neurochem. 2008, 105, 1820–1833. [Google Scholar] [CrossRef] [PubMed]
- Jhun, B.S.; Jin, Q.; Oh, Y.T.; Kim, S.S.; Kong, Y.; Cho, Y.H.; Ha, J.; Baik, H.H.; Kang, I. 5-Aminoimidazole-4-carboxamide riboside suppresses lipopolysaccharide-induced TNF-alpha production through inhibition of phosphatidylinositol 3-kinase/Akt activation in RAW 264.7 murine macrophages. Biochem. Biophys. Res. Commun. 2004, 318, 372–380. [Google Scholar] [CrossRef] [PubMed]
- Kuo, C.L.; Ho, F.M.; Chang, M.Y.; Prakash, E.; Lin, W.W. Inhibition of lipopolysaccharide-induced inducible nitric oxide synthase and cyclooxygenase-2 gene expression by 5-aminoimidazole-4-carboxamide riboside is independent of AMP-activated protein kinase. J. Cell. Biochem. 2008, 103, 931–940. [Google Scholar] [CrossRef] [PubMed]
- Banskota, S.; Regmi, S.C.; Kim, J.A. NOX1 to NOX2 switch deactivates AMPK and induces invasive phenotype in colon cancer cells through overexpression of MMP-7. Mol. Cancer 2015, 14, 123. [Google Scholar] [CrossRef] [Green Version]
- Kim, H.S.; Hwang, J.T.; Yun, H.; Chi, S.G.; Lee, S.J.; Kang, I.; Yoon, K.S.; Choe, W.J.; Kim, S.S.; Ha, J. Inhibition of AMP-activated protein kinase sensitizes cancer cells to cisplatin-induced apoptosis via hyper-induction of p53. J. Biol. Chem. 2008, 283, 3731–3742. [Google Scholar] [CrossRef] [Green Version]
- Chen, L.; Wang, J.; You, Q.; He, S.; Meng, Q.; Gao, J.; Wu, X.; Shen, Y.; Sun, Y.; Wu, X. Activating AMPK to restore tight junction assembly in intestinal epithelium and to attenuate experimental colitis by metformin. Front. Pharmacol. 2018, 9, 761. [Google Scholar] [CrossRef] [Green Version]
- Yu, T.; Wan, P.; Zhu, X.-D.; Ren, Y.-P.; Wang, C.; Yan, R.-W.; Guo, Y.; Bai, A.-P. Inhibition of NADPH oxidase activities ameliorates DSS-induced colitis. Biochem. Pharmacol. 2018, 158, 126–133. [Google Scholar] [CrossRef]
- Timilshina, M.; Kang, Y.; Dahal, I.; You, Z.; Nam, T.-G.; Kim, K.-J.; Jeong, B.-S.; Chang, J.-H. BJ-3105, a 6-Alkoxypyridin-3-ol Analog, impairs T Cell differentiation and prevents experimental autoimmune encephalomyelitis disease progression. PLoS ONE 2017, 12, e0168942. [Google Scholar] [CrossRef]
- Kadayat, T.M.; Banskota, S.; Gurung, P.; Bist, G.; Magar, T.B.T.; Shrestha, A.; Kim, J.-A.; Lee, E.-S. Discovery and structure-activity relationship studies of 2-benzylidene-2, 3-dihydro-1H-inden-1-one and benzofuran-3 (2H)-one derivatives as a novel class of potential therapeutics for inflammatory bowel disease. Eur. J. Med. Chem. 2017, 137, 575–597. [Google Scholar] [CrossRef]
- Banskota, S.; Gautam, J.; Regmi, S.C.; Gurung, P.; Park, M.-H.; Kim, S.J.; Nam, T.-G.; Jeong, B.-S.; Kim, J.-A. BJ-1108, a 6-Amino-2, 4, 5-Trimethylpyridin-3-ol Analog, inhibits serotonin-induced angiogenesis and tumor growth through PI3K/NOX pathway. PLoS ONE 2016, 11, e0148133. [Google Scholar] [CrossRef]
- Wu, X.-F.; Ouyang, Z.-J.; Feng, L.-L.; Chen, G.; Guo, W.-J.; Shen, Y.; Wu, X.-D.; Sun, Y.; Xu, Q. Suppression of NF-κB signaling and NLRP3 inflammasome activation in macrophages is responsible for the amelioration of experimental murine colitis by the natural compound fraxinellone. Toxicol. Appl. Pharm. 2014, 281, 146–156. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Cifuentes-Pagano, E.; DeVallance, E.; de Jesus, D.; Sahoo, S.; Meijles, D.; Koes, D.; Camacho, C.; Ross, M.; St Croix, C. NADPH oxidase 2 inhibitors CPP11G and CPP11H attenuate endothelial cell inflammation & vessel dysfunction and restore mouse hind-limb flow. Redox Biol. 2019, 22, 101143. [Google Scholar] [PubMed]
- Dusi, S.; Donini, M.; Rossi, F. Mechanisms of NADPH oxidase activation in human neutrophils: p67 phox is required for the translocation of Rac 1 but not of Rac 2 from cytosol to the membranes. Biochem. J. 1995, 308, 991–994. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rinckel, L.A.; Faris, S.L.; Hitt, N.D.; Kleinberg, M.E. Rac1 disrupts p67phox/p40phox binding: A novel role for Rac in NADPH oxidase activation. Biochem. Biophys. Res. Commun. 1999, 263, 118–122. [Google Scholar] [CrossRef]
- Park, S.-Y.; Lee, J.-S.; Ko, Y.J.; Kim, A.R.; Choi, M.K.; Kwak, M.-K.; Choi, H.G.; Yong, C.S.; Kim, J.-A. Inhibitory effect of simvastatin on the TNF-α-and angiotensin II-induced monocyte adhesion to endothelial cells is mediated through the suppression of geranylgeranyl isoprenoid-dependent ROS generation. Arch. Pharm. Res. 2008, 31, 195–204. [Google Scholar] [CrossRef]
- Geremia, A.; Biancheri, P.; Allan, P.; Corazza, G.R.; Di Sabatino, A. Innate and adaptive immunity in inflammatory bowel disease. Autoimmun. Rev. 2014, 13, 3–10. [Google Scholar] [CrossRef]
- Alex, P.; Zachos, N.C.; Nguyen, T.; Gonzales, L.; Chen, T.-E.; Conklin, L.S.; Centola, M.; Li, X. Distinct cytokine patterns identified from multiplex profiles of murine DSS and TNBS-induced colitis. Inflamm. Bowel Dis. 2009, 15, 341–352. [Google Scholar] [CrossRef]
- Arab, H.H.; Al-Shorbagy, M.Y.; Abdallah, D.M.; Nassar, N.N. Telmisartan attenuates colon inflammation, oxidative perturbations and apoptosis in a rat model of experimental inflammatory bowel disease. PLoS ONE 2014, 9, e97193. [Google Scholar] [CrossRef] [Green Version]
- Salt, I.P.; Palmer, T.M. Exploiting the anti-inflammatory effects of AMP-activated protein kinase activation. Expert Opin. Investig. Drug 2012, 21, 1155–1167. [Google Scholar] [CrossRef]
- Sansone, P.; Bromberg, J. Targeting the interleukin-6/Jak/stat pathway in human malignancies. J. Clin. Oncol. 2012, 30, 1005. [Google Scholar] [CrossRef] [Green Version]
- Hodge, J.; Kawabata, T.; Krishnaswami, S.; Clark, J.; Telliez, J.; Dowty, M.; Menon, S.; Lamba, M.; Zwillich, S. The mechanism of action of tofacitinib-an oral Janus kinase inhibitor for the treatment of rheumatoid arthritis. Clin. Exp. Rheumatol. 2016, 34, 318–328. [Google Scholar] [PubMed]
- Kawai, T.; Akira, S. Toll-like receptors and their crosstalk with other innate receptors in infection and immunity. Immunity 2011, 34, 637–650. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abreu, M.T. Toll-like receptor signalling in the intestinal epithelium: How bacterial recognition shapes intestinal function. Nat. Rev. Immunol. 2010, 10, 131–144. [Google Scholar] [CrossRef] [PubMed]
- Fink, S.L.; Cookson, B.T. Caspase-1-dependent pore formation during pyroptosis leads to osmotic lysis of infected host macrophages. Cell. Microbiol. 2006, 8, 1812–1825. [Google Scholar] [CrossRef]
- Maloy, K.J.; Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature 2011, 474, 298–306. [Google Scholar] [CrossRef]
- Banskota, S.; Regmi, S.C.; Gautam, J.; Gurung, P.; Lee, Y.J.; Ku, S.K.; Lee, J.H.; Lee, J.; Chang, H.W.; Park, S.J.; et al. Serotonin disturbs colon epithelial tolerance of commensal E. coli by increasing NOX2-derived superoxide. Free Radic. Biol. Med. 2017, 106, 196–207. [Google Scholar] [CrossRef]
- Jeong, B.-S.; Kim, J.-A.; Nam, T.-G. Preparation of pyridinol derivative for treatment of inflammatory bowel disease. World Intellectual Property Organization WO2017123038, 2017. [Google Scholar]
- Pun, N.T.; Park, P.H. Adiponectin inhibits inflammatory cytokines production by Beclin-1 phosphorylation and B-cell lymphoma 2 mRNA destabilization: Role for autophagy induction. Br. J. Pharmacol. 2018, 175, 1066–1084. [Google Scholar]
- Thapa, D.; Lee, J.S.; Park, S.-Y.; Bae, Y.-H.; Bae, S.-K.; Kwon, J.B.; Kim, K.-J.; Kwak, M.-K.; Park, Y.-J.; Choi, H.G. Clotrimazole ameliorates intestinal inflammation and abnormal angiogenesis by inhibiting interleukin-8 expression through a nuclear factor-κB-dependent manner. J. Pharmacol. Exp. Ther. 2008, 327, 353–364. [Google Scholar] [CrossRef] [Green Version]
- Thapa, D.; Lee, J.S.; Park, M.-A.; Cho, M.-Y.; Park, Y.-J.; Choi, H.G.; Jeong, T.C.; Kim, J.-A. Inhibitory effects of clotrimazole on TNF-α-induced adhesion molecule expression and angiogenesis. Arch. Pharm. Res. 2009, 32, 593–603. [Google Scholar] [CrossRef]
- Regmi, S.C.; Park, S.-Y.; Ku, S.K.; Kim, J.-A. Serotonin regulates innate immune responses of colon epithelial cells through Nox2-derived reactive oxygen species. Free Radic. Biol. Med. 2014, 69, 377–389. [Google Scholar] [CrossRef]
Primer | Sequence 5′→3′ |
---|---|
Prkaa1 forward | CCCACCATCACTCCATCTCT |
Prkaa1 reverse | AGCCTGCTTGGCACACTTAT |
Lyz2-Cre mutant | CCCAGAAATGCCAGATTACG |
Lyz2-Cre common | CTTGGGCTGCCAGAATTTCTC |
Lyz2-Cre wild type | TTACAGTCGGCCAGGCTGAC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gurung, P.; Dahal, S.; Chaudhary, P.; Guragain, D.; Karmacharya, U.; Kim, J.-A.; Jeong, B.-S. Potent Inhibitory Effect of BJ-3105, a 6-Alkoxypyridin-3-ol Derivative, on Murine Colitis Is Mediated by Activating AMPK and Inhibiting NOX. Int. J. Mol. Sci. 2020, 21, 3145. https://doi.org/10.3390/ijms21093145
Gurung P, Dahal S, Chaudhary P, Guragain D, Karmacharya U, Kim J-A, Jeong B-S. Potent Inhibitory Effect of BJ-3105, a 6-Alkoxypyridin-3-ol Derivative, on Murine Colitis Is Mediated by Activating AMPK and Inhibiting NOX. International Journal of Molecular Sciences. 2020; 21(9):3145. https://doi.org/10.3390/ijms21093145
Chicago/Turabian StyleGurung, Pallavi, Sadan Dahal, Prakash Chaudhary, Diwakar Guragain, Ujjwala Karmacharya, Jung-Ae Kim, and Byeong-Seon Jeong. 2020. "Potent Inhibitory Effect of BJ-3105, a 6-Alkoxypyridin-3-ol Derivative, on Murine Colitis Is Mediated by Activating AMPK and Inhibiting NOX" International Journal of Molecular Sciences 21, no. 9: 3145. https://doi.org/10.3390/ijms21093145