MiR-21 Is Required for the Epithelial–Mesenchymal Transition in MDA-MB-231 Breast Cancer Cells
Abstract
1. Introduction
2. Results
2.1. miR-21 Decreased Disease-Specific and Overall Survival Rates in Breast Cancer In Vivo and In Vitro
2.2. miR-21 Downregulation Decreased the Colony Size in MDA-MB-231 Cells via Increasing Survival-Related Mechanisms
2.3. miR-21 Promotes EMT
2.4. miR-21 Affects Wnt-11-Mediated Cellular Responses
2.5. Regaining miR-21 Reverses the Metastatic Phenotype of MDA-MB-231 Cells
3. Discussion
4. Materials and Methods
4.1. Overall Survival Data
4.2. Cell Culture
4.3. RNA Extraction and qRT–PCR
4.4. CRISPR/Cas9 Assay
4.5. Genomic Cleavage Assay
4.6. Extracellular Vesicle Isolation
4.7. Nanoparticle Tracking Analysis (NTA)
4.8. Hanging Drop Assay
4.9. Colony Formation
4.10. Western Blot Analysis
4.11. Immunostaining
4.12. Plasmid Transfection for Survival Assay
4.13. Wound Healing Assay
4.14. Determination of ROS Generation
4.15. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
BCa | Breast cancer |
EMT | Epithelial-mesenchymal transition |
EV | Extracellular vesicle |
miR | microRNA |
TNBC | Triple Negative Breast Cancer |
TCGA-BRCA | The Cancer Genome Atlas Breast Invasive Carcinoma |
ROS | Reactive Oxygen Species |
References
- Miller, K.D.; Siegel, R.L.; Khan, R.; Jemal, A. Cancer Statistics. CA Cancer J. Clin. 2018, 70, 7–30. [Google Scholar] [CrossRef]
- Swerdlow, A.J.; Harvey, C.E.; Milne, R.L.; Pottinger, C.A.; Vachon, C.M.; Wilkens, L.R.; Gapstur, S.M.; Johansson, M.; Weiderpass, E.; Winn, D.M. The National Cancer Institute Cohort Consortium: An International Pooling Collaboration of 58 Cohorts from 20 Countries. Cancer Epidemiol. Biomark. Prev. 2018, 27, 1307–1319. [Google Scholar] [CrossRef] [PubMed]
- Maughan, K.L.; Lutterbie, M.A.; Ham, P.S. Treatment of breast cancer. Am. Fam. Phys. 2010, 81, 1339–1346. [Google Scholar]
- Luque-Bolivar, A.; Pérez-Mora, E.; Villegas, V.E.; Rondón-Lagos, M. Resistance and Overcoming Resistance in Breast Cancer. Breast Cancer Targ. Ther. 2020, 12, 211–229. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.-M.; Oh, M.H.; Go, J.-H.; Han, K.; Choi, S.-Y. Molecular subtypes of triple-negative breast cancer: Understanding of subtype categories and clinical implication. Genes Genom. 2020, 42, 1381–1387. [Google Scholar] [CrossRef]
- Treeck, O.; Schüler-Toprak, S.; Ortmann, O. Estrogen Actions in Triple-Negative Breast Cancer. Cells 2020, 9, 2358. [Google Scholar] [CrossRef] [PubMed]
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
- Chen, C.-Z.; Li, L.; Lodish, H.F.; Bartel, D.P. MicroRNAs Modulate Hematopoietic Lineage Differentiation. Science 2004, 303, 83–86. [Google Scholar] [CrossRef]
- Corsten, M.F.; Dennert, R.; Jochems, S.; Kuznetsova, T.; Devaux, Y.; Hofstra, L.; Wagner, D.R.; Staessen, J.A.; Heymans, S.; Schroen, B. Circulating MicroRNA-208b and MicroRNA-499 Reflect Myocardial Damage in Cardiovascular Disease. Circ. Cardiovasc. Genet. 2010, 3, 499–506. [Google Scholar] [CrossRef]
- Alevizos, I.; Illei, G.G. MicroRNAs as biomarkers in rheumatic diseases. Nat. Rev. Rheumatol. 2010, 6, 391–398. [Google Scholar] [CrossRef]
- Rupaimoole, R.; Slack, R.R.F.J. MicroRNA therapeutics: Towards a new era for the management of cancer and other diseases. Nat. Rev. Drug Discov. 2017, 16, 203–222. [Google Scholar] [CrossRef] [PubMed]
- Sethi, S.; Sethi, S.; Bluth, M.H. Clinical Implication of MicroRNAs in Molecular Pathology: An Update for 2018. Clin. Lab. Med. 2018, 38, 237–251. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.H.; Jung, Y.D.; Choi, Y.S.; Lee, Y.M. Targeting of RUNX3 by miR-130a and miR-495 cooperatively increases cell proliferation and tumor angiogenesis in gastric cancer cells. Oncotarget 2015, 6, 33269–33278. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.; Zhou, L.; Cheng, Y.; Sun, L.; Fan, J.; Liang, J.; Guo, M.; Liu, N.; Zhu, L. MicroRNA-543 acts as an oncogene by targeting PAQR3 in hepatocellular carcinoma. Am. J. Cancer Res. 2014, 4, 897–906. [Google Scholar]
- Li, P.-L.; Zhang, X.; Wang, L.-L.; Du, L.-T.; Yang, Y.-M.; Li, J.; Wang, C.X. MicroRNA-218 is a prognostic indicator in colorectal cancer and enhances 5-fluorouracil-induced apoptosis by targetingBIRC5. Carcinogenesis 2015, 36, 1484–1493. [Google Scholar] [CrossRef]
- Liu, S.-Y.; Li, X.-Y.; Chen, W.-Q.; Hu, H.; Luo, B.; Shi, Y.-X.; Wu, T.-W.; Li, Y.; Kong, Q.-Z.; Lu, H.-D.; et al. Demethylation of the MIR145 promoter suppresses migration and invasion in breast cancer. Oncotarget 2017, 8, 61731–61741. [Google Scholar] [CrossRef]
- Kunita, A.; Morita, S.; Irisa, T.U.; Goto, A.; Niki, T.; Takai, D.; Nakajima, J.; Fukayama, M. MicroRNA-21 in cancer-associated fibroblasts supports lung adenocarcinoma progression. Sci. Rep. 2018, 8, 8838. [Google Scholar] [CrossRef]
- Gao, Z.; Liu, H.; Shi, Y.; Yin, L.; Zhu, Y.; Liu, R. Identification of Cancer Stem Cell Molecular Markers and Effects of hsa-miR-21-3p on Stemness in Esophageal Squamous Cell Carcinoma. Cancers 2019, 11, 518. [Google Scholar] [CrossRef]
- Wu, Y.; Song, Y.; Xiong, Y.; Wang, X.; Xu, K.; Han, B.; Bai, Y.; Liming, Z.; Zhang, Y.; Zhou, L. MicroRNA-21 (Mir-21) Promotes Cell Growth and Invasion by Repressing Tumor Suppressor PTEN in Colorectal Cancer. Cell. Physiol. Biochem. 2017, 43, 945–958. [Google Scholar] [CrossRef]
- Bourguignon, L.Y.W. Matrix Hyaluronan Promotes Specific MicroRNA Upregulation Leading to Drug Resistance and Tumor Progression. Int. J. Mol. Sci. 2016, 17, 517. [Google Scholar] [CrossRef]
- Dart, D.A.; Uysal-Onganer, P.; Jiang, W.G. Prostate-specific PTen deletion in mice activates inflammatory microRNA expression pathways in the epithelium early in hyperplasia development. Oncogenesis 2017, 6, 400. [Google Scholar] [CrossRef] [PubMed]
- Arisan, E.D.; Rencuzogullari, O.; Freitas, I.L.; Radzali, S.; Keskin, B.; Kothari, A.; Warford, A.; Uysal-Onganer, P. Upregulated Wnt-11 and miR-21 Expression Trigger Epithelial Mesenchymal Transition in Aggressive Prostate Cancer Cells. Biology 2020, 9, 52. [Google Scholar] [CrossRef] [PubMed]
- Uysal-Onganer, P.; MacLatchy, A.; Mahmoud, R.; Kraev, I.; Thompson, P.R.; Inal, J.M.; Lange, S. Peptidylarginine Deiminase Isozyme-Specific PAD2, PAD3 and PAD4 Inhibitors Differentially Modulate Extracellular Vesicle Signatures and Cell Invasion in Two Glioblastoma Multiforme Cell Lines. Int. J. Mol. Sci. 2020, 21, 1495. [Google Scholar] [CrossRef]
- Kosgodage, U.S.; Uysal-Onganer, P.; MacLatchy, A.; Kraev, I.; Chatterton, N.P.; Nicholas, A.P.; Inal, J.; Lange, S. Peptidylarginine Deiminases Post-Translationally Deiminate Prohibitin and Modulate Extracellular Vesicle Release and MicroRNAs in Glioblastoma Multiforme. Int. J. Mol. Sci. 2018, 20, 103. [Google Scholar] [CrossRef]
- Brabletz, T.; Kalluri, R.; Nieto, M.A.; Weinberg, R.A. EMT in cancer. Nat. Rev. Cancer 2018, 18, 128–134. [Google Scholar] [CrossRef]
- Ye, X.; Brabletz, T.; Kang, Y.; Longmore, G.D.; Nieto, M.A.; Stanger, B.Z.; Yang, J.; Weinberg, R.A. Upholding a role for EMT in breast cancer metastasis. Nat. Cell Biol. 2017, 547, e1–e3. [Google Scholar] [CrossRef] [PubMed]
- Piasecka, D.; Braun, M.; Kordek, R.; Sadej, R.; Romanska, H. MicroRNAs in regulation of triple-negative breast cancer progression. J. Cancer Res. Clin. Oncol. 2018, 144, 1401–1411. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Settleman, J. EMT, cancer stem cells and drug resistance: An emerging axis of evil in the war on cancer. Oncogene 2010, 29, 4741–4751. [Google Scholar] [CrossRef]
- Seton-Rogers, S. Epithelial-mesenchymal transition: Untangling EMT’s functions. Nat. Rev. Cancer 2016, 16, 1. [Google Scholar] [CrossRef]
- Lamouille, S.; Xu, J.; Derynck, R. Molecular mechanisms of epithelial–mesenchymal transition. Nat. Rev. Mol. Cell Biol. 2014, 15, 178–196. [Google Scholar] [CrossRef]
- Felipe Lima, J.; Nofech-Mozes, S.; Bayani, J.; Bartlett, J.M.S. EMT in breast carcinoma—A review. J. Clin. Med. 2016, 5, 65. [Google Scholar] [CrossRef]
- Qi, L.; Bart, J.; Tan, L.P.; Platteel, I.; Van Der Sluis, T.; Huitema, S.; Harms, G.; Fu, L.; Hollema, H.; Berg, A.V.D. Expression of miR-21 and its targets (PTEN, PDCD4, TM1) in flat epithelial atypia of the breast in relation to ductal carcinoma in situ and invasive carcinoma. BMC Cancer 2009, 9, 163. [Google Scholar] [CrossRef]
- Huang, T.-H.; Wu, F.; Loeb, G.B.; Hsu, R.; Heidersbach, A.; Brincat, A.; Horiuchi, D.; Lebbink, R.J.; Mo, Y.-Y.; Goga, A.; et al. Up-regulation of miR-21 by HER2/neu Signaling Promotes Cell Invasion. J. Biol. Chem. 2009, 284, 18515–18524. [Google Scholar] [CrossRef]
- Wang, H.; Tan, Z.; Hu, H.; Liu, H.; Wu, T.; Zheng, C.; Wang, X.; Luo, Z.; Wang, J.; Liu, S.; et al. microRNA-21 promotes breast cancer proliferation and metastasis by targeting LZTFL1. BMC Cancer 2019, 19, 1–13. [Google Scholar] [CrossRef] [PubMed]
- MacKenzie, T.A.; Schwartz, G.N.; Calderone, H.M.; Graveel, C.R.; Winn, M.E.; Hostetter, G.; Wells, W.A.; Sempere, L.F. Stromal expression of miR-21 identifies high-risk group in triple-negative breast cancer. Am. J. Pathol. 2014, 184, 3217–3225. [Google Scholar] [CrossRef] [PubMed]
- Uysal-Onganer, P.; Kawano, Y.; Caro, M.; Walker, M.M.; Diez, S.; Darrington, R.S.; Waxman, J.; Kypta, R.M. Wnt-11 promotes neuroendocrine-like differentiation, survival and migration of prostate cancer cells. Mol. Cancer 2010, 9, 55. [Google Scholar] [CrossRef] [PubMed]
- Guo, X.; Wang, X.F. Signaling cross-talk between TGF-beta/BMP and other pathways. Cell Res. 2009, 19, 71–88. [Google Scholar] [CrossRef] [PubMed]
- Krichevsky, A.M.; Gabriely, G. miR-21: A small multi-faceted RNA. J. Cell. Mol. Med. 2008, 13, 39–53. [Google Scholar] [CrossRef]
- Zhan, T.; Rindtorff, N.; Boutros, M. Wnt signaling in cancer. Oncogene 2017, 36, 1461–1473. [Google Scholar] [CrossRef]
- Yoshioka, T.; Umekita, Y.; Ohi, Y.; Souda, M.; Sagara, Y.; Sagara, Y.; Sagara, Y.; Rai, Y.; Tanimoto, A. Aldehyde dehydrogenase 1 expression is a predictor of poor prognosis in node-positive breast cancers: A long-term follow-up study. Histopathology 2011, 58, 608–616. [Google Scholar] [CrossRef]
- Wang, Y.; He, X.; Ngeow, J.; Eng, C. GATA2 negatively regulates PTEN by preventing nuclear translocation of androgen receptor and by androgen-independent suppression of PTEN transcription in breast cancer. Hum. Mol. Genet. 2011, 21, 569–576. [Google Scholar] [CrossRef] [PubMed]
- Han, M.; Liu, M.; Wang, Y.; Chen, X.; Xu, J.; Sun, Y.; Zhao, L.; Qu, H.; Fan, Y.; Wu, C. Antagonism of miR-21 reverses epithelial-mesenchymal transition and cancer stem cell phenotype through AKT/ERK1/2inactivation by targeting PTEN. PLoS ONE 2012, 7, e39520. [Google Scholar]
- Inal, J.M.; Kosgodage, U.; Azam, S.; Stratton, D.; Antwi-Baffour, S.; Lange, S. Blood/plasma secretome and microvesicles. Biochim. Biophys. Acta Proteins Proteom. 2013, 1834, 2317–2325. [Google Scholar] [CrossRef]
- Fatima, F.; Nawaz, M. Vesiculated Long Non-Coding RNAs: Offshore Packages Deciphering Trans-Regulation between Cells, Cancer Progression and Resistance to Therapies. Non-Coding RNA 2017, 3, 10. [Google Scholar] [CrossRef]
- Barbagallo, D.; Caponnetto, A.; Cirnigliaro, M.; Brex, D.; Barbagallo, C.; D’Angeli, F.; Morrone, A.; Caltabiano, R.; Barbagallo, G.M.; Ragusa, M.; et al. CircSMARCA5 Inhibits Migration of Glioblastoma Multiforme Cells by Regulating a Molecular Axis Involving Splicing Factors SRSF1/SRSF3/PTB. Int. J. Mol. Sci. 2018, 19, 480. [Google Scholar] [CrossRef]
- De Mooij, T.; Peterson, T.E.; Evans, J.; McCutcheon, B.; Parney, I.F. Short non-coding RNA sequencing of glioblastoma extracellular vesicles. J. Neuro Oncol. 2020, 146, 253–263. [Google Scholar] [CrossRef] [PubMed]
- Bin Zha, Q.; Yao, Y.F.; Ren, Z.J.; Li, X.J.; Tang, J.H. Extracellular vesicles: An overview of biogenesis, function, and role in breast cancer. Tumor Biol. 2017, 39. [Google Scholar] [CrossRef]
- Ozawa, P.M.M.; Alkhilaiwi, F.; Cavalli, I.J.; Malheiros, D.; de Souza Fonseca Ribeiro, E.M.; Cavalli, L.R. Extracellular vesicles from triple-negative breast cancer cells promote proliferation and drug resistance in non-tumorigenic breast cells. Breast Cancer Res. Treat. 2018, 172, 713–723. [Google Scholar] [CrossRef]
- Kholia, S.; Jorfi, S.; Thompson, P.R.; Causey, C.P.; Nicholas, A.P.; Inal, J.; Lange, S. A Novel Role for Peptidylarginine Deiminases (PADs) in Microvesicle Release: A Therapeutic Potential for PAD Inhibitors to Sensitize Prostate Cancer Cells to Chemotherapy. J. Extracell. Vesicles 2015, 4, 26192. [Google Scholar] [CrossRef]
- Kosgodage, U.S.; Trindade, R.P.; Thompson, P.R.; Inal, J.; Lange, S. Chloramidine/Bisindolylmaleimide-I-Mediated Inhibition of Exosome and Microvesicle Release and Enhanced Efficacy of Cancer Chemotherapy. Int. J. Mol. Sci. 2017, 18, 1007. [Google Scholar] [CrossRef] [PubMed]
- Kosgodage, U.S.; Mould, R.; Henley, A.B.; Nunn, A.V.; Guy, G.W.; Thomas, E.L.; Inal, J.M.; Bell, J.D.; Lange, S. Cannabidiol (CBD) Is a Novel Inhibitor for Exosome and Microvesicle (EMV) Release in Cancer. Front. Pharmacol. 2018, 9, 889. [Google Scholar] [CrossRef] [PubMed]
- Kosgodage, U.S.; Uysal-Onganer, P.; MacLatchy, A.; Mould, R.; Nunn, A.V.; Guy, G.W.; Kraev, I.; Chatterton, N.P.; Thomas, E.L.; Inal, J.; et al. Cannabidiol Affects Extracellular Vesicle Release, miR21 and miR126, and Reduces Prohibitin Protein in Glioblastoma Multiforme Cells. Transl. Oncol. 2019, 12, 513–522. [Google Scholar] [CrossRef] [PubMed]
- Federici, C.; Petrucci, F.; Caimi, S.; Cesolini, A.; Logozzi, M.; Borghi, M.; D’Ilio, S.; Lugini, L.; Violante, N.; Azzarito, T.; et al. Exosome release and low pH belong to a framework of resistance of human melanoma cells to cisplatin. PLoS ONE 2014, 9, e88193. [Google Scholar] [CrossRef]
- Jorfi, S.; Ansa-Addo, E.A.; Kholia, S.; Stratton, D.; Valley, S.; Lange, S.; Inal, J. Inhibition of microvesiculation sensitizes prostate cancer cells to chemotherapy and reduces docetaxel dose required to limit tumor growth in vivo. Sci. Rep. 2015, 5, 13006. [Google Scholar] [CrossRef]
- Koch, R.; Aung, T.; Vogel, D.; Chapuy, B.; Wenzel, D.; Becker, S.; Sinzig, U.; Venkataramani, V.; Von Mach, T.; Jacob, R.; et al. Nuclear Trapping through Inhibition of Exosomal Export by Indomethacin Increases Cytostatic Efficacy of Doxorubicin and Pixantrone. Clin. Cancer Res. 2016, 22, 395–404. [Google Scholar] [CrossRef]
- Muralidharan-Chari, V.; Kohan, H.G.; Asimakopoulos, A.G.; Sudha, T.; Sell, S.; Kannan, K.; Boroujerdi, M.; Davis, P.J.; Mousa, S.A. Microvesicle removal of anticancer drugs contributes to drug resistance in human pancreatic cancer cells. Oncotarget 2016, 7, 50365–50379. [Google Scholar] [CrossRef]
- Maacha, S.; Bhat, A.A.; Jimenez, L.; Raza, A.; Haris, M.; Uddin, S.; Grivel, J.-C. Extracellular vesicles-mediated intercellular communication: Roles in the tumor microenvironment and anti-cancer drug resistance. Mol. Cancer 2019, 18, 1–16. [Google Scholar] [CrossRef]
- Catalano, M.; O’Driscoll, L. Inhibiting extracellular vesicles formation and release: A review of EV inhibitors. J. Extracell. Vesicles 2020, 9, 1703244. [Google Scholar] [CrossRef]
- Goldman, M.J.; Craft, B.; Hastie, M.; Repečka, K.; McDade, F.; Kamath, A.; Banerjee, A.; Luo, Y.; Rogers, D.; Brooks, A.N.; et al. Visualizing and interpreting cancer genomics data via the Xena platform. Nat. Biotechnol. 2020, 38, 675–678. [Google Scholar] [CrossRef] [PubMed]
- Patel, S.; Alam, A.; Pant, R.; Chattopadhyay, S. Wnt Signaling and Its Significance Within the Tumor Microenvironment: Novel Therapeutic Insights. Front. Immunol. 2019, 10, 2872. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Lin, C.; Liu, Z.-R. P68 RNA Helicase Mediates PDGF-Induced Epithelial Mesenchymal Transition by Displacing Axin from β-Catenin. Cell 2006, 127, 139–155. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Zhang, Q.; Xu, J.; Guo, L.; Li, X. Clinical significance of serum miR-21 in breast cancer compared with CA153 and CEA. Chin. J. Cancer Res. 2013, 25, 743–748. [Google Scholar]
- Takahashi, R.-U. Considering Exosomal miR-21 as a Biomarker for Cancer. J. Clin. Med. 2016, 5, 42. [Google Scholar] [CrossRef]
- Melo, S.A.; Sugimoto, H.; O’Connell, J.T.; Kato, N.; Villanueva, A.; Vidal, A.; Qiu, L.; Vitkin, E.; Perelman, L.T.; Melo, C.A.; et al. Cancer Exosomes Perform Cell-Independent MicroRNA Biogenesis and Promote Tumorigenesis. Cancer Cell 2014, 26, 707–721. [Google Scholar] [CrossRef]
- Syn, N.; Wang, L.; Sethi, G.; Thiery, J.P.; Goh, B.-C. Exosome-Mediated Metastasis: From Epithelial–Mesenchymal Transition to Escape from Immunosurveillance. Trends Pharmacol. Sci. 2016, 37, 606–617. [Google Scholar] [CrossRef] [PubMed]
- Tokuhisa, M.; Ichikawa, Y.; Kosaka, N.; Ochiya, T.; Yashiro, M.; Hirakawa, K.; Kosaka, T.; Makino, H.; Akiyama, H.; Kunisaki, C.; et al. Exosomal miRNAs from Peritoneum Lavage Fluid as Potential Prognostic Biomarkers of Peritoneal Metastasis in Gastric Cancer. PLoS ONE 2015, 10, e0130472. [Google Scholar] [CrossRef] [PubMed]
- Shao, Y.; Chen, T.; Zheng, X.; Yang, S.; Xu, K.; Chen, X.; Xu, F.; Wang, L.; Shen, Y.; Wang, T.; et al. Colorectal cancer-derived small extracellular vesicles establish an inflammatory premetastatic niche in liver metastasis. Carcinogenesis 2018, 39, 1368–1379. [Google Scholar] [CrossRef]
- Qian, B.; Katsaros, D.; Lu, L.; Preti, M.; Durando, A.; Arisio, R.; Mu, L.; Yu, H. High miR-21 expression in breast cancer associated with poor disease-free survival in early stage disease and high TGF-β1. Breast Cancer Res. Treat. 2008, 117, 131–140. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Chaerkady, R.; Beer, M.A.; Mendell, J.T.; Pandey, A. Identification of miR-21 targets in breast cancer cells using a quantitative proteomic approach. Proteomics 2009, 9, 1374–1384. [Google Scholar] [CrossRef]
- Zhu, S.; Wu, H.; Wu, F.; Nie, D.; Sheng, S.; Mo, Y.-Y. MicroRNA-21 targets tumor suppressor genes in invasion and metastasis. Cell Res. 2008, 18, 350–359. [Google Scholar] [CrossRef] [PubMed]
- Wu, D.; Shi, M.; Fan, X.-D. Mechanism of miR-21 via Wnt/β-catenin signaling pathway in human A549 lung cancer cells and Lewis lung carcinoma in mice. Asian Pac. J. Trop. Med. 2015, 8, 479–484. [Google Scholar] [CrossRef] [PubMed]
- Allache, R.; Lachance, S.; Guyot, M.C.; De Marco, P.; Merello, E.; Justice, M.J.; Capra, V.; Kibar, Z. Novel mutations in Lrp6 orthologs in mouse and human neural tube defects affect a highly dosage-sensitive Wnt non-canonical planar cell polarity pathway. Hum. Mol. Genet. 2013, 23, 1687–1699. [Google Scholar] [CrossRef] [PubMed]
- Katoh, M. WNT Signaling Pathway and Stem Cell Signaling Network. Clin. Cancer Res. 2007, 13, 4042–4045. [Google Scholar] [CrossRef] [PubMed]
- Fang, H.; Xie, J.; Zhang, M.; Zhao, Z.; Wan, Y.; Yao, Y. miRNA-21 promotes proliferation and invasion of triple-negative breast cancer cells through targeting PTEN. Am. J. Transl. Res. 2017, 9, 953–961. [Google Scholar]
- Ohi, Y.; Umekita, Y.; Yoshioka, T.; Souda, M.; Rai, Y.; Sagara, Y.; Sagara, Y.; Sagara, Y.; Tanimoto, A. Aldehyde dehydrogenase 1 expression predicts poor prognosis in triple-negative breast cancer. Histopathology 2011, 59, 776–780. [Google Scholar] [CrossRef]
- Fleisher, B.; Clarke, C.; Ait-Oudhia, S. Current advances in biomarkers for targeted therapy in triple-negative breast cancer. Breast Cancer Targ. Ther. 2016, 8, 183–197. [Google Scholar] [CrossRef]
- Si, M.-L.; Zhu, S.; Wu, H.; Lu, Z.; Wu, F.; Mo, Y.-Y. miR-21-mediated tumor growth. Oncogene 2007, 26, 2799–2803. [Google Scholar] [CrossRef]
- Blower, P.E.; Chung, J.-H.; Verducci, J.S.; Lin, S.; Park, J.-K.; Dai, Z.; Liu, C.-G.; Schmittgen, T.D.; Reinhold, W.C.; Croce, C.M.; et al. MicroRNAs modulate the chemosensitivity of tumor cells. Mol. Cancer Ther. 2008, 7, 1–9. [Google Scholar] [CrossRef]
- Shi, C.; Liang, Y.; Yang, J.; Xia, Y.; Chen, H.; Han, H.; Yang, Y.; Wu, W.; Gao, R.; Qin, H. MicroRNA-21 Knockout Improve the Survival Rate in DSS Induced Fatal Colitis through Protecting against Inflammation and Tissue Injury. PLoS ONE 2013, 8, e66814. [Google Scholar] [CrossRef]
- Huo, W.; Zhao, G.; Yin, J.; Ouyang, X.; Wang, Y.; Yang, C.; Wang, B.; Dong, P.; Wang, Z.; Watari, H.; et al. Lentiviral CRISPR/Cas9 vector mediated miR-21 gene editing inhibits the epithelial to mesenchymal transition in ovarian cancer cells. J. Cancer 2017, 8, 57–64. [Google Scholar] [CrossRef]
- Rodriguez-Bravo, V.; Carceles-Cordon, M.; Hoshida, V.R.-B.Y.; Cordon-Cardo, C.; Galsky, M.D.; Domingodomenech, J. The role of GATA2 in lethal prostate cancer aggressiveness. Nat. Rev. Urol. 2017, 14, 38–48. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.-W.; Wang, J.-X.; Yin, X.; Qiu, S.-J.; Wu, H.; Liao, R.; Yi, Y.; Xiao, Y.-S.; Zhou, J.; Zhang, B.-H.; et al. Decreased Expression of GATA2 Promoted Proliferation, Migration and Invasion of HepG2 In Vitro and Correlated with Poor Prognosis of Hepatocellular Carcinoma. PLoS ONE 2014, 9, e87505. [Google Scholar] [CrossRef] [PubMed]
- Xu, K.; Wang, J.; Gao, J.; Di, J.; Jiang, B.; Chen, L.; Wang, Z.; Wang, A.; Wu, F.; Wu, W.; et al. GATA binding protein 2 overexpression is associated with poor prognosis in KRAS mutant colorectal cancer. Oncol. Rep. 2016, 36, 1672–1678. [Google Scholar] [CrossRef] [PubMed]
- Robinson, J.L.; Tzou, K.S.; Parker, A.S.; Heckman, M.G.; Wu, K.J.; Hilton, T.W.; Pisansky, T.M.; Schild, S.E.; Peterson, J.L.; Vallow, L.; et al. GATA2 expression and biochemical recurrence following salvage radiation therapy for relapsing prostate cancer. Br. J. Radiol. 2017, 90, 20170174. [Google Scholar] [CrossRef]
- Casciello, F.; Al-Ejeh, F.; Kelly, G.; Brennan, D.J.; Ngiow, S.F.; Young, A.; Stoll, T.; Windloch, K.; Hill, M.M.; Smyth, M.J.; et al. G9a drives hypoxia-mediated gene repression for breast cancer cell survival and tumorigenesis. Proc. Natl. Acad. Sci. USA 2017, 114, 7077–7082. [Google Scholar] [CrossRef]
- Gao, X.; Li, X.; Qian, C.; Li, F.; Zhang, Y.; Dang, L.; Xiao, X.; Liu, F.; Li, H.; Zhang, X. MiR-21 functions oppositely in proliferation and differentiation of neural stem/precursor cells via regulating AKT and GSK-3β. Cell. Mol. Biol. 2016, 62, 144–149. [Google Scholar] [CrossRef] [PubMed]
- Dai, L.; Chen, F.; Zheng, Y.; Zhang, D.; Qian, B.; Ji, H.; Long, F.; Creţoiu, D. miR-21 regulates growth and EMT in lung cancer cells via PTEN/Akt/GSK3β signaling. Front. Biosci. 2019, 24, 1426–1439. [Google Scholar]
- Tang, Q.; Ouyang, H.; He, D.; Yu, C.; Tang, G. MicroRNA-based potential diagnostic, prognostic and therapeutic applications in triple-negative breast cancer. Artif. Cells Nanomed. Biotechnol. 2019, 47, 2800–2809. [Google Scholar] [CrossRef]
- Shu, D.; Li, H.; Shu, Y.; Xiong, G.; Carson, I.W.E.; Haque, F.; Xu, R.; Guo, P. Systemic Delivery of Anti-miRNA for Suppression of Triple Negative Breast Cancer Utilizing RNA Nanotechnology. ACS Nano 2015, 9, 9731–9740. [Google Scholar] [CrossRef]
- Lü, L.; Mao, X.; Shi, P.; He, B.; Xu, K.; Zhang, S.; Wang, J. MicroRNAs in the prognosis of triple-negative breast cancer. Medicine 2017, 96, e7085. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Yue, J.; Sheng, Y.; Ren, A.; Penmatsa, S. A miR-21 hairpin structure-based gene knockdown vector. Biochem. Biophys. Res. Commun. 2010, 394, 667–672. [Google Scholar] [CrossRef] [PubMed]
- Théry, C.; Witwer, K.W.; Aikawa, E.; Alcaraz, M.J.; Anderson, J.D.; Andriantsitohaina, R.; Antoniou, A.; Arab, T.; Archer, F.; Atkin-Smith, G.K.; et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): A position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J. Extracell. Vesicles 2018, 7, 1535750. [Google Scholar] [CrossRef] [PubMed]
gRNA | RNA Sequence |
---|---|
miR-21 gRNA1 | CTCATGGCAACACCAGTCGA |
miR-21 gRNA2 | CTCATGGCAACACCAGTCGA |
miR-21 gRNA3 | ATGTCAGACAGCCCATCGAC |
miR-21 gRNA4 | ATGTTGACTGTTGAATCTCA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Arisan, E.D.; Rencuzogullari, O.; Cieza-Borrella, C.; Miralles Arenas, F.; Dwek, M.; Lange, S.; Uysal-Onganer, P. MiR-21 Is Required for the Epithelial–Mesenchymal Transition in MDA-MB-231 Breast Cancer Cells. Int. J. Mol. Sci. 2021, 22, 1557. https://doi.org/10.3390/ijms22041557
Arisan ED, Rencuzogullari O, Cieza-Borrella C, Miralles Arenas F, Dwek M, Lange S, Uysal-Onganer P. MiR-21 Is Required for the Epithelial–Mesenchymal Transition in MDA-MB-231 Breast Cancer Cells. International Journal of Molecular Sciences. 2021; 22(4):1557. https://doi.org/10.3390/ijms22041557
Chicago/Turabian StyleArisan, Elif Damla, Ozge Rencuzogullari, Clara Cieza-Borrella, Francesc Miralles Arenas, Miriam Dwek, Sigrun Lange, and Pinar Uysal-Onganer. 2021. "MiR-21 Is Required for the Epithelial–Mesenchymal Transition in MDA-MB-231 Breast Cancer Cells" International Journal of Molecular Sciences 22, no. 4: 1557. https://doi.org/10.3390/ijms22041557
APA StyleArisan, E. D., Rencuzogullari, O., Cieza-Borrella, C., Miralles Arenas, F., Dwek, M., Lange, S., & Uysal-Onganer, P. (2021). MiR-21 Is Required for the Epithelial–Mesenchymal Transition in MDA-MB-231 Breast Cancer Cells. International Journal of Molecular Sciences, 22(4), 1557. https://doi.org/10.3390/ijms22041557