Different Involvement of Vimentin during Invasion by Listeria monocytogenes at the Blood–Brain and the Blood–Cerebrospinal Fluid Barriers In Vitro
Abstract
:1. Introduction
2. Results
2.1. HBMEC and HIBCPP Cells Express Proteins Relevant for Lm Invasion
2.2. Modulation of Surface Vimentin Reduces the Invasion of Lm into HBMEC
2.3. Different Internalins Are Required for Invasion of Lm into HBMEC and HIBCPP Cells
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains, Construction of EGD-e ΔinlF, and Bacterial Growth Conditions
4.2. Cell Culture of HBMEC and HIBCPP Cells
4.3. Measurement of Barrier Function
4.4. Semiquantitative RT-PCR
4.5. Immunoblot
4.6. Immunofluorescence
4.7. Infection of HBMEC and HIBCPP Cells with Lm
4.8. Measurement of Cell Viability
4.9. Determination of Bacterial Invasion by Double Immunofluorescence
4.10. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Radoshevich, L.; Cossart, P. Listeria monocytogenes: Towards a complete picture of its physiology and pathogenesis. Nat. Rev. Microbiol. 2018, 16, 32–46. [Google Scholar] [CrossRef] [PubMed]
- Banovic, F.; Schroten, H.; Schwerk, C. Potential Roles and Functions of Listerial Virulence Factors during Brain Entry. Toxins 2020, 12, 297. [Google Scholar] [CrossRef] [PubMed]
- Schlech, W.F., 3rd; Lavigne, P.M.; Bortolussi, R.A.; Allen, A.C.; Haldane, E.V.; Wort, A.J.; Hightower, A.W.; Johnson, S.E.; King, S.H.; Nicholls, E.S.; et al. Epidemic listeriosis--evidence for transmission by food. N. Engl. J. Med. 1983, 308, 203–206. [Google Scholar] [CrossRef] [PubMed]
- Drevets, D.A.; Bronze, M.S. Listeria monocytogenes: Epidemiology, human disease, and mechanisms of brain invasion. FEMS Immunol. Med. Microbiol. 2008, 53, 151–165. [Google Scholar] [CrossRef] [Green Version]
- Bierne, H.; Milohanic, E.; Kortebi, M. To Be Cytosolic or Vacuolar: The Double Life of Listeria monocytogenes. Front. Cell. Infect. Microbiol. 2018, 8, 136. [Google Scholar] [CrossRef] [Green Version]
- Drevets, D.A. Listeria monocytogenes virulence factors that stimulate endothelial cells. Infect. Immun. 1998, 66, 232–238. [Google Scholar] [CrossRef] [Green Version]
- Berche, P. Bacteremia is required for invasion of the murine central nervous system by Listeria monocytogenes. Microb. Pathog. 1995, 18, 323–336. [Google Scholar] [CrossRef]
- Disson, O.; Lecuit, M. Targeting of the central nervous system by Listeria monocytogenes. Virulence 2012, 3, 213–221. [Google Scholar] [CrossRef] [Green Version]
- Dando, S.J.; Mackay-Sim, A.; Norton, R.; Currie, B.J.; St John, J.A.; Ekberg, J.A.; Batzloff, M.; Ulett, G.C.; Beacham, I.R. Pathogens Penetrating the Central Nervous System: Infection Pathways and the Cellular and Molecular Mechanisms of Invasion. Clin. Microbiol. Rev. 2014, 27, 691–726. [Google Scholar] [CrossRef] [Green Version]
- Grundler, T.; Quednau, N.; Stump, C.; Orian-Rousseau, V.; Ishikawa, H.; Wolburg, H.; Schroten, H.; Tenenbaum, T.; Schwerk, C. The surface proteins InlA and InlB are interdependently required for polar basolateral invasion by Listeria monocytogenes in a human model of the blood-cerebrospinal fluid barrier. Microbes Infect. Inst. Pasteur 2013, 15, 291–301. [Google Scholar] [CrossRef]
- Ghersi-Egea, J.F.; Strazielle, N.; Catala, M.; Silva-Vargas, V.; Doetsch, F.; Engelhardt, B. Molecular anatomy and functions of the choroidal blood-cerebrospinal fluid barrier in health and disease. Acta Neuropathol. 2018, 135, 337–361. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saunders, N.R.; Dziegielewska, K.M.; Mollgard, K.; Habgood, M.D. Physiology and molecular biology of barrier mechanisms in the fetal and neonatal brain. J. Physiol. 2018, 596, 5723–5756. [Google Scholar] [CrossRef] [Green Version]
- Greiffenberg, L.; Goebel, W.; Kim, K.S.; Weiglein, I.; Bubert, A.; Engelbrecht, F.; Stins, M.; Kuhn, M. Interaction of Listeria monocytogenes with human brain microvascular endothelial cells: InlB-dependent invasion, long-term intracellular growth, and spread from macrophages to endothelial cells. Infect. Immun. 1998, 66, 5260–5267. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bergmann, B.; Raffelsbauer, D.; Kuhn, M.; Goetz, M.; Hom, S.; Goebel, W. InlA- but not InlB-mediated internalization of Listeria monocytogenes by non-phagocytic mammalian cells needs the support of other internalins. Mol. Microbiol. 2002, 43, 557–570. [Google Scholar] [CrossRef] [PubMed]
- Dinner, S.; Kaltschmidt, J.; Stump-Guthier, C.; Hetjens, S.; Ishikawa, H.; Tenenbaum, T.; Schroten, H.; Schwerk, C. Mitogen-activated protein kinases are required for effective infection of human choroid plexus epithelial cells by Listeria monocytogenes. Microbes Infect. Inst. Pasteur 2017, 19, 18–33. [Google Scholar] [CrossRef] [PubMed]
- Bierne, H.; Sabet, C.; Personnic, N.; Cossart, P. Internalins: A complex family of leucine-rich repeat-containing proteins in Listeria monocytogenes. Microbes Infect. Inst. Pasteur 2007, 9, 1156–1166. [Google Scholar] [CrossRef]
- Camejo, A.; Carvalho, F.; Reis, O.; Leitao, E.; Sousa, S.; Cabanes, D. The arsenal of virulence factors deployed by Listeria monocytogenes to promote its cell infection cycle. Virulence 2011, 2, 379–394. [Google Scholar] [CrossRef] [Green Version]
- Mengaud, J.; Ohayon, H.; Gounon, P.; Mege, R.M.; Cossart, P. E-cadherin is the receptor for internalin, a surface protein required for entry of L. monocytogenes into epithelial cells. Cell 1996, 84, 923–932. [Google Scholar] [CrossRef] [Green Version]
- Shen, Y.; Naujokas, M.; Park, M.; Ireton, K. InIB-dependent internalization of Listeria is mediated by the Met receptor tyrosine kinase. Cell 2000, 103, 501–510. [Google Scholar] [CrossRef] [Green Version]
- Greiffenberg, L.; Goebel, W.; Kim, K.S.; Daniels, J.; Kuhn, M. Interaction of Listeria monocytogenes with human brain microvascular endothelial cells: An electron microscopic study. Infect. Immun. 2000, 68, 3275–3279. [Google Scholar] [CrossRef]
- Hertzig, T.; Weber, M.; Greiffenberg, L.; Holthausen, B.S.; Goebel, W.; Kim, K.S.; Kuhn, M. Antibodies present in normal human serum inhibit invasion of human brain microvascular endothelial cells by Listeria monocytogenes. Infect. Immun. 2003, 71, 95–100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dramsi, S.; Dehoux, P.; Lebrun, M.; Goossens, P.L.; Cossart, P. Identification of four new members of the internalin multigene family of Listeria monocytogenes EGD. Infect. Immun. 1997, 65, 1615–1625. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghosh, P.; Halvorsen, E.M.; Ammendolia, D.A.; Mor-Vaknin, N.; O’Riordan, M.X.D.; Brumell, J.H.; Markovitz, D.M.; Higgins, D.E. Invasion of the Brain by Listeria monocytogenes Is Mediated by InlF and Host Cell Vimentin. mBio 2018, 9, e00160-18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bastounis, E.E.; Yeh, Y.T.; Theriot, J.A. Matrix stiffness modulates infection of endothelial cells by Listeria monocytogenes via expression of cell surface vimentin. Mol. Biol. Cell 2018, 29, 1571–1589. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.H.; Chi, F.; Peng, L.; Bo, T.; Zhang, B.; Liu, L.Q.; Wu, X.; Mor-Vaknin, N.; Markovitz, D.M.; Cao, H.; et al. Vimentin, a Novel NF-kappaB Regulator, Is Required for Meningitic Escherichia coli K1-Induced Pathogen Invasion and PMN Transmigration across the Blood-Brain Barrier. PLoS ONE 2016, 11, e0162641. [Google Scholar] [CrossRef] [Green Version]
- Puthiyakunnon, S.; He, X.; Boddu, S.; Huang, S.H.; Cao, H. C-Met Inhibitors are Potential Novel Therapeutic Agents Against Listeria monocytogenes Infection Through Blocking the Bacteria Entry into Nonphagocytic Cells. Curr. Top. Med. Chem. 2017, 17, 278–289. [Google Scholar] [CrossRef]
- Mak, T.N.; Bruggemann, H. Vimentin in Bacterial Infections. Cells 2016, 5, 18. [Google Scholar] [CrossRef] [Green Version]
- Dinner, S.; Borkowski, J.; Stump-Guthier, C.; Ishikawa, H.; Tenenbaum, T.; Schroten, H.; Schwerk, C. A Choroid Plexus Epithelial Cell-based Model of the Human Blood-Cerebrospinal Fluid Barrier to Study Bacterial Infection from the Basolateral Side. J. Vis. Exp. JoVE 2016, 111, e54061. [Google Scholar] [CrossRef] [Green Version]
- Schwerk, C.; Papandreou, T.; Schuhmann, D.; Nickol, L.; Borkowski, J.; Steinmann, U.; Quednau, N.; Stump, C.; Weiss, C.; Berger, J.; et al. Polar Invasion and Translocation of Neisseria meningitidis and Streptococcus suis in a Novel Human Model of the Blood-Cerebrospinal Fluid Barrier. PLoS ONE 2012, 7, e30069. [Google Scholar] [CrossRef]
- Stins, M.F.; Badger, J.; Sik Kim, K. Bacterial invasion and transcytosis in transfected human brain microvascular endothelial cells. Microb. Pathog. 2001, 30, 19–28. [Google Scholar] [CrossRef]
- Ishiwata, I.; Ishiwata, C.; Ishiwata, E.; Sato, Y.; Kiguchi, K.; Tachibana, T.; Hashimoto, H.; Ishikawa, H. Establishment and characterization of a human malignant choroids plexus papilloma cell line (HIBCPP). Hum. Cell 2005, 18, 67–72. [Google Scholar] [CrossRef] [PubMed]
- Miettinen, M.; Clark, R.; Virtanen, I. Intermediate filament proteins in choroid plexus and ependyma and their tumors. Am. J. Pathol. 1986, 123, 231–240. [Google Scholar] [PubMed]
- Kasper, M.; Goertchen, R.; Stosiek, P.; Perry, G.; Karsten, U. Coexistence of cytokeratin, vimentin and neurofilament protein in human choroid plexus. An immunohistochemical study of intermediate filaments in neuroepithelial tissues. Virchows. Arch. A Pathol. Anat. Histopathol. 1986, 410, 173–177. [Google Scholar] [CrossRef] [PubMed]
- Shimomoto, T.; Yoshida, M.; Takahashi, M.; Uematsu, F.; Maekawa, A.; Nakae, D. A case report of a choroid plexus carcinoma spontaneously occurring in the right lateral ventricle of a 14-week-old, female Donryu rat. Toxicol. Pathol. 2004, 32, 264–268. [Google Scholar] [CrossRef] [PubMed]
- Lazarevic, I.; Engelhardt, B. Modeling immune functions of the mouse blood-cerebrospinal fluid barrier in vitro: Primary rather than immortalized mouse choroid plexus epithelial cells are suited to study immune cell migration across this brain barrier. Fluids Barriers CNS 2016, 13, 2. [Google Scholar] [CrossRef] [Green Version]
- Danielsson, F.; Peterson, M.K.; Caldeira Araujo, H.; Lautenschlager, F.; Gad, A.K.B. Vimentin Diversity in Health and Disease. Cells 2018, 7, 147. [Google Scholar] [CrossRef] [Green Version]
- Patteson, A.E.; Vahabikashi, A.; Goldman, R.D.; Janmey, P.A. Mechanical and Non-Mechanical Functions of Filamentous and Non-Filamentous Vimentin. BioEssays News Rev. Mol. Cell. Dev. Biol. 2020, 42, e2000078. [Google Scholar] [CrossRef]
- Chi, F.; Jong, T.D.; Wang, L.; Ouyang, Y.; Wu, C.; Li, W.; Huang, S.H. Vimentin-mediated signalling is required for IbeA+ E. coli K1 invasion of human brain microvascular endothelial cells. Biochem. J. 2010, 427, 79–90. [Google Scholar] [CrossRef]
- Teo, C.S.; Chu, J.J. Cellular vimentin regulates construction of dengue virus replication complexes through interaction with NS4A protein. J. Virol. 2014, 88, 1897–1913. [Google Scholar] [CrossRef] [Green Version]
- Deng, L.; Spencer, B.L.; Holmes, J.A.; Mu, R.; Rego, S.; Weston, T.A.; Hu, Y.; Sanches, G.F.; Yoon, S.; Park, N.; et al. The Group B Streptococcal surface antigen I/II protein, BspC, interacts with host vimentin to promote adherence to brain endothelium and inflammation during the pathogenesis of meningitis. PLoS Pathog. 2019, 15, e1007848. [Google Scholar] [CrossRef]
- Parida, S.K.; Domann, E.; Rohde, M.; Muller, S.; Darji, A.; Hain, T.; Wehland, J.; Chakraborty, T. Internalin B is essential for adhesion and mediates the invasion of Listeria monocytogenes into human endothelial cells. Mol. Microbiol. 1998, 28, 81–93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Riento, K.; Ridley, A.J. Rocks: Multifunctional kinases in cell behaviour. Nat. Rev. Mol. Cell Biol. 2003, 4, 446–456. [Google Scholar] [CrossRef] [PubMed]
- Kirchner, M.; Higgins, D.E. Inhibition of ROCK activity allows InlF-mediated invasion and increased virulence of Listeria monocytogenes. Mol. Microbiol. 2008, 68, 749–767. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ling, Z.; Zhao, D.; Xie, X.; Yao, H.; Wang, Y.; Kong, S.; Chen, X.; Pan, Z.; Jiao, X.; Yin, Y. inlF Enhances Listeria monocytogenes Early-Stage Infection by Inhibiting the Inflammatory Response. Front. Cell. Infect. Microbiol. 2021, 11, 748461. [Google Scholar] [CrossRef] [PubMed]
- Kaufmann, S.H. Acquired resistance to facultative intracellular bacteria: Relationship between persistence, cross-reactivity at the T-cell level, and capacity to stimulate cellular immunity of different Listeria strains. Infect. Immun. 1984, 45, 234–241. [Google Scholar] [CrossRef] [Green Version]
- Lingnau, A.; Domann, E.; Hudel, M.; Bock, M.; Nichterlein, T.; Wehland, J.; Chakraborty, T. Expression of the Listeria monocytogenes EGD inlA and inlB genes, whose products mediate bacterial entry into tissue culture cell lines, by PrfA-dependent and -independent mechanisms. Infect. Immun. 1995, 63, 3896–3903. [Google Scholar] [CrossRef] [Green Version]
- Schaferkordt, S.; Chakraborty, T. Vector plasmid for insertional mutagenesis and directional cloning in Listeria spp. Biotechniques 1995, 19, 720–722, 724–725. [Google Scholar]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef]
Primer | 5′-3′ Sequence |
---|---|
P1-f | TCGTAGAGATAAAATCGACAAACAA |
P2-r | TTTTTAATTA_ATTAGTCTTTCCTTTCATTA |
P3-f | AAAGACTAAT_TAATTAAAAAACCCAGCATT |
P4-r | TCATCTGGGACAGTTGAAGG |
P7-f | TCCCGCTAACTGGTCATAAAGGC |
P8-r | ACTGCGGGAAGTTGTGCGTAC |
M13 Forward/M100 | GTAAAACGACGGCCAG |
M13 Reverse/M101 | CAGGAAACAGCTATGAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Banovic, F.; Schulze, S.; Abu Mraheil, M.; Hain, T.; Chakraborty, T.; Orian-Rousseau, V.; Moroniak, S.; Weiss, C.; Ishikawa, H.; Schroten, H.; et al. Different Involvement of Vimentin during Invasion by Listeria monocytogenes at the Blood–Brain and the Blood–Cerebrospinal Fluid Barriers In Vitro. Int. J. Mol. Sci. 2022, 23, 12908. https://doi.org/10.3390/ijms232112908
Banovic F, Schulze S, Abu Mraheil M, Hain T, Chakraborty T, Orian-Rousseau V, Moroniak S, Weiss C, Ishikawa H, Schroten H, et al. Different Involvement of Vimentin during Invasion by Listeria monocytogenes at the Blood–Brain and the Blood–Cerebrospinal Fluid Barriers In Vitro. International Journal of Molecular Sciences. 2022; 23(21):12908. https://doi.org/10.3390/ijms232112908
Chicago/Turabian StyleBanovic, Franjo, Sandrin Schulze, Mobarak Abu Mraheil, Torsten Hain, Trinad Chakraborty, Véronique Orian-Rousseau, Selina Moroniak, Christel Weiss, Hiroshi Ishikawa, Horst Schroten, and et al. 2022. "Different Involvement of Vimentin during Invasion by Listeria monocytogenes at the Blood–Brain and the Blood–Cerebrospinal Fluid Barriers In Vitro" International Journal of Molecular Sciences 23, no. 21: 12908. https://doi.org/10.3390/ijms232112908
APA StyleBanovic, F., Schulze, S., Abu Mraheil, M., Hain, T., Chakraborty, T., Orian-Rousseau, V., Moroniak, S., Weiss, C., Ishikawa, H., Schroten, H., Adam, R., & Schwerk, C. (2022). Different Involvement of Vimentin during Invasion by Listeria monocytogenes at the Blood–Brain and the Blood–Cerebrospinal Fluid Barriers In Vitro. International Journal of Molecular Sciences, 23(21), 12908. https://doi.org/10.3390/ijms232112908