miR-143-null Is against Diet-Induced Obesity by Promoting BAT Thermogenesis and Inhibiting WAT Adipogenesis
Abstract
:1. Introduction
2. Results
2.1. miR-143 Is Downregulated in BAT of Mice Induced by HFD
2.2. miR-143KO Inhibits the Differentiation of White Adipocytes, but Not Brown Adipocytes
2.3. miR-143KO Does Not Affect Energy Metabolism in Mice
2.4. miR-143KO Reduces Diet-Induced Obesity by Promoting Energy Expenditure
2.5. miR-143KO Promotes Thermogenesis and Lipolysis in BAT of Mice Fed with HFD
2.6. miR-143KO Promotes Lipolysis and Inhibits Adipogenesis in WAT of Mice Fed with HFD
3. Discussion
4. Materials and Methods
4.1. Experimental Animals
4.2. QMR Analysis of Whole-Body Composition
4.3. Oil Red O Staining
4.4. H&E Staining
4.5. Metabolic Cage Analysis
4.6. GTT and ITT
4.7. Mitochondrial Observation by TEM
4.8. Mitochondrial DNA Quantification
4.9. BAT Mitochondrial Respiration Assays
4.10. Measurement of Basal and Stimulated Lipolysis of BAT and WAT
4.11. Isolation and Culture of Primary Brown and White Adipocytes
4.12. Analysis of TG, Glucose, and NEFA Concentrations
4.13. qPCR Analyses
4.14. Western Blot Analysis
4.15. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
miRNAs | microRNAs |
KO | knockout |
BAT | brown adipose tissue |
WAT | white adipose tissue |
scWAT | subcutaneous white adipose tissue |
eWAT | epididymal white adipose tissue |
TGs | triglycerides |
NEFA | non-esterified fatty acids |
MEK5 | mitogen-activated protein kinase kinase 5 |
ERK5 | extracellular signal-regulated kinase 5 |
ND | normal diet |
HFD | high-fat diet |
SVF | stromal-vascular fraction |
PPAR-γ | peroxisome proliferator-activated receptor-γ |
CEBP-α | CCAAT enhancer-binding protein-α |
RER | respiratory exchange ratio |
QMR | quantitative magnetic resonance |
AC9 | adenylate cyclase 9 |
UCP1 | uncoupling protein 1 |
AMPKα | AMP activated protein kinase α |
CPT1α | carnitine palmitoyltransferase 1α |
FASN | fatty acid synthase |
HSL | hormone sensitive lipase |
NST | non-shivering thermogenesis |
References
- Kahn, S.E.; Hull, R.L.; Utzschneider, K.M. Mechanisms linking obesity to insulin resistance and type 2 diabetes. Nature 2006, 444, 840–846. [Google Scholar] [CrossRef] [PubMed]
- Pillon, N.J.; Loos, R.J.F.; Marshall, S.M.; Zierath, J.R. Metabolic consequences of obesity and type 2 diabetes: Balancing genes and environment for personalized care. Cell 2021, 184, 1530–1544. [Google Scholar] [CrossRef] [PubMed]
- Magkos, F.; Hjorth, M.F.; Astrup, A. Diet and exercise in the prevention and treatment of type 2 diabetes mellitus. Nat. Rev. Endocrinol. 2020, 16, 545–555. [Google Scholar] [CrossRef] [PubMed]
- Sethi, J.K.; Vidal-Puig, A.J. Thematic review series: Adipocyte biology. Adipose tissue function and plasticity orchestrate nutritional adaptation. J. Lipid Res. 2007, 48, 1253–1262. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sakers, A.; De Siqueira, M.K.; Seale, P.; Villanueva, C.J. Adipose-tissue plasticity in health and disease. Cell 2022, 185, 419–446. [Google Scholar] [CrossRef] [PubMed]
- Shamsi, F.; Wang, C.H.; Tseng, Y.H. The evolving view of thermogenic adipocytes-ontogeny, niche and function. Nat. Rev. Endocrinol. 2021, 17, 726–744. [Google Scholar] [CrossRef] [PubMed]
- Onogi, Y.; Ussar, S. Regulatory networks determining substrate utilization in brown adipocytes. Trends Endocrinol. Metab. 2022, 33, 493–506. [Google Scholar] [CrossRef]
- Henningsen, J.B.; Scheele, C. Brown Adipose Tissue: A Metabolic Regulator in a Hypothalamic Cross Talk? Annu. Rev. Physiol. 2021, 83, 279–301. [Google Scholar] [CrossRef]
- Kahn, C.R.; Wang, G.; Lee, K.Y. Altered adipose tissue and adipocyte function in the pathogenesis of metabolic syndrome. J. Clin. Investig. 2019, 129, 3990–4000. [Google Scholar] [CrossRef]
- Vishvanath, L.; Gupta, R.K. Contribution of adipogenesis to healthy adipose tissue expansion in obesity. J. Clin. Investig. 2019, 129, 4022–4031. [Google Scholar] [CrossRef] [Green Version]
- Xu, P.Z.; Vernooy, S.Y.; Guo, M.; Hay, B.A. The Drosophila MicroRNA mir-14 suppresses cell death and is required for normal fat metabolism. Curr. Biol. 2003, 13, 790–795. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.; Sinnott-Armstrong, N.; Wagschal, A.; Wark, A.R.; Camporez, J.P.; Perry, R.J.; Ji, F.; Sohn, Y.; Oh, J.; Wu, S.; et al. A MicroRNA Linking Human Positive Selection and Metabolic Disorders. Cell 2020, 183, 684–701. [Google Scholar] [CrossRef] [PubMed]
- He, L.; Tang, M.; Xiao, T.; Liu, H.; Liu, W.; Li, G.; Zhang, F.; Xiao, Y.; Zhou, Z.; Liu, F.; et al. Obesity-Associated miR-199a/214 Cluster Inhibits Adipose Browning via PRDM16-PGC-1alpha Transcriptional Network. Diabetes 2018, 67, 2585–2600. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Elia, L.; Quintavalle, M.; Zhang, J.; Contu, R.; Cossu, L.; Latronico, M.V.; Peterson, K.L.; Indolfi, C.; Catalucci, D.; Chen, J.; et al. The knockout of miR-143 and -145 alters smooth muscle cell maintenance and vascular homeostasis in mice: Correlates with human disease. Cell Death Differ. 2009, 16, 1590–1598. [Google Scholar] [CrossRef]
- Jordan, S.D.; Kruger, M.; Willmes, D.M.; Redemann, N.; Wunderlich, F.T.; Bronneke, H.S.; Merkwirth, C.; Kashkar, H.; Olkkonen, V.M.; Bottger, T.; et al. Obesity-induced overexpression of miRNA-143 inhibits insulin-stimulated AKT activation and impairs glucose metabolism. Nat. Cell Biol. 2011, 13, 434–446. [Google Scholar] [CrossRef]
- Esau, C.; Kang, X.; Peralta, E.; Hanson, E.; Marcusson, E.G.; Ravichandran, L.V.; Sun, Y.; Koo, S.; Perera, R.J.; Jain, R.; et al. MicroRNA-143 regulates adipocyte differentiation. J. Biol. Chem. 2004, 279, 52361–52365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xie, H.; Lim, B.; Lodish, H.F. MicroRNAs induced during adipogenesis that accelerate fat cell development are downregulated in obesity. Diabetes 2009, 58, 1050–1057. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, L.; Hou, J.; Ye, L.; Chen, Y.; Cui, J.; Tian, W.; Li, C.; Liu, L. MicroRNA-143 regulates adipogenesis by modulating the MAP2K5-ERK5 signaling. Sci. Rep. 2014, 4, 3819–3829. [Google Scholar] [CrossRef] [Green Version]
- Engin, A.B. MicroRNA and Adipogenesis. Adv. Exp. Med. Biol. 2017, 960, 489–509. [Google Scholar] [CrossRef]
- Lee, M.S.; Kim, Y. Mulberry Fruit Extract Ameliorates Adipogenesis via Increasing AMPK Activity and Downregulating MicroRNA-21/143 in 3T3-L1 Adipocytes. J. Med. Food 2020, 23, 266–272. [Google Scholar] [CrossRef]
- Zhang, P.; Du, J.; Wang, L.; Niu, L.; Zhao, Y.; Tang, G.; Jiang, Y.; Shuai, S.; Bai, L.; Li, X.; et al. MicroRNA-143a-3p modulates preadipocyte proliferation and differentiation by targeting MAPK7. Biomed. Pharmacother. 2018, 108, 531–539. [Google Scholar] [CrossRef] [PubMed]
- Bae, I.S.; Park, P.J.; Lee, J.H.; Cho, E.G.; Lee, T.R.; Kim, S.H. PPARgamma-mediated G-protein coupled receptor 120 signaling pathway promotes transcriptional activation of miR-143 in adipocytes. Gene 2017, 626, 64–69. [Google Scholar] [CrossRef] [PubMed]
- Xihua, L.; Shengjie, T.; Weiwei, G.; Matro, E.; Tingting, T.; Lin, L.; Fang, W.; Jiaqiang, Z.; Fenping, Z.; Hong, L. Circulating miR-143-3p inhibition protects against insulin resistance in Metabolic Syndrome via targeting of the insulin-like growth factor 2 receptor. Transl. Res. 2019, 205, 33–43. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dahlman, I.; Belarbi, Y.; Laurencikiene, J.; Pettersson, A.M.; Arner, P.; Kulyte, A. Comprehensive functional screening of miRNAs involved in fat cell insulin sensitivity among women. Am. J. Physiol. Endocrinol. Metab. 2017, 312, E482–E494. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takanabe, R.; Ono, K.; Abe, Y.; Takaya, T.; Horie, T.; Wada, H.; Kita, T.; Satoh, N.; Shimatsu, A.; Hasegawa, K. Up-regulated expression of microRNA-143 in association with obesity in adipose tissue of mice fed high-fat diet. Biochem. Biophys. Res. Commun. 2008, 376, 728–732. [Google Scholar] [CrossRef]
- Li, M.; Wu, H.; Luo, Z.; Xia, Y.; Guan, J.; Wang, T.; Gu, Y.; Chen, L.; Zhang, K.; Ma, J.; et al. An atlas of DNA methylomes in porcine adipose and muscle tissues. Nat. Commun. 2012, 3, 850. [Google Scholar] [CrossRef] [Green Version]
- Nazari, M.; Saberi, A.; Karandish, M.; Neisi, N.; Jalali, M.T.; Makvandi, M. Influence of L-carnitine on the Expression Level of Adipose Tissue miRNAs Related to Weight Changes in Obese Rats. Pak. J. Biol. Sci. 2016, 19, 227–232. [Google Scholar] [CrossRef] [Green Version]
- Chen, X.; Luo, J.; Yang, L.; Guo, Y.; Fan, Y.; Liu, J.; Sun, J.; Zhang, Y.; Jiang, Q.; Chen, T.; et al. miR-143-Mediated Responses to Betaine Supplement Repress Lipogenesis and Hepatic Gluconeogenesis by Targeting MAT1a and MAPK11. J. Agric. Food Chem. 2022, 70, 7981–7992. [Google Scholar] [CrossRef]
- Chen, X.P.; Luo, J.Y.; Liu, J.; Chen, T.; Sun, J.J.; Zhang, Y.L.; Xi, Q.Y. Exploration of the Effect on Genome-Wide DNA Methylation by miR-143 Knock-Out in Mice Liver. Int. J. Mol. Sci. 2021, 22, 13075. [Google Scholar] [CrossRef]
- Katsuki, A.; Sumida, Y.; Urakawa, H.; Gabazza, E.C.; Murashima, S.; Maruyama, N.; Morioka, K.; Nakatani, K.; Yano, Y.; Adachi, Y. Increased visceral fat and serum levels of triglyceride are associated with insulin resistance in Japanese metabolically obese, normal weight subjects with normal glucose tolerance. Diabetes Care 2003, 26, 2341–2344. [Google Scholar] [CrossRef]
- Kimura, I.; Ichimura, A.; Ohue-Kitano, R.; Igarashi, M. Free Fatty Acid Receptors in Health and Disease. Physiol. Rev. 2020, 100, 171–210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, D.; Liu, C.D.; Li, H.F.; Tian, M.L.; Pan, J.Q.; Shu, G.; Jiang, Q.Y.; Yin, Y.L.; Zhang, L. LSD1 mediates microbial metabolite butyrate-induced thermogenesis in brown and white adipose tissue. Metabolism 2020, 102, 154011. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Recazens, E.; Mouisel, E.; Langin, D. Hormone-sensitive lipase: Sixty years later. Prog. Lipid Res. 2021, 82, 101084. [Google Scholar] [CrossRef] [PubMed]
- Arner, P.; Kulyte, A. MicroRNA regulatory networks in human adipose tissue and obesity. Nat. Rev. Endocrinol. 2015, 11, 276–288. [Google Scholar] [CrossRef] [PubMed]
- Rottiers, V.; Naar, A.M. MicroRNAs in metabolism and metabolic disorders. Nat. Rev. Mol. Cell Biol. 2012, 13, 239–250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, B.; Fan, J.; Chen, N. A Novel Regulator of Type II Diabetes: MicroRNA-143. Trends Endocrinol. Metab. 2018, 29, 380–388. [Google Scholar] [CrossRef] [PubMed]
- Thomou, T.; Mori, M.A.; Dreyfuss, J.M.; Konishi, M.; Sakaguchi, M.; Wolfrum, C.; Rao, T.N.; Winnay, J.N.; Garcia-Martin, R.; Grinspoon, S.K.; et al. Adipose-derived circulating miRNAs regulate gene expression in other tissues. Nature 2017, 542, 450–455. [Google Scholar] [CrossRef] [Green Version]
- Al-Rawaf, H.A. Circulating microRNAs and adipokines as markers of metabolic syndrome in adolescents with obesity. Clin. Nutr. 2019, 38, 2231–2238. [Google Scholar] [CrossRef]
- Vatandoost, N.; Amini, M.; Iraj, B.; Momenzadeh, S.; Salehi, R. Dysregulated miR-103 and miR-143 expression in peripheral blood mononuclear cells from induced prediabetes and type 2 diabetes rats. Gene 2015, 572, 95–100. [Google Scholar] [CrossRef]
- Kilic, I.D.; Dodurga, Y.; Uludag, B.; Alihanoglu, Y.I.; Yildiz, B.S.; Enli, Y.; Secme, M.; Bostanci, H.E. MicroRNA-143 and -223 in obesity. Gene 2015, 560, 140–142. [Google Scholar] [CrossRef]
- Can, U.; Buyukinan, M.; Yerlikaya, F.H. The investigation of circulating microRNAs associated with lipid metabolism in childhood obesity. Pediatr. Obes. 2016, 11, 228–234. [Google Scholar] [CrossRef] [PubMed]
- Xin, M.; Small, E.M.; Sutherland, L.B.; Qi, X.; McAnally, J.; Plato, C.F.; Richardson, J.A.; Bassel-Duby, R.; Olson, E.N. MicroRNAs miR-143 and miR-145 modulate cytoskeletal dynamics and responsiveness of smooth muscle cells to injury. Genes Dev. 2009, 23, 2166–2178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boettger, T.; Beetz, N.; Kostin, S.; Schneider, J.; Kruger, M.; Hein, L.; Braun, T. Acquisition of the contractile phenotype by murine arterial smooth muscle cells depends on the Mir143/145 gene cluster. J. Clin. Investig. 2009, 119, 2634–2647. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chivukula, R.R.; Shi, G.; Acharya, A.; Mills, E.W.; Zeitels, L.R.; Anandam, J.L.; Abdelnaby, A.A.; Balch, G.C.; Mansour, J.C.; Yopp, A.C.; et al. An essential mesenchymal function for miR-143/145 in intestinal epithelial regeneration. Cell 2014, 157, 1104–1116. [Google Scholar] [CrossRef] [Green Version]
- Calo, N.; Ramadori, P.; Sobolewski, C.; Romero, Y.; Maeder, C.; Fournier, M.; Rantakari, P.; Zhang, F.P.; Poutanen, M.; Dufour, J.F.; et al. Stress-activated miR-21/miR-21* in hepatocytes promotes lipid and glucose metabolic disorders associated with high-fat diet consumption. Gut 2016, 65, 1871–1881. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, L.; Chen, X.W.; Huang, X.; Song, B.L.; Wang, Y.; Wang, Y. Regulation of glucose and lipid metabolism in health and disease. Sci. China Life Sci. 2019, 62, 1420–1458. [Google Scholar] [CrossRef] [PubMed]
- Cannon, B.; Nedergaard, J. Brown adipose tissue: Function and physiological significance. Physiol. Rev. 2004, 84, 277–359. [Google Scholar] [CrossRef] [PubMed]
- Herzig, S.; Shaw, R.J. AMPK: Guardian of metabolism and mitochondrial homeostasis. Nat. Rev. Mol. Cell Biol. 2018, 19, 121–135. [Google Scholar] [CrossRef] [Green Version]
- Garcia, D.; Shaw, R.J. AMPK: Mechanisms of Cellular Energy Sensing and Restoration of Metabolic Balance. Mol. Cell 2017, 66, 789–800. [Google Scholar] [CrossRef] [Green Version]
- Trefts, E.; Shaw, R.J. AMPK: Restoring metabolic homeostasis over space and time. Mol. Cell 2021, 81, 3677–3690. [Google Scholar] [CrossRef]
- Oh, C.M.; Namkung, J.; Go, Y.; Shong, K.E.; Kim, K.; Kim, H.; Park, B.Y.; Lee, H.W.; Jeon, Y.H.; Song, J.; et al. Regulation of systemic energy homeostasis by serotonin in adipose tissues. Nat. Commun. 2015, 6, 6794. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Um, J.H.; Park, S.J.; Kang, H.; Yang, S.; Foretz, M.; McBurney, M.W.; Kim, M.K.; Viollet, B.; Chung, J.H. AMP-activated protein kinase-deficient mice are resistant to the metabolic effects of resveratrol. Diabetes 2010, 59, 554–563. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schweiger, M.; Eichmann, T.O.; Taschler, U.; Zimmermann, R.; Zechner, R.; Lass, A. Measurement of lipolysis. Methods Enzymol. 2014, 538, 171–193. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|
mu-Ucp1 | ACTGCCACACCTCCAGTCATT | CTTTGCCTCACTCAGGATTGG |
mu-Pgc1a | AGCCGTGACCACTGACAACGAG | GCTGCATGGTTCTGAGTGCTAAG |
mu-Cidea | ATCACAACTGGCCTGGTTACG | TACTACCCGGTGTCCATTTCT |
mu-Cd36 | ATGGGCTGTGATCGGAACTG | TTTGCCACGTCATCTGGGTTT |
mu-Cpt1a | CTCCGCCTGAGCCATGAAG | CACCAGTGATGATGCCATTCT |
mu-Cox7a1 | CCGACAATGACCTCCCAGTA | TGTTTGTCCAAGTCCTCCAA |
mu-Pparg | CTGCATCTCCACCTTATTAT | CACAGACTCGGCACTCA |
mu-Cebpa | AGAAGTCGGTGGACAAGAACA | TTTGGCTTTATCTCGGCTCT |
mu-Atgl | AAAGGACCTGATGACCACC | GCAGCCACTCCAACAAGC |
mu-Hsl | AGACACCAGCCAACGGATAC | GCTGGCACGGAAGAAGATAC |
mu-Plin | CCATGACGACCAGACAGACAC | CCCAGGTCACTGCGGAGAT |
mu-Mek5 | AAGCAGCCCAAGGAGAGAC | GAACTGCACGATGAATGGGTG |
mu-Fasn | GCTGCGGAAACTTCAGGAAAT | AGAGACGTGTCACTCCTGGACTT |
mu-Acc | TGTACAAGCAGTGTGGGCTGGCT | CCACATGGCCTGGCTTGGAGGG |
mu-Srebp1c | AACCAGAAGCTCAAGCAGGA | TCATGCCCTCCATAGACACA |
mu-U6 | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT |
mu-18s | CTTAGTTGGTGGAGCGATTT | GCTGAACGCCACTTGTCC |
Mu-Gapdh | GGAAAGCTGTGGCGTGAT | AAGGTGGAAGAATGGGAGTT |
mtDNA-specific PCR | CCGCAAGGGAAAGATGAAAGA | TCGTTTGGTTTCGGGGTTTC |
DNA-specific PCR | -GCCAGCCTCTCCTGATGT | GGGAACACAAAAGACCTCTTCTGG |
mu-qmiR-143-3p | GGGTGAGATGAAGCACTG | CAGTGCGTGTCGTGGAGT |
mu-miR143-3p-RT | GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGAGCTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, J.; Liu, J.; Zeng, D.; Wang, H.; Wang, Y.; Xiong, J.; Chen, X.; Luo, J.; Chen, T.; Xi, Q.; et al. miR-143-null Is against Diet-Induced Obesity by Promoting BAT Thermogenesis and Inhibiting WAT Adipogenesis. Int. J. Mol. Sci. 2022, 23, 13058. https://doi.org/10.3390/ijms232113058
Liu J, Liu J, Zeng D, Wang H, Wang Y, Xiong J, Chen X, Luo J, Chen T, Xi Q, et al. miR-143-null Is against Diet-Induced Obesity by Promoting BAT Thermogenesis and Inhibiting WAT Adipogenesis. International Journal of Molecular Sciences. 2022; 23(21):13058. https://doi.org/10.3390/ijms232113058
Chicago/Turabian StyleLiu, Jie, Jiatao Liu, Dewei Zeng, Huan Wang, Yun Wang, Jiali Xiong, Xingping Chen, Junyi Luo, Ting Chen, Qianyun Xi, and et al. 2022. "miR-143-null Is against Diet-Induced Obesity by Promoting BAT Thermogenesis and Inhibiting WAT Adipogenesis" International Journal of Molecular Sciences 23, no. 21: 13058. https://doi.org/10.3390/ijms232113058