miR-23b-3p, miR-124-3p and miR-218-5p Synergistic or Additive Effects on Cellular Processes That Modulate Cervical Cancer Progression? A Molecular Balance That Needs Attention
Abstract
:1. Introduction
2. miRNAs and Cervical Cancer Progression
3. miR-23b-3p, miR-124-3p, and miR-218-5p Regulate Cervical Cancer Progression
4. miR-23b-3p, miR-124-3p, and miR-218-5p Target Prediction and Function Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Sadri Nahand, J.; Moghoofei, M.; Salmaninejad, A.; Bahmanpour, Z.; Karimzadeh, M.; Nasiri, M.; Mirzaei, H.R.; Pourhanifeh, M.H.; Bokharaei-Salim, F.; Mirzaei, H.; et al. Pathogenic role of exosomes and microRNAs in HPV-mediated onflammation and cervical cancer: A review. Int. J. Cancer 2020, 146, 305–320. [Google Scholar] [CrossRef] [PubMed]
- Ruan, F.; Wang, Y.-F.; Chai, Y. Diagnostic values of miR-21, miR-124, and M-CSF in patients with early cervical cancer. Technol. Cancer Res. Treat. 2020, 19, 1533033820914983. [Google Scholar] [CrossRef] [PubMed]
- Yan, L.; Huang, H.; Zhang, Y.; Yuan, X.; Yan, Z.; Cao, C.; Luo, X. Involvement of p53-dependent apoptosis signal in antitumor effect of Colchicine on human papilloma virus (HPV)-positive human cervical cancer cells. Biosci. Rep. 2020, 40, BSR20194065. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, C.; Mao, D.; Hua, G.; Lv, X.; Chen, X.; Angeletti, P.C.; Dong, J.; Remmenga, S.W.; Rodabaugh, K.J.; Zhou, J.; et al. The Hippo/ YAP pathway interacts with EGFR signaling and HPV oncoproteins to regulate cervical cancer progression. EMBO Mol. Med. 2015, 7, 1426–1449. [Google Scholar] [CrossRef]
- Panayiotou, T.; Michael, S.; Zaravinos, A.; Demirag, E.; Achilleos, C.; Strati, K. Human papillomavirus E7 binds Oct4 and regulates its activity in HPV-associated cervical cancers. PLoS Pathog. 2020, 16, e1008468. [Google Scholar] [CrossRef] [Green Version]
- Cuninghame, S.; Jackson, R.; Lees, S.J.; Zehbe, I. Two common variants of human papillomavirus type 16 E6 differentially deregulate sugar metabolism and hypoxia signalling in permissive human keratinocytes. J. Gen. Virol. 2017, 98, 2310–2319. [Google Scholar] [CrossRef]
- Filippova, M.; Parkhurst, L.; Duerksen-Hughes, P.J. The human papillomavirus 16 E6 protein binds to Fas-associated death domain and protects cells from Fas-triggered apoptosis. J. Biol. Chem. 2004, 279, 25729–25744. [Google Scholar] [CrossRef] [Green Version]
- Contreras-Paredes, A.; De la Cruz-Hernández, E.; Martínez-Ramírez, I.; Dueñas-González, A.; Lizano, M. E6 variants of human papillomavirus 18 differentially modulate the protein kinase B/phosphatidylinositol 3-kinase (akt/PI3K) signaling pathway. Virology 2009, 383, 78–85. [Google Scholar] [CrossRef] [Green Version]
- Veeraraghavalu, K.; Subbaiah, V.K.; Srivastava, S.; Chakrabarti, O.; Syal, R.; Krishna, S. Complementation of human papillomavirus type 16 E6 and E7 by jagged1-specific notch1-phosphatidylinositol 3-kinase signaling involves pleiotropic oncogenic functions independent of CBF1;Su(H);Lag-1 activation. J. Virol. 2005, 79, 7889–7898. [Google Scholar] [CrossRef]
- Zhang, R.; Lu, H.; Lyu, Y.-Y.; Yang, X.-M.; Zhu, L.-Y.; Yang, G.-D.; Jiang, P.-C.; Re, Y.; Song, W.-W.; Wang, J.-H.; et al. E6/E7-P53-POU2F1-CTHRC1 axis promotes cervical cancer metastasis and activates Wnt/PCP pathway. Sci. Rep. 2017, 7, 44744. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lüönd, F.; Tiede, S.; Christofori, G. Breast cancer as an example of tumour heterogeneity and tumour cell plasticity during malignant progression. Br. J. Cancer 2021, 125, 164–175. [Google Scholar] [CrossRef] [PubMed]
- Huang, S. Tumor progression: Chance and necessity in Darwinian and Lamarckian somatic (mutationless) evolution. Prog. Biophys. Mol. Biol. 2012, 110, 69–86. [Google Scholar] [CrossRef] [PubMed]
- Coghlin, C.; Murray, G.I. The role of gene regulatory networks in promoting cancer progression and metastasis. Futur. Oncol. 2014, 10, 735–748. [Google Scholar] [CrossRef]
- Chen, Y.; Wu, Q.; Lin, J.; Wei, J. DARS-AS1 accelerates the proliferation of cervical cancer cells via miR-628-5p/JAG1 axis to activate Notch pathway. Cancer Cell Int. 2020, 20, 535. [Google Scholar] [CrossRef]
- Ouyang, M.; Liu, G.; Xiong, C.; Rao, J. microRNA-181a-5p impedes the proliferation, migration, and invasion of retinoblastoma cells by targeting the NRAS proto-oncogene. Clinics 2022, 77, 100026. [Google Scholar] [CrossRef]
- Steenbergen, R.; Snijders, P.J.F.; Heideman, D.A.M.; Meijer, C.J.L.M. Clinical implications of (epi)genetic changes in HPV-induced cervical precancerous lesions. Nat. Rev. Cancer 2014, 14, 395–405. [Google Scholar] [CrossRef]
- Thakur, N.; Singhal, P.; Mehrotra, R.; Bharadwaj, M. Impacts of single nucleotide polymorphisms in three microRNAs (miR-146a, miR-196a2 and miR-499) on the susceptibility to cervical cancer among Indian women. Biosci. Rep. 2019, 39, BSR20180723. [Google Scholar] [CrossRef] [Green Version]
- Ma, L.; Weinberg, R.A. MicroRNAs in malignant progression. Cell Cycle 2008, 7, 570–572. [Google Scholar] [CrossRef]
- Yamamoto, N.; Kinoshita, T.; Nohata, N.; Itesako, T.; Yoshino, H.; Enokida, H.; Nakagawa, M.; Shozu, M.; Seki, N. Tumor suppressive microRNA-218 inhibits cancer cell migration and invasion by targeting focal adhesion pathways in cervical squamous cell carcinoma. Int. J. Oncol. 2013, 42, 1523–1532. [Google Scholar] [CrossRef]
- Dimri, M.; Carroll, J.D.; Cho, J.-H.; Dimri, G.P. microRNA-141 regulates BMI1 expression and induces senescence in human diploid fibroblasts. Cell Cycle 2013, 12, 3537–3546. [Google Scholar] [CrossRef] [PubMed]
- Ma, C.; Zeng, C.; Jin, L.; Yang, Y.; Li, P.; Chen, L.; Wang, J. GSK3β mediates the carcinogenic effect of HPV16 in cervical cancer. Sci. Rep. 2015, 5, 16555. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, L.; Cai, Y.; Zhang, D.; Sun, J.; Xu, C.; Zhao, W.; Jiang, W.; Pan, C. miR-195/miR-497 regulate CD274 expression of immune regulatory ligands in triple-negative breast cancer. J. Breast Cancer 2018, 21, 371–381. [Google Scholar] [CrossRef] [PubMed]
- Fan, B.; Jin, Y.; Zhang, H.; Zhao, R.; Sun, M.; Sun, M.; Yuan, X.; Wang, W.; Wang, X.; Chen, Z.; et al. MicroRNA-21 contributes to renal cell carcinoma cell invasiveness and angiogenesis via the PDCD4/c-Jun (AP-1) signalling pathway. Int. J. Oncol. 2019, 56, 178–192. [Google Scholar] [CrossRef]
- Wang, J.-Y.; Chen, L.-J. The role of miRNAs in the invasion and metastasis of cervical cancer. Biosci. Rep. 2019, 39, 1042. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pedroza-Torres, A.; López-Urrutia, E.; Garcia, V.; Jacobo-Herrera, N.; Herrera, L.A.; Peralta-Zaragoza, O.; López-Camarillo, C.; De Leon, D.C.; Fernández-Retana, J.; Cerna-Cortés, J.F.; et al. MicroRNAs in cervical cancer: Evidences for a miRNA profile deregulated by HPV and its impact on radio-resistance. Molecules 2014, 19, 6263–6281. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.; Zhong, Y.; Li, L. miR-124 and miR-203 synergistically inactivate EMT pathway via coregulation of ZEB2 in clear cell renal cell carcinoma (ccRCC). J. Transl. Med. 2020, 18, 69. [Google Scholar] [CrossRef] [Green Version]
- Hua, K.; Chen, Y.; Chen, C.; Tang, Y.; Huang, T.; Lin, Y.; Yeh, T.; Huang, K.; Lee, H.; Hsu, M.; et al. MicroRNA-23a/27a/24-2 cluster promotes gastric cancer cell proliferation synergistically. Oncol. Lett. 2018, 16, 2319–2325. [Google Scholar] [CrossRef] [Green Version]
- Shekhar, R.; Priyanka, P.; Kumar, P.; Ghosh, T.; Khan, M.; Nagarajan, P.; Saxena, S. The microRNAs miR-449a and miR-424 suppress osteosarcoma by targeting cyclin A2 expression. J. Biol. Chem. 2019, 294, 4381–4400. [Google Scholar] [CrossRef] [Green Version]
- Chen, G.; Huang, P.; Xie, J.; Li, R. microRNA-211 suppresses the growth and metastasis of cervical cancer by directly targeting ZEB1. Mol. Med. Rep. 2017, 17, 1275–1282. [Google Scholar] [CrossRef]
- Yu, N.; Jin, J.; Liu, J.; Ma, M. Upregulation of miR-494 promotes cervical cancer cell proliferation, migration and invasion via the MAPK/ERK pathway. Int. J. Clin. Exp. Pathol. 2017, 10, 3101–3108. [Google Scholar]
- Jiménez-Wences, H.; Martínez-Carrillo, D.N.; Peralta-Zaragoza, O.; Campos-Viguri, G.E.; Hernández-Sotelo, D.; Jiménez-López, M.A.; Muñoz-Camacho, J.G.; Garzón-Barrientos, V.H.; Illades-Aguiar, B.; Fernández-Tilapa, G. Methylation and expression of miRNAs in precancerous lesions and cervical cancer with HPV16 infection. Oncol. Rep. 2016, 35, 2297–2305. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Campos-Viguri, G.E.; Jiménez-Wences, H.; Peralta-Zaragoza, O.; Torres-Altamirano, G.; Soto-Flores, D.G.; Hernández-Sotelo, D.; Alarcón-Romero, L.D.C.; Jiménez-López, M.A.; Illades-Aguiar, B.; Fernández-Tilapa, G. miR-23b as a potential tumor suppressor and its regulation by DNA methylation in cervical cancer. Infect. Agents Cancer 2015, 10, 42. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Campos-Viguri, G.E.; Peralta-Zaragoza, O.; Jiménez-Wences, H.; Longinos-González, A.E.; Castañón-Sánchez, C.A.; Ramírez-Carrillo, M.; López-Camarillo, C.; Castañeda-Saucedo, E.; Jiménez-López, M.A.; Martínez-Carrillo, D.N.; et al. MiR-23b-3p reduces the proliferation, migration and invasion of cervical cancer cell lines via the reduction of c-Met expression. Sci. Rep. 2020, 10, 3256. [Google Scholar] [CrossRef] [Green Version]
- Liu, S.; Song, L.; Zeng, S.; Zhang, L. MALAT1-miR-124-RBG2 axis is involved in growth and invasion of HR-HPV-positive cervical cancer cells. Tumor Biol. 2015, 37, 633–640. [Google Scholar] [CrossRef]
- Liu, Z.; Mao, L.; Wang, L.; Zhang, H.; Hu, X. miR-218 functions as a tumor suppressor gene in cervical cancer. Mol. Med. Rep. 2019, 21, 209–219. [Google Scholar] [CrossRef] [Green Version]
- Mccredie, M.R.; Paul, C.; Sharples, K.J.; Baranyai, J.; Medley, G.; Skegg, D.C.; Jones, R.W. Consequences in women of participating in a study of the natural history of cervical intraepithelial neoplasia 3. Aust. N. Z. J. Obstet. Gynaecol. 2010, 50, 363–370. [Google Scholar] [CrossRef]
- Schiffman, M.; Yu, K.; Zuna, R.; Dunn, S.T.; Zhang, H.; Walker, J.; Gold, M.; Hyun, N.; Rydzak, G.; Katki, H.A.; et al. Proof-of-principle study of a novel cervical screening and triage strategy: Computer-analyzed cytology to decide which HPV-positive women are likely to have ≥CIN2. Int. J. Cancer 2016, 140, 718–725. [Google Scholar] [CrossRef] [Green Version]
- Li, X.; Zhou, Q.; Tao, L.; Yu, C. MicroRNA-106a promotes cell migration and invasion by targeting tissue inhibitor of matrix metalloproteinase 2 in cervical cancer. Oncol. Rep. 2017, 38, 1774–1782. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Z.; Wang, J.; Li, J.; Wang, X.; Song, W. MicroRNA-150 promotes cell proliferation, migration, and invasion of cervical cancer through targeting PDCD4. Biomed. Pharmacother. 2018, 97, 511–517. [Google Scholar] [CrossRef]
- Lv, M.; Ou, R.; Zhang, Q.; Lin, F.; Li, X.; Wang, K.; Xu, Y. MicroRNA-664 suppresses the growth of cervical cancer cells via targeting c-Kit. Drug Des. Dev. Ther. 2019, 13, 2371–2379. [Google Scholar] [CrossRef] [PubMed]
- Liang, C.; Ding, J.; Yang, Y.; Deng, L.; Li, X. MicroRNA-433 inhibits cervical cancer progression by directly targeting metadherin to regulate the AKT and β-catenin signalling pathways. Oncol. Rep. 2017, 38, 3639–3649. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Yang, F.; Wang, M.; Cao, W.; Yang, Z. miR-378 functions as an onco-miRNA by targeting the ST7L/Wnt/β-catenin pathway in cervical cancer. Int. J. Mol. Med. 2017, 40, 1047–1056. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Q.; Feng, Y.; Chao, X.; Shi, S.; Liang, M.; Qiao, Y.; Wang, B.; Wang, P.; Zhu, Z. HOTAIR contributes to cell proliferation and metastasis of cervical cancer via targetting miR-23b/MAPK1 axis. Biosci. Rep. 2018, 38, BSR20171563. [Google Scholar] [CrossRef] [Green Version]
- Zhu, L.; Yang, S.; Wang, J. miR-217 inhibits the migration and invasion of HeLa cells through modulating MAPK1. Int. J. Mol. Med. 2019, 44, 1824–1832. [Google Scholar] [CrossRef]
- Wang, P.; Zhang, L.; Zhang, J.; Xu, G. MicroRNA-124-3p inhibits cell growth and metastasis in cervical cancer by targeting IGF2BP1. Exp. Ther. Med. 2017, 15, 1385–1393. [Google Scholar] [CrossRef] [Green Version]
- Zhang, L.; Li, H.; Yuan, M.; Li, M.; Zhang, S. Cervical cancer cells-secreted exosomal microRNA-221-3p promotes invasion, migration and angiogenesis of microvascular endothelial cells in cervical cancer by down-regulating MAPK10 expression. Cancer Manag. Res. 2019, 11, 10307–10319. [Google Scholar] [CrossRef] [Green Version]
- Wang, N.; Li, Y.; Zhou, J. miR-31 Functions as an oncomir which promotes epithelial-mesenchymal transition via regulating BAP1 in cervical cancer. BioMed Res. Int. 2017, 2017, 6361420. [Google Scholar] [CrossRef] [Green Version]
- Wei, W.-F.; Zhou, C.-F.; Wu, X.-G.; He, L.-N.; Wu, L.-F.; Chen, X.-J.; Yan, R.-M.; Zhong, M.; Yu, Y.-H.; Liang, L.; et al. MicroRNA-221-3p, a TWIST2 target, promotes cervical cancer metastasis by directly targeting THBS2. Cell Death Dis. 2017, 8, 3220. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Cai, D.; Meng, L.; Wang, B. MicroRNA-124 inhibits proliferation, invasion, migration and epithelial-mesenchymal transition of cervical carcinoma cells by targeting astrocyte-elevated gene-1. Oncol. Rep. 2016, 36, 2321–2328. [Google Scholar] [CrossRef] [Green Version]
- Nahand, J.S.; Taghizadeh-Boroujeni, S.; Karimzadeh, M.; Borran, S.; Pourhanifeh, M.H.; Moghoofei, M.; Bokharaei-Salim, F.; Karampoor, S.; Jafari, A.; Asemi, Z.; et al. microRNAs: New prognostic, diagnostic, and therapeutic biomarkers in cervical cancer. J. Cell. Physiol. 2019, 234, 17064–17099. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Li, S.; Li, Y.; Liu, H.; Zhang, Y.; Zhang, Q. miRNA-218 regulates the proliferation and apoptosis of cervical cancer cells via targeting Gli3. Exp. Ther. Med. 2018, 16, 2433–2441. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mao, Y.; Zhang, L.; Li, Y.; Yan, M.; He, L. MiR-218 suppresses cell progression by targeting APC in cervical cancer. Int. J. Clin. Exp. Pathol. 2017, 10, 2259–2269. [Google Scholar]
- Wan, H.-Y.; Li, Q.-Q.; Zhang, Y.; Tian, W.; Li, Y.-N.; Liu, M.; Li, X.; Tang, H. MiR-124 represses vasculogenic mimicry and cell motility by targeting amotL1 in cervical cancer cells. Cancer Lett. 2014, 355, 148–158. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.-M.; Li, X.-J.; Yang, H.-L.; Zhang, Y.-B.; Li, J.-C. MicroRNA-23b suppresses cervical cancer biological progression by directly targeting six1 and affecting epithelial-to-mesenchymal transition and AKT/mTOR signaling pathway. Eur. Rev. Med. Pharmacol. Sci. 2019, 23, 4688–4697. [Google Scholar] [PubMed]
- Jiang, Z.; Song, Q.; Zeng, R.; Li, J.; Li, J.; Lin, X.; Chen, X.; Zhang, J.; Zheng, Y. MicroRNA-218 inhibits EMT, migration and invasion by targeting SFMBT1 and DCUN1D1 in cervical cancer. Oncotarget 2016, 7, 45622–45636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yeung, C.L.A.; Tsang, T.Y.; Yau, P.L.; Kwok, T.T. Human papillomavirus type 16 E6 induces cervical cancer cell migration through the p53/microRNA-23b/urokinase-type plasminogen activator pathway. Oncogene 2011, 30, 2401–2410. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Song, E.; Yu, W.; Xiong, X.; Kuang, X.; Ai, Y.; Xiong, X. Astrocyte elevated gene-1 promotes progression of cervical squamous cell carcinoma by inducing epithelial-mesenchymal transition via Wnt signaling. Int. J. Gynecol. Cancer 2015, 25, 345–355. [Google Scholar] [CrossRef]
- Xu, Y.; He, Q.; Lu, Y.; Tao, F.; Zhao, L.; Ou, R. MicroRNA-218-5p inhibits cell growth and metastasis in cervical cancer via LYN/NF-κB signaling pathway. Cancer Cell Int. 2018, 18, 198. [Google Scholar] [CrossRef]
- Zhu, L.; Tu, H.; Liang, Y.; Tang, D. MiR-218 produces anti-tumor effects on cervical cancer cells in vitro. World J. Surg. Oncol. 2018, 16, 204. [Google Scholar] [CrossRef]
- Liang, B.; Li, Y.; Wang, T. A three miRNAs signature predicts survival in cervical cancer using bioinformatics analysis. Sci. Rep. 2017, 7, 5624. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zare, A.; Ahadi, A.; Larki, P.; Omrani, M.D.; Zali, M.R.; Alamdari, N.M.; Ghaedi, H. The clinical significance of miR-335, miR-124, miR-218 and miR-484 downregulation in gastric cancer. Mol. Biol. Rep. 2018, 45, 1587–1595. [Google Scholar] [CrossRef]
- Li, W.; Liu, Z.; Chen, L.; Zhou, L.; Yao, Y. MicroRNA-23b is an independent prognostic marker and suppresses ovarian cancer progression by targeting runt-related transcription factor-2. FEBS Lett. 2014, 588, 1608–1615. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, N.; Wang, L.; Tan, G.; Guo, Z.; Liu, L.; Yang, M.; He, J. MicroRNA-218 inhibits proliferation and invasion in ovarian cancer by targeting Runx2. Oncotarget 2017, 8, 91530–91541. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, C.; Tang, Z.; Song, Q.; Yang, M.; Shi, Q.; Weng, Y. Downregulated microRNA-23b promotes BMP9-mediated osteogenesis in C2C12 myoblast cells by targeting Runx2. Mol. Med. Rep. 2016, 13, 2492–2498. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.; Shao, G.; Zhang, M.; Zhu, F.; Zhao, B.; He, C.; Zhang, Z. miR-124 represses the mesenchymal features and suppresses metastasis in Ewing sarcoma. Oncotarget 2016, 8, 10274–10286. [Google Scholar] [CrossRef] [Green Version]
- Han, M.; Chen, L.; Wang, Y. miR-218 overexpression suppresses tumorigenesis of papillary thyroid cancer via inactivation of PTEN /PI3K/AKT pathway by targeting Runx2. OncoTargets Ther. 2018, 11, 6305–6316. [Google Scholar] [CrossRef] [Green Version]
- La Rosa, M.I.C.-D.; Jiménez-Wences, H.; Alarcón-Millán, J.; Romero-López, M.J.; Castañón-Sánchez, C.A.; Salmerón-Bárcenas, E.G.; Fernández-Tilapa, G. miR-218-5p/RUNX2 axis positively regulates proliferation and is associated with poor prognosis in cervical cancer. Int. J. Mol. Sci. 2022, 23, 6993. [Google Scholar] [CrossRef]
- Liu, B.; Tian, Y.; Li, F.; Zhao, Z.; Jiang, X.; Zhai, C.; Han, X.; Zhang, L. Tumor-suppressing roles of miR-214 and miR-218 in breast cancer. Oncol. Rep. 2016, 35, 3178–3184. [Google Scholar] [CrossRef] [Green Version]
- Grossi, I.; Arici, B.; Portolani, N.; De Petro, G.; Salvi, A. Clinical and biological significance of miR-23b and miR-193a in human hepatocellular carcinoma. Oncotarget 2016, 8, 6955–6969. [Google Scholar] [CrossRef] [Green Version]
- Pimenta, R.C.; Viana, N.I.; Amaral, G.Q.; Park, R.; Morais, D.R.; Pontes, J.J.; Guimaraes, V.R.; Camargo, J.A.; Leite, K.R.; Nahas, W.C.; et al. MicroRNA-23b and microRNA-27b plus flutamide treatment enhances apoptosis rate and decreases CCNG1 expression in a castration-resistant prostate cancer cell line. Tumor Biol. 2018, 40, 1010428318803011. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sawada, M.; Kanai, Y.; Arai, E.; Ushijima, S.; Ojima, H.; Hirohashi, S. Increased expression of DNA methyltransferase 1 (DNMT1) protein in uterine cervix squamous cell carcinoma and its precursor lesion. Cancer Lett. 2007, 251, 211–219. [Google Scholar] [CrossRef] [PubMed]
- Au Yeung, C.L.; Tsang, W.P.; Tsang, T.Y.; Co, N.N.; Yau, P.L.; Kwok, T.T. HPV-16 E6 upregulation of DNMT1 through repression of tumor suppresor p53. Oncol. Rep. 2010, 24, 1599–1604. [Google Scholar] [CrossRef] [PubMed]
- Yeung, C.L.A.; Tsang, T.Y.; Yau, P.L.; Kwok, T.T. Human papillomavirus type 16 E6 suppresses microRNA-23b expression in human cervical cancer cells through DNA methylation of the host gene C9orf3. Oncotarget 2017, 8, 12158–12173. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ben, W.; Yang, Y.; Yuan, J.; Sun, J.; Huang, M.; Zhang, D.; Zheng, J. Human papillomavirus 16 E6 modulates the expression of host microRNAs in cervical cancer. Taiwan. J. Obstet. Gynecol. 2015, 54, 364–370. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lopez-Pulido, E.I.; Muñoz-Valle, J.F.; Del Toro-Arreola, S.; Jave-Suárez, L.F.; Bueno-Topete, M.R.; Estrada-Chávez, C.; Pereira-Suárez, A.L. High expression of prolactin receptor is associated with cell survival in cervical cancer cells. Cancer Cell Int. 2013, 13, 103. [Google Scholar] [CrossRef] [Green Version]
- Yeasmin, S.; Nakayama, K.; Rahman, M.T.; Rahman, M.; Ishikawa, M.; Katagiri, A.; Iida, K.; Nakayama, N.; Otuski, Y.; Kobayashi, H.; et al. Biological and clinical significance of NAC1 expression in cervical carcinomas: A comparative study between squamous cell carcinomas and adenocarcinomas/adenosquamous carcinomas. Hum. Pathol. 2012, 43, 506–519. [Google Scholar] [CrossRef]
- Sun, Z.; Niu, S.; Xu, F.; Zhao, W.; Ma, R.; Chen, M. CircAMOTL1 promotes tumorigenesis through miR-526b/SIK2 axis in cervical cancer. Front. Cell Dev. Biol. 2020, 8, 568190. [Google Scholar] [CrossRef]
- Dong, W.; Li, B.; Wang, J.; Song, Y.; Zhang, Z.; Fu, C. MicroRNA-337 inhibits cell proliferation and invasion of cervical cancer through directly targeting specificity protein 1. Tumor Biol. 2017, 39, 1010428317711323. [Google Scholar] [CrossRef] [Green Version]
- Zhao, W.; Yang, H.; Chai, J.; Xing, L. RUNX2 as a promising therapeutic target for malignant tumors. Cancer Manag. Res. 2021, 13, 2539–2548. [Google Scholar] [CrossRef]
- Cohen-Solal, K.A.; Boregowda, R.K.; Lasfar, A. RUNX2 and the PI3K/AKT axis reciprocal activation as a driving force for tumor progression. Mol. Cancer 2015, 14, 137. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pratap, J.; Javed, A.; Languino, L.R.; van Wijnen, A.J.; Stein, J.L.; Stein, G.S.; Lian, J.B. The Runx2 osteogenic transcription factor regulates matrix metalloproteinase 9 in bone metastatic cancer cells and controls cell invasion. Mol. Cell. Biol. 2005, 25, 8581–8591. [Google Scholar] [CrossRef] [PubMed]
- Ouyang, P.; Wu, K.; Su, L.; An, W.; Bie, Y.; Zhang, H.; Kang, H.; Jiang, E.; Zhu, W.; Yao, Y.; et al. Inhibition of human cervical cancer cell invasion by IL-37 involving runt related transcription factor 2 suppression. Ann. Transl. Med. 2019, 7, 568. [Google Scholar] [CrossRef] [PubMed]
miRNA | Expression | Tissue/Cell Lines | Biopsies Available Information | Target mRNA | Biological Function | Reference | ||
---|---|---|---|---|---|---|---|---|
Diagnostic | HPV Infection | Viral Genotype | ||||||
miR-23b-3p | Decreased | Biopsies (n = 16)/CaSki and C-33A | ISC | 16 positive | 16 | c-Met | ↑ Proliferation ↑ Migration ↑ Invasion | [34] |
Decreased | Biopsies/SiHa, HeLa, CaSki cells | ISC | NI | NI | MAPK1 | ↑ Proliferation ↑ Invasion ↓ Apoptosis | [44] | |
miR-124-3p | Decreased | Biopsies (n = 18)/HeLa, SiHa, CaSki and C-33A | 11 ISC 7 ICC | 10 positive 8 negative | NI | AEG-1 | ↑ Proliferation ↑ Migration ↑ Invasion ↓ Apoptosis | [50] |
Decreased | Biopsies/HeLa, SiHa, CaSki cells | ISC | 22 positive | NI | GRB2 | ↑ Proliferation ↑ Invasion ↓ Apoptosis | [35] | |
miR-218-5p | Decreased | Biopsies (n = 80)/Hela, SiHa and C-33A | 40 ISC 40 ICC | 60 positive 20 negative | 16/18 | ROBO1 | ↑ Proliferation ↑ Migration ↑ Invasion | [36] |
Database | Number of Targets for Each miRNA | ||
---|---|---|---|
miR-23b-3p | miR-124-3p | miR-218-5p | |
TargetScanHuman | 1342 | 1820 | 1102 |
miRTarBase | 322 | 1447 | 819 |
miRDB | 1457 | 1648 | 1084 |
Total | 3121 | 4915 | 3005 |
miRNA | Position in 3′-UTR Region | miRNA-mRNA Hybridization | Site | |
---|---|---|---|---|
RUNX2 | hsa-miR-23b-3p | 1047–1068 | miRNA 3′ CCAUUAGGGACCG-UUACACUA 5′ | | | | | | | mRNA 5′ AGUUCAUCCAGGCACAAUGUGAU 3′ | 7mer-m8 |
hsa-miR-124-3p | 1529–1535 | miRNA 3′ CCGUAAGUGGCGCACGGAAU 5′ | | | | | | mRNA 5′ AGGGGAACCCCAAUCUGCCUUAC 3′ | 7mer-A1 | |
hsa-miR-218-5p | 1308–1315 | miRNA 3′ UGUACCAAUCUAGUUCGUGUU 5′ | | | | | | | mRNA 5′ UCAUAUUAAAAAGACAAGCACAA 3′ | 8mer | |
2260–2266 | miRNA 3′ UGUACCAAUCUAGUUCGUGUU 5′ | | | | | | | mRNA 5′ GUGUGUGGUAGCUUGAAGCACAC 3′ | 7mer-m8 | ||
2840–2846 | miRNA 3′ UGUACCAAUCUAGU—UCGUGUU 5′ | | | | | | mRNA 5′ CGUGGUUCUCUUUGUAGCACAA 3′ | 7mer-A1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Romero-López, M.J.; Jiménez-Wences, H.; Cruz-De la Rosa, M.I.; Román-Fernández, I.V.; Fernández-Tilapa, G. miR-23b-3p, miR-124-3p and miR-218-5p Synergistic or Additive Effects on Cellular Processes That Modulate Cervical Cancer Progression? A Molecular Balance That Needs Attention. Int. J. Mol. Sci. 2022, 23, 13551. https://doi.org/10.3390/ijms232113551
Romero-López MJ, Jiménez-Wences H, Cruz-De la Rosa MI, Román-Fernández IV, Fernández-Tilapa G. miR-23b-3p, miR-124-3p and miR-218-5p Synergistic or Additive Effects on Cellular Processes That Modulate Cervical Cancer Progression? A Molecular Balance That Needs Attention. International Journal of Molecular Sciences. 2022; 23(21):13551. https://doi.org/10.3390/ijms232113551
Chicago/Turabian StyleRomero-López, Manuel Joaquín, Hilda Jiménez-Wences, Merlin Itsel Cruz-De la Rosa, Ilce Valeria Román-Fernández, and Gloria Fernández-Tilapa. 2022. "miR-23b-3p, miR-124-3p and miR-218-5p Synergistic or Additive Effects on Cellular Processes That Modulate Cervical Cancer Progression? A Molecular Balance That Needs Attention" International Journal of Molecular Sciences 23, no. 21: 13551. https://doi.org/10.3390/ijms232113551