Chronic Methylmercury Intoxication Induces Systemic Inflammation, Behavioral, and Hippocampal Amino Acid Changes in C57BL6J Adult Mice
Abstract
1. Introduction
2. Results
2.1. MeHg Intoxication and Metabolic Changes
2.2. Systemic Inflammation Biomarkers
2.3. Hippocampal Neuroinflammatory-Related Biomarkers
2.4. Hippocampal Neurochemical Changes
2.5. Exploratory and Locomotor Behavior
2.6. Memory Assessment
3. Discussion
4. Materials and Methods
4.1. Experimental Mice
4.2. MeHg Intoxication
4.3. Determination of Hair Hg Concentration
4.4. Evaluation of Lipid Profile
4.5. Systemic Inflammation Biomarkers
4.6. Enzymatic Activity of MPO
4.7. Hippocampal MDA Levels
4.8. Analysis of Neuroinflammatory-Related Gene Expression
4.9. Hippocampal Acetylcholinesterase (AChE) Activity
4.10. Hippocampal Amino Acids Levels by HPLC and BDNF ELISA Assay
4.11. Behavioral Assessment
4.11.1. Open-Field Test
4.11.2. Y-Maze Test
4.11.3. Barnes Maze
4.12. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Chételat, J.; Hickey, M.B.C.; Poulain, A.J.; Dastoor, A.; Ryjkov, A.; McAlpine, D.; Vanderwolf, K.; Jung, T.S.; Hale, L.; Cooke, E.L.L.; et al. Spatial variation of mercury bioaccumulation in bats of Canada linked to atmospheric mercury deposition. Sci. Total Environ. 2018, 626, 668–677. [Google Scholar] [CrossRef] [PubMed]
- Le Croizier, G.; Sonke, J.E.; Lorrain, A.; Renedo, M.; Hoyos-Padilla, M.; Santana-Morales, O.; Meyer, L.; Huveneers, C.; Butcher, P.; Amezcua-Martinez, F.; et al. Foraging plasticity diversifies mercury exposure sources and bioaccumulation patterns in the world’s largest predatory fish. J. Hazard. Mater. 2022, 425, 127956. [Google Scholar] [CrossRef] [PubMed]
- Meneses, H.N.M.; Oliveira-da-Costa, M.; Basta, P.C.; Morais, C.G.; Pereira, R.J.B.; Souza, S.M.S.; Hacon, S.S. Mercury Contamination: A Growing Threat to Riverine and Urban Communities in the Brazilian Amazon. Int. J. Environ. Res. Public Health 2022, 19, 2816. [Google Scholar] [CrossRef] [PubMed]
- Costa Júnior, J.M.F.; Silva, C.I.M.; Lima, A.A.S.; Júnior, D.R.; Silveira, L.C.L.; Souza, G.S.; Pinheiro, M.C.N. Teores de mercúrio em cabelo e consumo de pescado de comunidades ribeirinhas na Amazônia brasileira, região do Tapajós. Cien. Saude Colet. 2018, 23, 805–812. [Google Scholar] [CrossRef] [PubMed]
- Ni, M.; Li, X.; Rocha, J.B.T.; Farina, M.; Aschner, M. Glia and Methylmercury Neurotoxicity. J. Toxicol. Environ. Health Part A 2017, 75, 1091–1101. [Google Scholar] [CrossRef]
- Macedo-Júnior, S.J.; Luiz-Cerutti, M.; Nascimento, D.B.; Farina, M.; Soares Santos, A.R.; de Azevedo Maia, A.H. Methylmercury exposure for 14 days (short-term) produces behavioral and biochemical changes in mouse cerebellum, liver, and serum. J. Toxicol. Environ. Health Part A 2017, 80, 1145–1155. [Google Scholar] [CrossRef]
- Azar, J.; Yousef, M.H.; El-Fawal, H.A.; Abdelnaser, A. Mercury and Alzheimer’s disease: A look at the links and evidence. Metab. Brain Dis. 2021, 36, 361–374. [Google Scholar] [CrossRef]
- Walsh, R.N.; Cummins, R.A. The open-field test: A critical review. Psychol. Bull. 1976, 83, 482–504. [Google Scholar] [CrossRef]
- Madejczyk, M.S.; Aremu, D.A.; Simmons-Willis, T.A.; Clarkson, T.W.; Ballatori, N. Accelerated urinary excretion of methylmercury following administration of its antidote N-acetylcysteine requires Mrp2/Abcc2, the apical multidrug resistance-associated protein. J. Pharmacol. Exp. Ther. 2007, 322, 378–384. [Google Scholar] [CrossRef]
- Moreira, E.L.; Oliveira, J.; Dutra, M.F.; Santos, D.B.; Gonçalves, C.A.; Goldfeder, E.M.; Bem, A.F.; Prediger, R.D.; Aschner, M.; Farina, M. Does Methylmercury-Induced Hypercholesterolemia Play a Causal Role in Its Neurotoxicity and Cardiovascular Disease? Toxicol. Sci. 2012, 130, 373–382. [Google Scholar] [CrossRef]
- Ferrer, B.; Prince, L.M.; Tinkov, A.A.; Santamaria, A.; Bowman, A.B.; Aschner, M. Chronic exposure to methylmercury disrupts ghrelin actions in C57BL/6J mice. Food Chem. Toxicol. 2021, 147, 111918. [Google Scholar] [CrossRef] [PubMed]
- Ellingsen, D.G.; Efskind, J.; Haug, E.; Thomassen, Y.; Martinsen, I.; Gaarder, P.I. Effects of low mercury vapour exposure on the thyroid function in chloralkali workers. J. Appl. Toxicol. 2000, 20, 483–489. [Google Scholar] [CrossRef]
- Merke, A.; Merke, J.; Silbernagel, G.; März, W. Free Thyroid Hormones and Mortality in Caucasians Undergoing Angiography: The Ludwigshafen Risk and Cardiovascular Health (Luric) Study. Endocr. Pract. 2017, 23, 288–298. [Google Scholar] [CrossRef] [PubMed]
- Leocádio, P.C.L.; Dias, R.P.; Pinto, D.V.; Reis, J.M.; Nascimento, J.C.R.; Brito, G.A.C.; Júnior, J.T.V.; Foureaux, G.; Ferreira, A.J.; Windmöller, C.C.; et al. Pollutants and nutrition: Are methylmercury effects on blood pressure and lipoprotein profile comparable to high-fat diet in mice? Ecotoxicol. Environ. Saf. 2020, 204, 111036. [Google Scholar] [CrossRef]
- Pinto, D.V.; Raposo, R.S.; Matos, G.A.; Alvarez-Leite, J.I.; Malva, J.O.; Oriá, R.B. Methylmercury Interactions With Gut Microbiota and Potential Modulation of Neurogenic Niches in the Brain. Front. Neurosci. 2020, 14, 576543. [Google Scholar] [CrossRef] [PubMed]
- Jin, X.; Hidiroglou, N.; Lok, E.; Taylor, M.; Kapal, K.; Ross, N.; Sarafin, K.; Lau, A.; Souza, A.; Chan, H.M.; et al. Dietary Selenium (Se) and Vitamin E (VE) Supplementation Modulated Methylmercury-Mediated Changes in Markers of Cardiovascular Diseases in Rats. Cardiovasc. Toxicol. 2012, 12, 10–24. [Google Scholar] [CrossRef]
- De Freitas, A.S.; Funck, V.R.; dos Santos Rotta, M.; Bohrer, D.; Mörschbächer, V.; Puntel, R.L.; Nogueira, C.W.; Farina, M.; Aschner, M.; Rocha, J.B.T. Diphenyl diselenide, a simple organoselenium compound, decreases methylmercury-induced cerebral, hepatic and renal oxidative stress and mercury deposition in adult mice. Brain Res. Bull. 2009, 79, 77–84. [Google Scholar] [CrossRef]
- Ruan, Y.; Wu, C.; Guo, X.; Xu, Z.; Xing, C.; Cao, H.; Zhang, C.; Hu, G.; Liu, P. High Doses of Copper and Mercury Changed Cecal Microbiota in Female Mice. Biol. Trace Elem. Res. 2019, 189, 134–144. [Google Scholar] [CrossRef]
- Bhat, M.; Pasini, E.; Copeland, J.; Angeli, M.; Husain, S.; Kumar, D.; Renner, E.; Teterina, A.; Allard, J.; Guttman, D.S.; et al. Impact of Immunosuppression on the Metagenomic Composition of the Intestinal Microbiome: A Systems Biology Approach to Post-Transplant Diabetes. Sci. Rep. 2017, 7, 10277. [Google Scholar] [CrossRef]
- Indiani, C.M.S.P.; Rizzardi, K.F.; Castelo, P.M.; Ferraz, L.F.C.; Darrieux, M.; Parisotto, T.M. Childhood Obesity and Firmicutes/Bacteroidetes Ratio in the Gut Microbiota: A Systematic Review. Child. Obes. 2018, 14, 501–509. [Google Scholar] [CrossRef]
- Zhang, B.-B.; Liu, Y.-M.; Hu, A.-L.; Xu, S.-F.; Fan, L.-D.; Cheng, M.-L.; Wei, L.-X.; Liu, J. HgS and Zuotai differ from HgCl2 and methyl mercury in intestinal Hg absorption, transporter expression and gut microbiome in mice. Toxicol. Appl. Pharmacol. 2019, 379, 114615. [Google Scholar] [CrossRef] [PubMed]
- Erdamar, H.; Türközkan, N.; Ekremoğlu, M.; Kurt, Y.; Yaman, H. The effect of taurine on polymorphonuclear leukocyte functions in endotoxemia. Amino Acids 2007, 33, 581–585. [Google Scholar] [CrossRef] [PubMed]
- Huebbe, P.; Rimbach, G. Evolution of human apolipoprotein E (APOE) isoforms: Gene structure, protein function and interaction with dietary factors. Ageing Res. Rev. 2017, 37, 146–161. [Google Scholar] [CrossRef] [PubMed]
- Kim, C.; Jang, J.S.; Cho, M.-R.; Agarawal, S.R.; Cha, Y.-N. Taurine chloramine induces heme oxygenase-1 expression via Nrf2 activation in murine macrophages. Int. Immunopharmacol. 2010, 10, 440–446. [Google Scholar] [CrossRef]
- Piao, S.; Cha, Y.-N.; Kim, C. Taurine chloramine protects RAW 264.7 macrophages against hydrogen peroxide-induced apoptosis by increasing antioxidants. J. Clin. Biochem. Nutr. 2011, 49, 50–56. [Google Scholar] [CrossRef]
- Jong, C.J.; Azuma, J.; Schaffer, S. Mechanism underlying the antioxidant activity of taurine: Prevention of mitochondrial oxidant production. Amino Acids 2012, 42, 2223–2232. [Google Scholar] [CrossRef]
- Towner, R.A.; Saunders, D.; Smith, N.; Towler, W.; Cruz, M.; Do, S.; Maher, J.E.; Whitaker, K.; Lerner, M.; Morton, K.A. Assessing long-term neuroinflammatory responses to encephalopathy using MRI approaches in a rat endotoxemia model. GeroScience 2018, 40, 49–60. [Google Scholar] [CrossRef]
- Spadoni, I.; Zagato, E.; Bertocchi, A.; Paolinelli, R.; Hot, E.; Sabatino, A.D.; Caprioli, F.; Bottiglieri, L.; Oldani, A.; Viale, G.; et al. A gut-vascular barrier controls the systemic dissemination of bacteria. Science 2015, 350, 830–834. [Google Scholar] [CrossRef]
- Ray, R.S.; Katyal, A. Myeloperoxidase: Bridging the gap in neurodegeneration. Neurosci. Biobehav. Rev. 2016, 68, 611–620. [Google Scholar] [CrossRef]
- Aslankoc, R.; Savran, M.; Ozmen, O.; Asci, S. Hippocampus and cerebellum damage in sepsis induced by lipopolysaccharide in aged rats—Pregabalin can prevent damage. Biomed. Pharmacother. 2018, 108, 1384–1392. [Google Scholar] [CrossRef]
- Arnhold, J.; Flemmig, J. Human myeloperoxidase in innate and acquired immunity. Arch. Biochem. Biophys. 2010, 500, 92–106. [Google Scholar] [CrossRef] [PubMed]
- Üllen, A.; Singewald, E.; Konya, V.; Fauler, G.; Reicher, H.; Nusshold, C.; Hammer, A.; Kratky, D.; Heinemann, A.; Holzer, P.; et al. Myeloperoxidase-Derived Oxidants Induce Blood-Brain Barrier Dysfunction In Vitro and In Vivo. PLoS ONE 2013, 8, e64034. [Google Scholar] [CrossRef] [PubMed]
- Huh, S.H.; Chung, Y.C.; Piao, Y.; Jin, M.Y.; Son, H.J.; Yoon, N.S.; Hong, J.Y.; Pak, Y.K.; Kim, Y.S.; Hong, J.K.; et al. Ethyl Pyruvate Rescues Nigrostriatal Dopaminergic Neurons by Regulating Glial Activation in a Mouse Model of Parkinson’s Disease. J. Immunol. 2011, 187, 960–969. [Google Scholar] [CrossRef] [PubMed]
- Shinozaki, Y.; Nomura, M.; Iwatsuki, K.; Moriyama, Y.; Gachet, C.; Koizumi, S. Microglia trigger astrocyte-mediated neuroprotection via purinergic gliotransmission. Sci. Rep. 2014, 4, 4329. [Google Scholar] [CrossRef] [PubMed]
- Shimizu, E.; Kawahara, K.; Kajizono, M.; Sawada, M.; Nakayama, H. IL-4-Induced Selective Clearance of Oligomeric β-Amyloid Peptide 1–42 by Rat Primary Type 2 Microglia. J. Immunol. 2008, 181, 6503–6513. [Google Scholar] [CrossRef]
- Derecki, N.C.; Quinnies, K.M.; Kipnis, J. Alternatively activated myeloid (M2) cells enhance cognitive function in immune compromised mice. Brain Behav. Immun. 2011, 25, 379–385. [Google Scholar] [CrossRef]
- Teixeira, F.B.; Leão, L.K.R.; Bittencourt, L.O.; Aragão, W.A.B.; Nascimento, P.C.; Luz, D.A.; Braga, D.V.; Silva, M.C.F.; Oliveira, K.R.M.; Herculano, A.M.; et al. Neurochemical dysfunction in motor cortex and hippocampus impairs the behavioral performance of rats chronically exposed to inorganic mercury. J. Trace Elem. Med. Biol. 2019, 52, 143–150. [Google Scholar] [CrossRef]
- Aaseth, J.; Wallace, D.R.; Vejrup, K.; Alexander, J. Methylmercury and developmental neurotoxicity: A global concern. Curr. Opin. Toxicol. 2020, 19, 80–87. [Google Scholar] [CrossRef]
- Bittencourt, L.O.; Dionizio, A.; Nascimento, P.C.; Puty, B.; Leão, L.K.R.; Luz, D.A.; Silva, M.C.F.; Amado, K.K.; Leite, A.; Buzalaf, M.R.; et al. Proteomic approach underlying the hippocampal neurodegeneration caused by low doses of methylmercury after long-term exposure in adult rats. Metallomics 2019, 11, 390–403. [Google Scholar] [CrossRef]
- Christinal, J.; Sumathi, T. Effect of Bacopa monniera Extract on Methylmercury-Induced Behavioral and Histopathological Changes in Rats. Biol. Trace Elem. Res. 2013, 155, 56–64. [Google Scholar] [CrossRef]
- Fonfría, E.; Rodríguez-Farré, E.; Suñol, C. Mercury interaction with the GABA(A) receptor modulates the benzodiazepine binding site in primary cultures of mouse cerebellar granule cells. Neuropharmacology 2001, 41, 819–833. [Google Scholar] [CrossRef]
- Yuan, Y.; Atchison, W.D. Methylmercury acts at multiple sites to block hippocampal synaptic transmission. J. Pharmacol. Exp. Ther. 1995, 275, 1308–1316. [Google Scholar] [CrossRef] [PubMed]
- Giachino, C.; Barz, M.; Tchorz, J.S.; Tome, M.; Gassmann, M.; Bischofberger, J.; Bettler, B.; Taylor, V. GABA suppresses neurogenesis in the adult hippocampus through GABAB receptors. Development 2014, 141, 83–90. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Zhong, C.; Bonaguidi, M.A.; Sun, G.J.; Hsu, D.; Gu, Y.; Meletis, K.; Huang, Z.J.; Ge, S.; Enikolopov, G.; et al. Neuronal circuitry mechanism regulating adult quiescent neural stem-cell fate decision. Nature 2012, 489, 150–154. [Google Scholar] [CrossRef] [PubMed]
- Ulrich, D.; Bettler, B. GABA(B) receptors: Synaptic functions and mechanisms of diversity. Curr. Opin. Neurobiol. 2007, 17, 298–303. [Google Scholar] [CrossRef]
- Sastry, K.V.; Rao, D.R. Effect of mercuric chloride on the intestinal absorption of an amino acid, glycine, in the freshwater murrel, Channa punctatus. Toxicol. Lett. 1982, 11, 11–15. [Google Scholar] [CrossRef]
- Reynolds, J.N.; Racz, W.J. Effects of methylmercury on the spontaneous and potassium-evoked release of endogenous amino acids from mouse cerebellar slices. Can. J. Physiol. Pharmacol. 1987, 65, 791–798. [Google Scholar] [CrossRef]
- Hirayama, K.; Inouye, M.; Fujisaki, T. Alteration of putative amino acid levels and morphological findings in neural tissues of methylmercury-intoxicated mice. Arch. Toxicol. 1985, 57, 35–40. [Google Scholar] [CrossRef]
- Chen, C.; Xia, S.; He, J.; Lu, G.; Xie, Z.; Han, H. Roles of taurine in cognitive function of physiology, pathologies and toxication. Life Sci. 2019, 231, 116584. [Google Scholar] [CrossRef]
- Zhu, W.; Cruz, G.B.; Ayaz, Z.; Joseph, J.N.; Boby, A.; Cadet, P.; Neuwirth, L.S. Influences of Taurine Pharmacodynamics and Sex on Active Avoidance Learning and Memory. Adv. Exp. Med. Biol. 2022, 1370, 381–393. [Google Scholar] [CrossRef]
- Zheng, J. Protective Effects of Taurine Against Inflammation and Apoptosis in Cadmium-Induced Hepatotoxicity. Mol. Med. Rep. 2021, 18, 1–15. [Google Scholar] [CrossRef]
- Gonzalez-Vazquez, A.; Aguilar-Peralta, A.-K.; Tomas-Sanchez, C.; Branco-Alvarez, V.-M.; Martinez-Fong, D.; Gonzalez-Barrios, J.-A.; Treviño, S.; Peña, L.M.-P.; Alatriste, V.; Soto-Rodriguez, G.; et al. Taurine Increases Zinc Preconditioning-Induced Prevention of Nitrosative Stress, Metabolic Alterations, and Motor Deficits in Young Rats following Intrauterine Ischemia. Oxid. Med. Cell. Longev. 2021, 2021, 6696538. [Google Scholar] [CrossRef] [PubMed]
- Wei, B.; Liu, M.; Chen, Z.; Wei, M. Schisandrin ameliorates cognitive impairment and attenuates Aβ deposition in APP/PS1 transgenic mice: Involvement of adjusting neurotransmitters and their metabolite changes in the brain. Acta Pharmacol. Sin. 2018, 39, 616–625. [Google Scholar] [CrossRef] [PubMed]
- Chupel, M.U.; Minuzzi, L.G.; Furtado, G.E.; Santos, M.L.; Ferreira, J.P.; Filaire, E.; Teixeira, A.M. Taurine supplementation reduces myeloperoxidase and matrix-metalloproteinase-9 levels and improves the effects of exercise in cognition and physical fitness in older women. Amino Acids 2021, 53, 333–345. [Google Scholar] [CrossRef] [PubMed]
- da Silva Raposo, R.; Pinto, D.V.; Moreira, R.; Dias, R.P.; Fontes Ribeiro, C.A.; Oriá, R.B.; Malva, J.O. Methylmercury Impact on Adult Neurogenesis: Is the Worst Yet to Come From Recent Brazilian Environmental Disasters? Front. Aging Neurosci. 2020, 12, 591601. [Google Scholar] [CrossRef] [PubMed]
- Reagan-Shaw, S.; Nihal, M.; Ahmad, N. Dose translation from animal to human studies revisited. FASEB J. 2008, 22, 659–661. [Google Scholar] [CrossRef]
Primers | Forward (5′→3′) | Reverse (5′→3′) |
---|---|---|
IFN-γ | CACGCCGCGTCTTGGT | TCTAGGCTTTCAATGAGT |
IL-4 | ACAGGAGAAGGGACGCCAT | GAAGCCCTACAGACGAGCTCA |
IL-5 | GACTCTCAGCTGTGTCTGGG | GGACAGCTGTGTCAAGGTCT |
IL-6 | CTGCAAGAGACTTCCATCCAG | AGTGGTATAGACAGGTCTGTTGG |
IL-10 | GTGAAGACTTTCTTTCAAACAAAG | CTGCTCCACTGCCTTGCTCTTATT |
β-actin | GTGGGCCGCTCTAGGCACCAA | CTCTTTGATGTCACGCACGATTTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nascimento, T.S.; Pinto, D.V.; Dias, R.P.; Raposo, R.S.; Nunes, P.I.G.; Roque, C.R.; Santos, F.A.; Andrade, G.M.; Viana, J.L.; Fostier, A.H.; et al. Chronic Methylmercury Intoxication Induces Systemic Inflammation, Behavioral, and Hippocampal Amino Acid Changes in C57BL6J Adult Mice. Int. J. Mol. Sci. 2022, 23, 13837. https://doi.org/10.3390/ijms232213837
Nascimento TS, Pinto DV, Dias RP, Raposo RS, Nunes PIG, Roque CR, Santos FA, Andrade GM, Viana JL, Fostier AH, et al. Chronic Methylmercury Intoxication Induces Systemic Inflammation, Behavioral, and Hippocampal Amino Acid Changes in C57BL6J Adult Mice. International Journal of Molecular Sciences. 2022; 23(22):13837. https://doi.org/10.3390/ijms232213837
Chicago/Turabian StyleNascimento, Tyciane S., Daniel V. Pinto, Ronaldo P. Dias, Ramon S. Raposo, Paulo Iury G. Nunes, Cássia R. Roque, Flávia A. Santos, Geanne M. Andrade, José Lucas Viana, Anne H. Fostier, and et al. 2022. "Chronic Methylmercury Intoxication Induces Systemic Inflammation, Behavioral, and Hippocampal Amino Acid Changes in C57BL6J Adult Mice" International Journal of Molecular Sciences 23, no. 22: 13837. https://doi.org/10.3390/ijms232213837
APA StyleNascimento, T. S., Pinto, D. V., Dias, R. P., Raposo, R. S., Nunes, P. I. G., Roque, C. R., Santos, F. A., Andrade, G. M., Viana, J. L., Fostier, A. H., Sussulini, A., Alvarez-Leite, J. I., Fontes-Ribeiro, C., Malva, J. O., & Oriá, R. B. (2022). Chronic Methylmercury Intoxication Induces Systemic Inflammation, Behavioral, and Hippocampal Amino Acid Changes in C57BL6J Adult Mice. International Journal of Molecular Sciences, 23(22), 13837. https://doi.org/10.3390/ijms232213837