Functional and Molecular Immune Response of Rainbow Trout (Oncorhynchus mykiss) Following Challenge with Yersinia ruckeri
Abstract
:1. Introduction
2. Results
2.1. Hematological Analyses and Blood Smears
2.2. Innate Humoral and Oxidative Stress Parameters
2.3. Immune Related Genes Analyzed by Real-Time qPCR
3. Discussion
4. Materials and Methods
4.1. Experimental Design
4.2. Bacterial Growth and Inoculum Preparation
4.3. Bacterial Challenge
4.4. Sampling
4.5. Hematological Analyses and Blood Smears
- MCV (µm3) = (Ht/RBC) × 10
- MCH (pg/cell) = (Hb/RBC) × 10
- MHCH (g/100 mL) = (Hb/Ht) × 100
4.6. Innate Humoral Immune Parameters
4.6.1. Peroxidase (PER)
4.6.2. Anti-Protease (AP)
- % non-inhibited trypsin = (Sample absorbance × 100)/Reference sample
- % inhibited trypsin = 100 − % non-inhibited trypsin
4.6.3. Lysozyme (LYS)
4.6.4. Nitric Oxide (NO)
4.7. Oxidative Stress
4.7.1. Liver Homogenization
4.7.2. Protein Concentration
4.7.3. Lipid Peroxidation (LPO)
4.7.4. Catalase (CAT)
4.7.5. Superoxide Dismutase (SOD)
4.7.6. Glutathione-S-Transferase (GST)
4.8. Gene Expression Analysis
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- The State of World Fisheries and Aquaculture (SOFIA); FAO: Rome, Italy, 2020. [CrossRef]
- INE (Instituto Nacional de Estatística). Estatísticas da Pesca: 2020; INE: Lisboa, Portugal, 2021; Available online: https://www.ine.pt/xurl/pub/280980980 (accessed on 25 November 2021).
- Davies, R.L.; Frerichs, G.N. Morphological and biochemical differences among isolates of Yersinia ruckeri obtained from wide geographical areas. J. Fish Dis. 1989, 12, 357–365. [Google Scholar] [CrossRef]
- Fouz, B.; Zarza, C.; Amaro, C. First description of non-motile Yersinia ruckeri serovar I strains causing disease in rainbow trout, Oncorhynchus mykiss (Walbaum), cultured in Spain. J. Fish Dis. 2006, 29, 339–346. [Google Scholar] [CrossRef] [PubMed]
- Ross, A.J.; Rucker, R.R.; Ewing, W.H. Description of a bacterium associated with redmouth disease of rainbow trout (Salmo gairdneri). Can. J. Microbiol. 1966, 12, 763–770. [Google Scholar] [CrossRef] [PubMed]
- Frerichs, G.N. Isolation and Identification of Fish Bacterial Pathogens. In Bacterial Diseases of Fish; Inglis, V., Roberts, R.J., Bromage, N.R., Eds.; Blackwell Science Ltd.: Oxford, UK, 1993; pp. 270–272. [Google Scholar]
- Gibello, A.; Blanco, M.M.; Moreno, M.A.; Dominguez, L.; Fernandez-Garayzabal, L.F. Utilización de la PCR para el diagnóstico en ictiopatología. Rev. AquaTiC 2001, 15, 1–16. [Google Scholar]
- Sirvas-Cornejo, S.; Sanchez-Robinet, C.C.; Peña-Dominguez, C. Rapid diagnosis and identification by PCR of Yersinia ruckeri isolated of Oncorhynchus mykiss from Canta, Lima, Peru. Rev. Peru Biol. 2011, 18, 349–353. [Google Scholar]
- Rucker, R. Redmouth disease of rainbow trout (Salmo gairdneri). Bull. Off. Int. Epizoot. 1966, 65, 825–830. [Google Scholar] [PubMed]
- Alvarez, J.D.; Austin, B.; Conroy, D.A. First outbreak of enteric redmouth of rainbow trout Oncorhynchus mykiss cultured in Venezuela. Bull. Eur. Ass. Fish Pathol. 1992, 12, 190–198. [Google Scholar]
- Bravo, S. Disease reported in pen reared salmonids from Chile. AFS/FHS Newsl. 1993, 21, 3. [Google Scholar]
- Bravo, S.; Kojagura, V. First isolation of Yersinia ruckeri from rainbow trout (Oncorhynchus mykiss) in Peru. Bull. Eur. Ass. Fish Pathol. 2004, 24, 104–108. [Google Scholar]
- Sierralta, V.; Leon, J.; De Blas, I.; Bastardo, A.; Romalde, J.L.; Castro, T.; Mateo, E. Patología e identificación de Yersinia ruckeri en trucha arco iris (Oncorhynchus mykiss) en piscigranjas de Junín, Perú. Rev. AquaTIC 2013, 38, 28–45. [Google Scholar]
- Lesel, R.; Lesel, M.; Gavini, F.; Vuillaume, A. Outbreak of enteric redmouth disease in rainbow trout. Salmo gairdneri Richardson, in France. J. Fish Dis. 1983, 6, 385–387. [Google Scholar] [CrossRef]
- Fuhrmann, H.; Bohm, K.H.; Schlotfeldt, H.J. An outbreak of enteric redmouth disease in West Germany. J. Fish Dis. 1983, 6, 309–311. [Google Scholar] [CrossRef]
- Sousa, J.A.; Romalde, J.L.; Ledo, A.; Eiras, J.C.; Barja, J.L.; Toranzo, A.E. Health status of salmonid aquaculture in North Portugal. First detection of IPN virus. J. Fish Dis. 1996, 19, 83–89. [Google Scholar] [CrossRef]
- Austin, D.A.; Robertson, P.A.; Austin, B. Recovery of a new biogroup of Yersinia ruckeri from diseased rainbow trout (Oncorhynchus mykiss, Walbaum). Syst. Appl. Microbiol. 2003, 26, 127–131. [Google Scholar] [CrossRef] [PubMed]
- Timur, G.; Timur, M. An outbreak of enteric redmouth disease in farmed rainbow trout (Oncorynchus mykiss) in Turkey. Bull Eur. Ass. Fish Pathol. 1991, 11, 182–183. [Google Scholar]
- Soltani, M.; Fadaiifard, F.; Mehrabi, M.R. First report of yersiniosis-like infection in farmed rainbow trout. Bull. Eur. Assoc. Fish Pathol. 1999, 23, 173–176. [Google Scholar]
- Raidal, S.; Cross, G.; Fenwick, S.; Nicholls, P.; Nowak, B.; Ellard, K.; Stephens, E. Aquatic Animal Health: Exotic Disease Training Manual; Fisheries Research and Development Corp. and Murdoch University: Perth, Australia, 2004; pp. 40–42. [Google Scholar]
- Bragg, R.R.; Henton, M.M. Isolation of Yersinia ruckeri from rainbow trout in South Africa. Bull. Eur. Assoc. Fish Pathol. 1986, 6, 5–6. [Google Scholar]
- Bullock, G.L.; Struckey, H.M.; Shotts, E.B. Early records of North American and Australian outbreaks of enteric redmouth disease. Fish Health News 1977, 6, 96. [Google Scholar]
- Horne, M.T.; Barnes, A.C. Enteric Redmouth Disease (Yersinia ruckeri). In Fish Diseases and Disorders. Viral, Bacterial and Fungal Infections; Woo, P.T.K., Bruno, D.W., Eds.; CABI Publishing: Wallingford, UK, 1999; Volume 3, pp. 455–477. [Google Scholar]
- Raida, M.K.; Buchmann, K. Development of adaptive immunity in rainbow trout, Oncorhynchus mykiss (Walbaum) surviving an infection with Yersinia ruckeri. Fish Shellfish Immunol. 2008, 25, 533–541. [Google Scholar] [CrossRef] [PubMed]
- Tobback, E.; Decostere, A.; Hermans, K.; Ryckaert, J.; Duchateau, L.; Haesebrouck, F.; Chiers, K. Route of entry and tissue distribution of Yersinia ruckeri in experimentally infected rainbow trout Oncorhynchus mykiss. Dis. Aquat. Org. 2009, 84, 219–228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Farsani, M.N.; Hoseinifar, S.H.; Rashidian, G.; Farsani, H.G.; Ashouri, G.; Van Doan, H. Dietary effects of Coriandrum sativum extract on growth performance, physiological and innate immune responses and resistance of rainbow trout (Oncorhynchus mykiss) against Yersinia ruckeri. Fish Shellfish Immunol. 2019, 91, 233–240. [Google Scholar] [CrossRef] [PubMed]
- Tobback, E.; Decostere, A.; Hermans, K.; Haesebrouck, F.; Chiers, K. Yersinia ruckeri infections in salmonid fish. J. Fish Dis. 2007, 30, 257–268. [Google Scholar] [CrossRef] [PubMed]
- Furones, M.D.; Rodgers, C.J.; Munn, C.B. Yersinia ruckeri, the causal agent of enteric redmouth disease (ERM) in fish. Annu. Rev. Fish Dis. 1993, 3, 105–125. [Google Scholar] [CrossRef]
- Frerichs, G.N.; Stewart, J.A.; Collens, R.O. Atypical infection of rainbow trout, (Salmo gairdneri, Richardson), with Yersinia ruckeri. J. Fish Dis. 1985, 8, 383–387. [Google Scholar] [CrossRef]
- Inglis, V.; Roberts, R.J.; Bromage, N.J. Enteric Redmouth (ERM) and Other Enterobacterial Infections of Fish. In Bacterial Diseases of Fish; Blackwell Scientific: Oxford, UK, 1993; pp. 80–105. [Google Scholar]
- Carson, J.; Wilson, T. Australia and New Zealand Standard Diagnostic Procedure Manual; Ablis: Victoria, Australia, 2009; pp. 1–18. [Google Scholar]
- Avci, H.; Birincioğlu, S.S. Pathological findings in rainbow trout (Oncorhynchus mykiss, Walbaum 1792) experimentally infected with Yersinia ruckeri. Turk. J. Vet. Anim. Sci. 2005, 29, 1321–1328. [Google Scholar]
- Roberts, M.S. A report of an epizootic in hatchery reared rainbow trout, Salmo gairdneri Richardson, at an English trout farm, caused by Yersinia ruckeri. J. Fish Dis. 1983, 6, 551–552. [Google Scholar] [CrossRef]
- Rigos, G.; Stevenson, R. The effect of antibiotic treatment on the establishment of persistent infection with Yersinia ruckeri Serovar II in rainbow trout Oncorhynchus mykiss (Walbaum). Aquac. Int. 2001, 9, 247–253. [Google Scholar] [CrossRef]
- Busch, R.A.; Lingg, A.J. Establishment of an asymptomatic carrier state infection of enteric redmouth disease in rainbow trout (Salmo gairdneri). J. Fish Res. Board Can. 1975, 32, 2429–2432. [Google Scholar] [CrossRef]
- Busch, R.A. Enteric Redmouth Disease. Symposium Internatinal de Talloires. Les Antigenes des Microorganismes Pathogens des Poissons; Collection Fondation Marcel Merieux: Lyon, France, 1982; pp. 201–224. [Google Scholar]
- Valtonen, E.T.; Rintamaki, P.; Koskivaara, M. Occurrence and pathogenicity of Yersinia ruckeri at fish farms in northern and central Finland. J. Fish Dis. 1992, 15, 163–171. [Google Scholar] [CrossRef]
- Mendez, J.; Guijarro, J.A. In vivo monitoring of Yersinia ruckeri in fish tissues: Progression and virulence gene expression. Environ. Microbiol. Rep. 2013, 5, 179–185. [Google Scholar] [CrossRef] [PubMed]
- Ingerslev, M.C.; Strube, M.L.; Jørgensen, L.V.G.; Dalsgaard, I.; Boye, M.; Madsen, L. Diet type dictates the gut microbiota and the immune response against Yersinia ruckeri in rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2014, 40, 624–633. [Google Scholar] [CrossRef] [PubMed]
- Khimmakthong, U.; Deshmukh, S.; Chettri, J.K.; Bojesen, A.M.; Kania, P.W.; Dalsgaard, I.; Buchmann, K. Tissue specific uptake of inactivated and live Yersinia ruckeri in rainbow trout (Oncorhynchus mykiss): Visualization by immunohistochemistry and in situ hybridization. Microb. Pathog. 2013, 59–60, 33–41. [Google Scholar] [CrossRef] [PubMed]
- Koppang, E.O.; Kvellestad, A.; Fischer, U. Fish Mucosal Immunity: Gill. In Mucosal Health in Aquaculture; Beck, B.H., Peatman, E., Eds.; Academic Press: Massachusetts, MA, USA, 2015; pp. 93–133. [Google Scholar]
- Ellis, A.E. Immunity to bacteria in fish. Fish Shellfish Immunol. 1999, 9, 291–308. [Google Scholar] [CrossRef]
- Jaafar, R.M.; Kania, P.W.; Larsen, A.H.; Nielsen, D.S.; Fouz, B.; Browdy, C.; Buchmann, K. Gut microbiota changes in rainbow trout, Oncorhynchus mykiss (Walbaum), during organic acid feed supplementation and Yersinia ruckeri infection. J. Fish Dis. 2013, 36, 599–606. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stevenson, R.M.W. Immunization with Bacterial Antigens: Yersiniosis. In Fish Vaccinology. Developments in Biological Standardization; Gudding, R., Lillehaug, A., Midtlyng, P.J., Brown., F., Eds.; Karger: Basel, Switzerland, 1997; Volume 90, pp. 117–124. [Google Scholar]
- Sönmez, A.Y.; Bilen, S.; Alak, G.; Hisar, O.; Yanık, T.; Biswas, G. Growth performance and antioxidant enzyme activities in rainbow trout (Oncorhynchus mykiss) juveniles fed diets supplemented with sage, mint and thyme oils. Fish Physiol. Biochem. 2015, 41, 165–175. [Google Scholar] [CrossRef] [PubMed]
- Ates, B.; Orun, I.; Talas, Z.S.; Durmaz, G.; Yilmaz, I. Effects of sodium selenite on some biochemical and hematological parameters of rainbow trout (Oncorhynchus mykiss Walbaum, 1792) exposed to Pb2+ and Cu2+. Fish Physiol. Biochem. 2008, 34, 53–59. [Google Scholar] [CrossRef] [PubMed]
- Mittal, M.; Siddiqui, M.R.; Tran, K.; Reddy, S.P.; Malik, A.B. Reactive oxygen species in inflammation and tissue injury. Antioxid. Redox Signal. 2014, 20, 1126–1167. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, T.; Wei, W.Y.; Wang, K.Y.; Wang, E.L.; Yang, Q. A Yersinia ruckeri TIR domain-containing protein (STIR-2) mediates immune evasion by targeting the MyD88 adaptor. Int. J. Mol. Sci. 2019, 20, 4409. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Press, C.M.; Evensen, O. The morphology of the immune system in teleost fishes. Fish Shellfish Immunol. 1999, 9, 309–318. [Google Scholar] [CrossRef] [Green Version]
- Tsujita, T.; Tsukada, H.; Nakao, M.; Oshiumi, H.; Matsumoto, M.; Seya, T. Sensing bacterial flagellin by membrane and soluble orthologs of Toll-like receptor 5 in rainbow trout (Oncorhynchus mykiss). J. Biol. Chem. 2004, 279, 48588–48597. [Google Scholar] [CrossRef] [Green Version]
- Fink, I.R.; Pietretti, D.; Voogdt, C.G.P.; Westphal, A.H.; Savelkoul, H.F.J.; Forlenza, M.; Wiegertjes, G.F. Molecular and functional characterization of Toll-like receptor (Tlr)1 and Tlr2 in common carp (Cyprinus carpio). Fish Shellfish Immunol. 2016, 56, 70–83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brietzke, A.; Arnemo, M.; Gjoen, T.; Rebl, H.; Korytar, T.; Goldammer, T.; Rebl, A.; Seyfert, H.M. Structurally diverse genes encode Tlr2 in rainbow trout: The conserved receptor cannot be stimulated by classical ligands to activate NF-kB in vitro. Dev. Comp. Immunol. 2016, 54, 75–88. [Google Scholar] [CrossRef] [PubMed]
- Takeda, K.; Kaisho, T.; Akira, S. Toll-like receptors. Annu. Rev. Immunol. 2003, 21, 335–376. [Google Scholar] [CrossRef] [PubMed]
- Hong, S.H.; Peddie, S.; Campos-Perez, J.J.; Zou, J.; Secombes, C.J. The effect of intraperitoneally administered recombinant IL-1 beta on immune parameters and resistance to Aeromonas salmonicida in the rainbow trout (Oncorhynchus mykiss). Dev. Comp. Immunol. 2003, 27, 801–812. [Google Scholar] [CrossRef]
- Martin, S.; Zou, J.; Houlihan, D.; Secombes, C. Directional responses following recombinant cytokine stimulation of rainbow trout (Oncorhynchus mykiss) RTS-11 macrophage cells as revealed by transcriptome profiling. BMC Genom. 2007, 8, 150. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, H.; Tuzun, E.; Alagappan, D.; Yu, X.; Scott, B.G.; Ischenko, A.; Christadoss, P. IL-1 receptor antagonist-mediated therapeutic effect in murine myasthenia gravis is associated with suppressed serum proinflammatory cytokines, C3, and antiacetylcholine receptor IgG1. J. Immunol. 2005, 175, 2018–2025. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gonzalez, S.F.; Huising, M.O.; Stakauskas, R.; Forlenza, M.; Verburg-van Kemenade, B.M.L.; Buchmann, K.; Nielsen, M.E.; Wiegertjes, G.F. Real-time gene expression analysis in carp (Cyprinus carpio L.) skin: Inflammatory responses to injury mimicking infection with ectoparasites. Dev. Comp. Immunol. 2007, 31, 244–254. [Google Scholar] [CrossRef] [PubMed]
- Tafalla, C.; Coll, J.; Secombes, C.J. Expression of genes related to the early immune response in rainbow trout (Oncorhynchus mykiss) after viral haemorrhagic septicemia virus (VHSV) infection. Dev. Comp. Immunol. 2005, 29, 615–626. [Google Scholar] [CrossRef] [PubMed]
- Raida, M.K.; Buchmann, K. Temperature-dependent expression of immunerelevant genes in rainbow trout following Yersinia ruckeri vaccination. Dis. Aqua Org. 2007, 77, 41–52. [Google Scholar] [CrossRef] [PubMed]
- Zou, J.; Peddie, S.; Scapigliati, G.; Zhang, Y.; Bols, N.C.; Ellis, A.E.; Secombes, C.J. Functional characterisation of the recombinant tumor necrosis factors in rainbow trout, Oncorhynchus mykiss. Dev. Comp. Immunol. 2003, 27, 813–822. [Google Scholar] [CrossRef]
- Laing, K.J.; Wang, T.H.; Zou, J.; Holland, J.; Hong, S.H.; Bols, N.; Hirono, I.; Aoki, T.; Secombes, C.J. Cloning and expression analysis of rainbow trout Oncorhynchus mykiss tumor necrosis factor-alpha. Eur. J. Biochem. 2001, 268, 1315–1322. [Google Scholar] [CrossRef] [PubMed]
- Zou, J.; Wang, T.; Hirono, I.; Aoki, T.; Inagawa, H.; Honda, T.; Soma, G.I.; Ototake, M.; Nakanishi, T.; Ellis, A.E.; et al. Differential expression of two tumor necrosis factor genes in rainbow trout, Oncorhynchus mykiss. Dev. Comp. Immunol. 2002, 26, 161–172. [Google Scholar] [CrossRef]
- Ammit, A.J.; Lazaar, A.L.; Irani, C.; O’Neill, G.M.; Gordon, N.D.; Amrani, Y.; Penn, R.B.; Panettieri, R.A. Tumor necrosis factor-alpha-induced secretion of RANTES and interleukin-6 from human airway smooth muscle cells–modulation by glucocorticoids and beta agonists. Am. J. Respir. Cell Mol. Biol. 2002, 26, 465–474. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Thorgaard, G.H.; Ristow, S.S. Molecular cloning and genomic structure of an interleukin-8 receptor-like gene from homozygous clones of rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2002, 13, 251–258. [Google Scholar] [CrossRef] [PubMed]
- Jimenez, N.; Coll, J.; Salguero, F.J.; Tafalla, C. Co-injection of interleukin 8 with the glycoprotein gene from viral haemorrhagic septicemia virus (VHSV) modulates the cytokine response in rainbow trout (Oncorhynchus mykiss). Vaccine 2006, 24, 5615–5626. [Google Scholar] [CrossRef] [PubMed]
- Wiens, G.D.; Glenney, G.W.; Lapatra, S.E.; Welch, T.J. Identification of novel rainbow trout (Oncorhynchus mykiss) chemokines, CXCd1 and CXCd2: mRNA expression after Yersinia ruckeri vaccination and challenge. Immunogenetics 2006, 58, 308–323. [Google Scholar] [CrossRef] [PubMed]
- Inoue, Y.; Kamota, S.; Itoa, K.; Yoshiura, Y.; Ototake, M.; Moritomo, T.; Nakanishi, T. Molecular cloning and expression analysis of rainbow trout (Oncorhynchus mykiss) interleukin-10 cDNAs. Fish Shellfish Immunol. 2005, 18, 335–344. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Secombes, C.J. Rainbow trout suppressor of cytokine signalling (SOCS)-1, 2 and 3: Molecular identification, expression and modulation. Mol. Immunol. 2008, 45, 1449–1457. [Google Scholar] [CrossRef] [PubMed]
- Wiegertjes, G.F.; Wentzel, A.S.; Spaink, H.P.; Elks, P.M.; Fink, I.R. Polarization of immune responses in fish: The ′macrophages first’ point of view. Mol. Immunol. 2016, 69, 146–156. [Google Scholar] [CrossRef] [PubMed]
- Marro, J.; Pfefferli, C.; de Preux, C.A.S.; Bise, T.; Jaźwińska, A. Collagen XII contributes to epicardial and connective tissues in the zebrafish heart during ontogenesis and regeneration. PLoS ONE 2016, 11, e0165497. [Google Scholar] [CrossRef] [Green Version]
- Johnston, E.F.; Gillis, T.E. Transforming growth factor beta-1 (TGF-beta1) stimulates collagen synthesis in cultured rainbow trout cardiac fibroblasts. J. Exp. Biol. 2017, 220, 2645–2653. [Google Scholar] [PubMed] [Green Version]
- Johnston, E.F.; Gillis, T.E. Transforming growth factor-β1 induces differentiation of rainbow trout (Oncorhynchus mykiss) cardiac fibroblasts into myofibroblasts. J. Exp. Biol. 2018, 221, jeb189167. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- D’Amico, G.; Frascaroli, G.; Bianchi, G.; Transidico, P.; Doni, A.; Vecchi, A.; Sozzani, S.; Allavena, P.; Mantovani, A. Uncoupling of inflammatory chemokine receptors by IL-10: Generation of functional decoys. Nat. Immunol. 2000, 1, 387–391. [Google Scholar] [CrossRef] [PubMed]
- Dumoutier, L.; Louahed, J.; Renauld, J.C. Cloning and characterization of IL-10-related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 and inducible by IL-9. J. Immunol. 2000, 164, 1814–1819. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chadzinska, M.; Baginski, P.; Kolaczkowska, E.; Savelkoul, H.F.J.; Verburg-van Kemenade, B.M. Expression profiles of matrix metalloproteinase 9 in teleost fish provide evidence for its active role in initiation and resolution of inflammation. Immunology 2008, 125, 601–610. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, T.; Kim, H.; Liu, X.; Sugiura, H.; Kohyama, T.; Fang, Q.; Wen, F.Q.; Abe, S.; Wang, X.; Atkinson, J.J.; et al. Matrix metalloproteinase-9 activates TGF-β and stimulates fibroblast contraction of collagen gels. Am. J. Physiol. Lung Cell. Mol. Physiol. 2014, 306, L1006–L1015. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ritonja, A.; Kopitar, M.; Jerala, R.; Turk, V. Primary structure of a new cysteine proteinase inhibitor from pig leucocytes. FEBS Lett. 1989, 255, 211–214. [Google Scholar] [CrossRef] [Green Version]
- Chang, C.I.; Zhang, Y.A.; Zou, J.; Nie, P.; Secombes, C.J. Two cathelicidin genes are present in both rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar). Antimicrob. Agents Chemother. 2006, 50, 185–195. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chang, C.I.; Pleguezuelos, O.; Zhang, Y.A.; Zou, J.; Secombes, C.J. Identification of a novel cathelicidin gene in rainbow trout Oncorhynchus mykiss. Infect. Immun. 2005, 73, 5053–5064. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bayne, C.J.; Gerwick, L.; Fujiki, K.; Nakao, M.; Yano, T. Immune-relevant (including acute phase) genes identified in the livers of rainbow trout, Oncorhynchus mykiss, by suppression subtractive hybridization. Dev. Comp. Immunol. 2001, 25, 205–217. [Google Scholar] [CrossRef]
- Jorgensen, J.B.; Lunde, H.; Jensen, L.; Whitehead, A.S.; Robertsen, B. Serum amyloid A transcription in Atlantic salmon (Salmo salar L.) hepatocytes is enhanced by stimulation with macrophage factors, recombinant human IL-1 beta, IL-6 and TNF alpha or bacterial lipopolysaccharide. Dev. Comp. Immunol. 2000, 24, 553–563. [Google Scholar] [CrossRef]
- Hartl, F.U. Molecular chaperones in cellular protein folding. Nature 1996, 381, 571–580. [Google Scholar] [CrossRef] [PubMed]
- Gerwick, L.; Reynolds, W.S.; Bayne, C.J. A precerebellin-like protein is part of the acute phase response in rainbow trout, Oncorhynchus mykiss. Dev. Comp. Immunol. 2000, 24, 597–607. [Google Scholar] [CrossRef]
- Raida, M.K.; Buchmann, K. Innate immune response in rainbow trout (Oncorhynchus mykiss) against primary and secondary infections with Yersinia ruckeri O1. Dev. Comp. Immunol. 2009, 33, 35–45. [Google Scholar] [CrossRef] [PubMed]
- Pang, Z.; Zuo, J.; Morgan, J.I. Cbln3, a novel member of the precerebellin family that binds specifically to Cbln1. J. Neurosci. 2000, 20, 6333–6339. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gerwick, L.; Corley-Smith, G.E.; Nakao, M.; Watson, J.; Bayne, C.J. Intracranial injections induce local transcription of a gene encoding precerebellin-like protein. Fish Physiol. Biochem. 2005, 31, 363–372. [Google Scholar] [CrossRef]
- Romalde, J.L.; Conchas, R.F.; Toranzo, A.E. Evidence that Yersinia ruckeri possesses a high affinity iron uptake system. FEMS Microbiol. Lett. 1991, 80, 121–125. [Google Scholar] [CrossRef]
- Fernandez, L.; Marquez, I.; Guijarro, J.A. Identification of specific in vivo-induced (ivi) genes in Yersinia ruckeri and analysis of ruckerbactin, a catecholate siderophore iron acquisition system. Appl. Environ. Microbiol. 2004, 70, 5199–5207. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Janeway, C.A.; Travers, P.; Walport, M.; Shlomchik, M.J. Immunobiology: The Immune System in Health and Disease, 6th ed.; Garland Science Publishing: New York, NY, USA, 2005. [Google Scholar]
- Kaplow, L.S. Simplified myeloperoxidase stain using benzidine dihychloride. Blood 1965, 26, 215–219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Afonso, A.; Lousada, S.; Silva, J.; Ellis, A.E.; Silva, M.T. Neutrophil and macrophage responses to inflammation in the peritoneal cavity of rainbow trout Oncorhynchus mykiss: A light and electron microscopic cytochemical study. Dis. Aquat. Organ. 1998, 34, 27–37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Quade, M.J.; Roth, J.A. A Rapid, direct assay to measure degranulation of bovine neutrophil primary granules. Vet. Immunol. Immunop. 1997, 58, 239–248. [Google Scholar] [CrossRef]
- Ellis, A.E. Serum Antiproteases in Fish. In Techniques in Fish Immunology, 1st ed.; Stolen, J.S., Fletcher, T.C., Anderson, D.P., Roberson, B.S., van Muiswinkel, W.B., Eds.; SOS Publications: FairHaven, MA, USA, 1990; pp. 95–99. [Google Scholar]
- Machado, M.; Azeredo, R.; Díaz-Rosales, P.; Afonso, A.; Peres, H.; Oliva-Teles, A.; Costas, B. Dietary tryptophan and methionine as modulators of European seabass (Dicentrarchus labrax) immune status and inflammatory response. Fish Shellfish Immunol. 2015, 42, 253–362. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Costas, B.; Conceição, L.E.; Dias, J.; Novoa, B.; Figueras, A.; Afonso, A. Dietary arginine and repeated handling increase disease resistance and modulate innate immune mechanisms of Senegalese sole (Solea senegalensis Kaup, 1858). Fish Shellfish Immunol. 2011, 31, 838–847. [Google Scholar] [CrossRef] [PubMed]
- Peixoto, D.; Pinto, W.; Gonçalves, A.T.; Machado, M.; Reis, B.; Silva, J.; Navalho, J.; Dias, J.; Conceição, L.; Costas, B. Microalgal biomasses have potential as ingredients in microdiets for Senegalese sole (Solea senegalensis) post-larvae. J. Appl. Phycol. 2021, 33, 2241–2250. [Google Scholar] [CrossRef]
- Costas, B.; Couto, A.; Azeredo, R.; Machado, M.; Krogdahl, Å.; Oliva-teles, A. Gilthead seabream (Sparus aurata) immune responses are modulated after feeding with purified antinutrients. Fish Shellfish Immunol. 2014, 41, 70–79. [Google Scholar] [CrossRef] [PubMed]
- Bird, R.P.; Draper, A.H. Comparative studies on different methods of malonaldehyde determination. Method. Enzymol. 1984, 105, 299–305. [Google Scholar]
- Clairborne, A. Catalase Activity. In Handbook of Methods of Oxygen Radical Research; Greenwald, R.A., Ed.; CRC Press: Boca Raton, FL, USA, 1985; pp. 283–284. [Google Scholar]
- Almeida, J.R.; Oliveira, C.; Gravato, C.; Guilhermino, L. Linking behavioural alterations with biomarkers responses in the European seabass Dicentrarchus labrax L. exposed to the organophosphate pesticide fenitrothion. Ecotoxicology 2010, 19, 1369–1381. [Google Scholar]
- Habig, W.H.; Pabst, M.J.; Jakoby, W.B. Glutathione-S-transferases, the first enzymatic step in mercapturic acid formation. J. Biol. Chem. 1974, 249, 7130–7139. [Google Scholar] [CrossRef]
- Frasco, M.F.; Guilhermino, L. Effects of dimethoate and beta-naphthoflavone on selected biomarkers of Poecilia reticulate. Fish Physiol. Biochem. 2002, 26, 149–156. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Babicki, S.; Arndt, D.; Marcu, A.; Liang, Y.; Grant, J.R.; Maciejewski, A.; Wishart, D.S. Heatmapper: Web-enabled heat mapping for all. Nucleic Acids Res. 2016, 44, W147–W153. [Google Scholar] [CrossRef] [PubMed]
Gene | Acronym | Efficiency (%) | Annealing Temperature (°C) | Amplicon Length (bp) | Acession nº | Primer Sequence (5’-3’) |
---|---|---|---|---|---|---|
Interleukin 1 Beta | il-1β | 102.52 | 58 | 62 | AJ278242.2 | F: CGTCACTGACTCTGAGAACAAGT R: TGGCGTGCAGCTCCATAG |
Interleukin 10 | il-10 | 100.36 | 58 | 119 | NM_001245099.1 | F: GGATTCTACACCACTTGAAGAGCC R: GTCGTTGTTGTTCTGTGTTCTGTTGT |
Toll-Like Receptor 2 | tlr-2 | 110.42 | 58 | 129 | XM_036958363.1 | F: GATCCAGAGCAACACTCTCAACAT R: CTCCAGACCATGAAGTTGACAAAC |
Heat Shock Protein 70 | hsp-70 | 83.74 | 60 | 135 | AB062281.1 | F: CTGCTGCTGCTGGATGTG R: GCTGGTTGTCGGAGTAAGTG |
Suppressor of Cytokine Signaling 3 | socs-3 | 121.62 | 58 | 228 | AM74872Z3 | F:CACAGAGAAACCGTTAAAAGGACTATCC R: AAGGGGCTGCTGCTCATGAC |
Ferritin | fer | 91.94 | 58 | 213 | NM_001160521.1 | F: ACTGGGTGACCAACCTCCG R: GGGCTACTGGCTTATAGGAACG |
Tumor Necrosis Factor Alpha 1 | tnf-α1 | 106.25 | 58 | 208 | NM_001124374.1 | F: CAAGAGTTTGAACCTCATTCAG R: GCTGCTGCCGCACATAAAG |
T-Cell Surface Glycoprotein CD8 Alpha Precursor | cd8 | 105.22 | 58 | 202 | AF178054.1 | F: CGACGACTACACCAATGACC R: TGTGGGCATCTTTTTGTTCTT |
Matrix Metalloproteinase 9 | mmp-9 | 98.27 | 58 | 212 | NM_001124370.1 | F: CATGGTGTCATTTGGAAAAGC R: CGAAGGAAAAAGGGAAGTGG |
Transforming Growth Factor Beta 1-Like | tgf-β1 | 96.92 | 58 | 229 | XM_021591332.1 | F: AGCTCTCGGAAGAAACGACA R: CGGGGTTGTGGTGCTTATAC |
Interleukin 8 | il-8 | 94.14 | 58 | 120 | XM_021625343.1 | F: AGAGACACTGAGATCATTGCCAC R: CCCTCTTCATTTGTTGTTGGC |
Serum Amyloid A | saa | 111.73 | 58 | 157 | XM_036980911.1 | F: GACGCCAACTGGAAAAACTC R: CTGCTGAGTCCTCGTGTCCT |
Precerebellin | pcb | 91.60 | 58 | 111 | XM_021611216.2 | F: GAAACTGCCAACCCAAAATC R: CATGCTACTGCCACTCCAGA |
Cathelicidin Isoform X1 | cath | 87.54 | 58 | 159 | XM_036984508.1 | F: CAAGAAGAGGCAAGGACAGC R: TGTTCGATGCAGGGAGAGTT |
Tumor Necrosis Factor Alpha 2 | tnf-α2 | 100.71 | 58 | 140 | NM_001124374.1 | F: AGAGGGGCCTTGAAAATAGCC R: TGCCGCACATAAAGCTGCTA |
Elongation Factor-1 Alpha | ef-1α | 86.32 | 55 | 159 | NM_001124339.1 | F: GGCAAGTCAACCACCACAG R: GATACCACGCTCCCTCTCAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fajardo, C.; Santos, P.; Passos, R.; Vaz, M.; Azeredo, R.; Machado, M.; Fernández-Boo, S.; Baptista, T.; Costas, B. Functional and Molecular Immune Response of Rainbow Trout (Oncorhynchus mykiss) Following Challenge with Yersinia ruckeri. Int. J. Mol. Sci. 2022, 23, 3096. https://doi.org/10.3390/ijms23063096
Fajardo C, Santos P, Passos R, Vaz M, Azeredo R, Machado M, Fernández-Boo S, Baptista T, Costas B. Functional and Molecular Immune Response of Rainbow Trout (Oncorhynchus mykiss) Following Challenge with Yersinia ruckeri. International Journal of Molecular Sciences. 2022; 23(6):3096. https://doi.org/10.3390/ijms23063096
Chicago/Turabian StyleFajardo, Carlos, Paulo Santos, Ricardo Passos, Mariana Vaz, Rita Azeredo, Marina Machado, Sergio Fernández-Boo, Teresa Baptista, and Benjamin Costas. 2022. "Functional and Molecular Immune Response of Rainbow Trout (Oncorhynchus mykiss) Following Challenge with Yersinia ruckeri" International Journal of Molecular Sciences 23, no. 6: 3096. https://doi.org/10.3390/ijms23063096