Transportin-3 Facilitates Uncoating of Influenza A Virus
Abstract
:1. Introduction
2. Results
2.1. TNPO3 Is Involved in the IAV Replication
2.2. TNPO3 Is Not Required for the IAV Attachment and the Expression of Sialic Acid Receptors
2.3. TNPO3 Is Not Required for the Endocytosis and Acidification
2.4. TNPO3 Plays a Crucial Role in the Uncoating Step of Influenza Virus Entry
2.5. Knockout of TNPO3 Inhibits the Nuclear Import of IAV
2.6. TNPO3 Interacts and Colocalizes with Influenza Virus M1 and M2 Proteins
3. Discussion
4. Materials and Methods
4.1. Cell and Virus
4.2. Antibodies and Reagents
4.3. Plasmids
4.4. Generation of the TNPO3 NPTr-Cas9 Knockout Cells
4.5. Virus Infection and Virus Titration
4.6. Sanger Sequencing
4.7. Cell Viability Assay
4.8. Indirect Immunofluorescence Assay
4.9. Lectin and HA Binding Assay
4.10. Endocytosis Assay
4.11. Acidification Assay
4.12. Uncoating Assay
4.13. Nuclear Import Assay
4.14. Co-IP and Western Blot Assay
4.15. Nuclear and Cytoplasmic Fractionation
4.16. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Long, J.S.; Mistry, B.; Haslam, S.M.; Barclay, W.S. Host and viral determinants of influenza A virus species specificity. Nat. Rev. Microbiol. 2019, 17, 67–81. [Google Scholar] [CrossRef] [PubMed]
- Petrova, V.N.; Russell, C.A. The evolution of seasonal influenza viruses. Nat. Rev. Microbiol. 2018, 16, 60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rogers, G.N.; Paulson, J.C. Receptor determinants of human and animal influenza-virus isolates-differences in receptor specificity of the hemagglutinin-H-3 based on species of origin. Virology 1983, 127, 361–373. [Google Scholar] [CrossRef]
- Simonsen, L.; Spreeuwenberg, P.; Lustig, R.; Taylor, R.J.; Fleming, D.M.; Kroneman, M.; Van Kerkhove, M.D.; Mounts, A.W.; Paget, W.J.; G. LaMOR Collaborating Teams. Global mortality estimates for the 2009 Influenza Pandemic from the GLaMOR project: A modeling study. PLoS Med. 2013, 10, e1001558. [Google Scholar] [CrossRef] [Green Version]
- Bright, R.A.; Shay, D.K.; Shu, B.; Cox, N.J.; Klimov, A.I. Adamantane resistance among influenza A viruses isolated early during the 2005–2006 influenza season in the United States. JAMA-J. Am. Med. Assoc. 2006, 295, 891–894. [Google Scholar] [CrossRef] [Green Version]
- Nicoll, A.; Ciancio, B.; Kramarz, P. Influenza Project, Team. Observed oseltamivir resistance in seasonal influenza viruses in Europe interpretation and potential implications. Euro Surveill. 2008, 13, pii=8025. [Google Scholar] [CrossRef]
- Warfield, K.L.; Schaaf, K.R.; DeWald, L.E.; Spurgers, K.B.; Wang, W.; Stavale, E.; Mendenhall, M.; Shilts, M.H.; Stockwell, T.B.; Barnard, D.L.; et al. Lack of selective resistance of influenza A virus in presence of host-targeted antiviral, UV-4B. Sci Rep. 2019, 9, 7484. [Google Scholar] [CrossRef]
- Hao, L.; Sakurai, A.; Watanabe, T.; Sorensen, E.; Nidom, C.A.; Newton, M.A.; Ahlquist, P.; Kawaoka, Y. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature 2008, 454, 890–893. [Google Scholar] [CrossRef] [Green Version]
- Karlas, A.; Machuy, N.; Shin, Y.; Pleissner, K.P.; Artarini, A.; Heuer, D.; Becker, D.; Khalil, H.; Ogilvie, L.A.; Hess, S.; et al. Genome-wide RNAi screen identifies human host factors crucial for influenza virus replication. Nature 2010, 463, U132–U818. [Google Scholar] [CrossRef]
- Konig, R.; Stertz, S.; Zhou, Y.; Inoue, A.; Hoffmann, H.H.; Bhattacharyya, S.; Alamares, J.G.; Tscherne, D.M.; Ortigoza, M.B.; Liang, Y.H.; et al. Human host factors required for influenza virus replication. Nature 2010, 463, 813–817. [Google Scholar] [CrossRef]
- Li, B.; Clohisey, S.M.; Chia, B.S.; Wang, B.; Cui, A.; Eisenhaure, T.; Schweitzer, L.D.; Hoover, P.; Parkinson, N.J.; Nachshon, A.; et al. Genome-wide CRISPR screen identifies host dependency factors for influenza A virus infection. Nat. Commun. 2020, 11, 164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Song, Y.M.; Huang, H.X.; Hu, Y.Z.; Zhang, J.W.; Li, F.; Yin, X.; Shi, J.Z.; Li, Y.B.; Li, C.J.; Zhao, D.M.; et al. A genome-wide CRISPR/Cas9 gene knockout screen identifies immunoglobulin superfamily DCC subclass member 4 as a key host factor that promotes influenza virus endocytosis. PLoS Pathog. 2021, 17, e1010141. [Google Scholar] [CrossRef] [PubMed]
- Su, W.C.; Chen, Y.C.; Tseng, C.H.; Hsu, P.W.; Tung, K.F.; Jeng, K.S.; Lai, M.M. Pooled RNAi screen identifies ubiquitin ligase Itch as crucial for influenza A virus release from the endosome during virus entry. Proc. Natl. Acad. Sci. USA 2013, 110, 17516–17521. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Banerjee, I.; Yamauchi, Y.; Helenius, A.; Horvath, P. High-content analysis of sequential events during the early phase of influenza A virus infection. PLoS ONE 2013, 8, e68450. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dou, D.; Revol, R.; Ostbye, H.; Wang, H.; Daniels, R. Influenza A virus cell entry, replication, virion assembly and movement. Front. Immunol. 2018, 9, 1581. [Google Scholar] [CrossRef]
- Luo, M. Influenza virus entry. Adv. Exp. Med. Biol. 2012, 726, 201–221. [Google Scholar]
- Matlin, K.S.; Reggio, H.; Helenius, A.; Simons, K. Infectious entry pathway of influenza virus in a canine kidney cell line. J. Cell Biol. 1981, 91 Pt 1, 601–613. [Google Scholar] [CrossRef] [Green Version]
- Wang, G.; Jiang, L.; Wang, J.; Zhang, J.; Kong, F.; Li, Q.; Yan, Y.; Huang, S.; Zhao, Y.; Liang, L.; et al. The G protein-coupled receptor FFAR2 promotes internalization during influenza A virus entry. J. Virol. 2020, 94, e01707-19. [Google Scholar] [CrossRef] [Green Version]
- Skehel, J.J.; Bayley, P.M.; Brown, E.B.; Martin, S.R.; Waterfield, M.D.; White, J.M.; Wilson, I.A.; Wiley, D.C. Changes in the conformation of influenza-virus hemagglutinin at the Ph optimum of virus-mediated membrane-fusion. Proc. Natl. Acad. Sci. USA-Biol. Sci. 1982, 79, 968–972. [Google Scholar] [CrossRef] [Green Version]
- Edinger, T.O.; Pohl, M.O.; Yanguez, E.; Stertz, S. Cathepsin W is required for escape of influenza A virus from late endosomes. mBio 2015, 6, e00297. [Google Scholar] [CrossRef] [Green Version]
- Rafalski, M.; Ortiz, A.; Rockwell, A.; van Ginkel, L.C.; Lear, J.D.; DeGrado, W.F.; Wilschut, J. Membrane fusion activity of the influenza virus hemagglutinin: Interaction of HA2 N-terminal peptides with phospholipid vesicles. Biochemistry 1991, 30, 10211–10220. [Google Scholar] [CrossRef]
- Bui, M.; Whittaker, G.; Helenius, A. Effect of M1 protein and low pH on nuclear transport of influenza virus ribonucleoproteins. J. Virol. 1996, 70, 8391–8401. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miyake, Y.; Keusch, J.J.; Decamps, L.; Ho-Xuan, H.; Iketani, S.; Gut, H.; Kutay, U.; Helenius, A.; Yamauchi, Y. Influenza virus uses transportin 1 for vRNP debundling during cell entry. Nat. Microbiol. 2019, 4, 578–586. [Google Scholar] [CrossRef] [PubMed]
- Alber, F.; Dokudovskaya, S.; Veenhoff, L.M.; Zhang, W.; Kipper, J.; Devos, D.; Suprapto, A.; Karni-Schmidt, O.; Williams, R.; Chait, B.T.; et al. The molecular architecture of the nuclear pore complex. Nature 2007, 450, 695–701. [Google Scholar] [CrossRef] [PubMed]
- Christ, F.; Thys, W.; De Rijck, J.; Gijsbers, R.; Albanese, A.; Arosio, D.; Emiliani, S.; Rain, J.C.; Benarous, R.; Cereseto, A.; et al. Transportin-SR2 imports HIV into the nucleus. Curr. Biol. 2008, 18, 1192–1202. [Google Scholar] [CrossRef] [Green Version]
- Jang, S.; Cook, N.J.; Pye, V.E.; Bedwell, G.J.; Dudek, A.M.; Singh, P.K.; Cherepanov, P.; Engelman, A.N. Differential role for phosphorylation in alternative polyadenylation function versus nuclear import of SR-like protein CPSF6. Nucleic Acids Res. 2019, 47, 4663–4683. [Google Scholar] [CrossRef] [Green Version]
- Kataoka, N.; Bachorik, J.L.; Dreyfuss, G. Transportin-SR, a nuclear import receptor for SR proteins. J. Cell Biol. 1999, 145, 1145–1152. [Google Scholar] [CrossRef] [Green Version]
- Maertens, G.N.; Cook, N.J.; Wang, W.; Hare, S.; Gupta, S.S.; Oztop, I.; Lee, K.; Pye, V.E.; Cosnefroy, O.; Snijders, A.P.; et al. Structural basis for nuclear import of splicing factors by human Transportin 3. Proc. Natl. Acad. Sci. USA 2014, 111, 2728–2733. [Google Scholar] [CrossRef] [Green Version]
- Pollard, V.W.; Michael, W.M.; Nakielny, S.; Siomi, M.C.; Wang, F.; Dreyfuss, G. A novel receptor-mediated nuclear protein import pathway. Cell 1996, 86, 985–994. [Google Scholar] [CrossRef] [Green Version]
- Strom, A.C.; Weis, K. Importin-beta-like nuclear transport receptors. Genome Biol. 2001, 2, 3008. [Google Scholar] [CrossRef] [Green Version]
- Bochnakian, A.; Zhen, A.; Zisoulis, D.G.; Idica, A.; KewalRamani, V.N.; Neel, N.; Daugaard, I.; Hamdorf, M.; Kitchen, S.; Lee, K.; et al. Interferon-inducible MicroRNA miR-128 modulates HIV-1 replication by targeting TNPO3 mRNA. J. Virol. 2019, 93, e00364-19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Iaco, A.; Luban, J. Inhibition of HIV-1 infection by TNPO3 depletion is determined by capsid and detectable after viral cDNA enters the nucleus. Retrovirology 2011, 8, 98. [Google Scholar] [CrossRef] [Green Version]
- Zhou, L.; Sokolskaja, E.; Jolly, C.; James, W.; Cowley, S.A.; Fassati, A. Transportin 3 promotes a nuclear maturation step required for efficient HIV-1 integration. PLoS Pathog. 2011, 7, e1002194. [Google Scholar] [CrossRef] [PubMed]
- Ali, M.K.; Kim, J.; Hamid, F.B.; Shin, C.G. Knockdown of the host cellular protein transportin 3 attenuates prototype foamy virus infection. Biosci. Biotechnol. Biochem. 2015, 79, 943–951. [Google Scholar] [CrossRef] [Green Version]
- Hamid, F.B.; Kim, J.; Shin, C.G. Characterization of prototype foamy virus infectivity in transportin 3 knockdown human 293t cell line. J. Microbiol. Biotechnol. 2017, 27, 380–387. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.X.; Zou, J.H.; Gao, Q.X.; Xie, S.S.; Cao, J.Y.; Zhou, H.B. CMAS and ST3GAL4 Play an important role in the adsorption of influenza virus by affecting the synthesis of sialic acid receptors. Int. J. Mol. Sci. 2021, 22, 6081. [Google Scholar] [CrossRef] [PubMed]
- Qin, C.; Li, W.; Li, Q.; Yin, W.; Zhang, X.W.; Zhang, Z.P.; Zhang, X.E.; Cui, Z.Q. Real-time dissection of dynamic uncoating of individual influenza viruses. Proc. Natl. Acad. Sci. USA 2019, 116, 2577–2582. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, B.J.; Cansizoglu, A.E.; Suel, K.E.; Louis, T.H.; Zhang, Z.; Chook, Y.M. Rules for nuclear localization sequence recognition by karyopherin beta 2. Cell 2006, 126, 543–558. [Google Scholar] [CrossRef] [Green Version]
- Han, J.; Perez, J.T.; Chen, C.; Li, Y.; Benitez, A.; Kandasamy, M.; Lee, Y.; Andrade, J.; tenOever, B.; Manicassamy, B. Genome-wide CRISPR/Cas9 screen identifies host factors essential for influenza virus replication. Cell Rep. 2018, 23, 596–607. [Google Scholar] [CrossRef] [Green Version]
- Heaton, B.E.; Kennedy, E.M.; Dumm, R.E.; Harding, A.T.; Sacco, M.T.; Sachs, D.; Heaton, N.S. A CRISPR activation screen identifies a pan-avian influenza virus inhibitory host factor. Cell Rep. 2017, 20, 1503–1512. [Google Scholar] [CrossRef] [Green Version]
- Furuchi, T.; Aikawa, K.; Arai, H.; Inoue, K. Bafilomycin A1, a specific inhibitor of vacuolar-type H(+)-ATPase, blocks lysosomal cholesterol trafficking in macrophages. J. Biol. Chem. 1993, 268, 27345–27348. [Google Scholar] [CrossRef]
- Yoshimori, T.; Yamamoto, A.; Moriyama, Y.; Futai, M.; Tashiro, Y. Bafilomycin A1, a specific inhibitor of vacuolar-type H(+)-ATPase, inhibits acidification and protein degradation in lysosomes of cultured cells. J. Biol. Chem. 1991, 266, 17707–17712. [Google Scholar] [CrossRef]
- Hay, A.J.; Wolstenholme, A.J.; Skehel, J.J.; Smith, M.H. The molecular basis of the specific anti-influenza action of amantadine. EMBO J. 1985, 4, 3021–3024. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Takeuchi, K.; Pinto, L.H.; Lamb, R.A. Ion channel activity of influenza A virus M2 protein: Characterization of the amantadine block. J. Virol. 1993, 67, 5585–5594. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Banerjee, I.; Miyake, Y.; Nobs, S.P.; Schneider, C.; Horvath, P.; Kopf, M.; Matthias, P.; Helenius, A.; Yamauchi, Y. Influenza A virus uses the aggresome processing machinery for host cell entry. Science 2014, 346, 473–477. [Google Scholar] [CrossRef] [PubMed]
- Larson, G.P.; Tran, V.; Yu, S.; Cai, Y.; Higgins, C.A.; Smith, D.M.; Baker, S.F.; Radoshitzky, S.R.; Kuhn, J.H.; Mehle, A. EPS8 facilitates uncoating of influenza A virus. Cell Rep. 2019, 29, 2175–2183.e4. [Google Scholar] [CrossRef] [Green Version]
- Yanguez, E.; Hunziker, A.; Dobay, M.P.; Yildiz, S.; Schading, S.; Elshina, E.; Karakus, U.; Gehrig, P.; Grossmann, J.; Dijkman, R. Phosphoproteomic-based kinase profiling early in influenza virus infection identifies GRK2 as antiviral drug target. Nat. Commun. 2018, 9, 3679. [Google Scholar] [CrossRef] [Green Version]
- Xia, B.; Zhao, Z.T.; Wu, Y.Y.; Wang, Y.; Zhao, Y.; Wang, J. Circular RNA circTNPO3 regulates paclitaxel resistance of ovarian cancer cells by miR-1299/NEK2 signaling pathway. Mol. Therapy-Nucleic Acids 2020, 21, 780–791. [Google Scholar] [CrossRef]
- Yu, T.; Ran, L.Y.; Zhao, H.W.; Yin, P.; Li, W.; Lin, J.; Mao, H.; Cai, D.P.; Ma, Q.; Pan, X.J.; et al. Circular RNA circ-TNPO3 suppresses metastasis of GC by acting as a protein decoy for IGF2BP3 to regulate the expression of MYC and SNAIL. Mol. Therapy-Nucleic Acids 2021, 26, 649–664. [Google Scholar] [CrossRef]
- Price, A.J.; Fletcher, A.J.; Schaller, T.; Elliott, T.; Lee, K.; KewalRamani, V.N.; Chin, J.W.; Towers, G.J.; James, L.C. CPSF6 defines a conserved capsid interface that modulates HIV-1 Replication. PLoS Pathog. 2012, 8, 2896. [Google Scholar] [CrossRef] [Green Version]
- Fernandez, J.; Machado, A.K.; Lyonnais, S.; Chamontin, C.; Gartner, K.; Leger, T.; Henriquet, C.; Garcia, C.; Portilho, D.M.; Pugniere, M.; et al. Transportin-1 binds to the HIV-1 capsid via a nuclear localization signal and triggers uncoating. Nat. Microbiol. 2019, 4, 1840–1850. [Google Scholar] [CrossRef] [PubMed]
- Soniat, M.; Chook, Y.M. Karyopherin-beta 2 Recognition of a PY-NLS Variant that Lacks the Proline-Tyrosine Motif. Structure 2016, 24, 1802–1809. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Logue, E.C.; Taylor, K.T.; Goff, P.H.; Landau, N.R. The cargo-binding domain of transportin 3 is required for lentivirus nuclear import. J. Virol. 2011, 85, 12950–12961. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kalidasan, V.; Ng, W.H.; Ishola, O.A.; Ravichantar, N.; Tan, J.J.; Das, K.T.l. A guide in lentiviral vector production for hard-to-transfect cells, using cardiac-derived c-kit expressing cells as a model system. Sci. Rep. 2021, 11, 19265. [Google Scholar] [CrossRef]
- Miyanohara, A. Preparation of vesicular stomatitis virus-G (VSV-G) conjugate and its use in gene transfer. Cold Spring Harb. Protoc. 2012, 2012, 453–456. [Google Scholar] [CrossRef] [Green Version]
- Reed, L.J.; Muench, H. A simple method of estimating fifty per cent endpoint. Am. J. Hyg. 1938, 27, 493–497. [Google Scholar]
Primer Name | Sequence (5′ to 3′) |
---|---|
TNPO3-sgRNA-F TNPO3-sgRNA-R HA-M1-F HA-M1-R HA-M2-F HA-M2-R FLAG-TNPO3-F FLAG-TNPO3-R TNPO3-Genome-F TNPO3-Genome-R | CACCGTACCACGACCCAGATCCCAG AAACCTGGGATCTGGGTCGTGGTAC CGGAATTCATGAGTCTTCTAACCGAGGT CCGCTCGAGCTTGAATCGCTGTATCTGCACT CGGAATTCATGAGTCTTCTAACCGAGGT CCGCTCGAGCTCCAGCTCTATGTTGACAAAAT CCATCGATAATGAAAATGAAGATTCAGACCT CGCGGATCCTCGAAACAATCTGGTGAAGTCT AACTTCCACGGGGAACCCCT AAGCGGCGTAGATGAAGCTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zou, J.; Yu, L.; Zhu, Y.; Yang, S.; Zhao, J.; Zhao, Y.; Jiang, M.; Xie, S.; Liu, H.; Zhao, C.; et al. Transportin-3 Facilitates Uncoating of Influenza A Virus. Int. J. Mol. Sci. 2022, 23, 4128. https://doi.org/10.3390/ijms23084128
Zou J, Yu L, Zhu Y, Yang S, Zhao J, Zhao Y, Jiang M, Xie S, Liu H, Zhao C, et al. Transportin-3 Facilitates Uncoating of Influenza A Virus. International Journal of Molecular Sciences. 2022; 23(8):4128. https://doi.org/10.3390/ijms23084128
Chicago/Turabian StyleZou, Jiahui, Luyao Yu, Yinxing Zhu, Shuaike Yang, Jiachang Zhao, Yaxin Zhao, Meijun Jiang, Shengsong Xie, Hailong Liu, Changzhi Zhao, and et al. 2022. "Transportin-3 Facilitates Uncoating of Influenza A Virus" International Journal of Molecular Sciences 23, no. 8: 4128. https://doi.org/10.3390/ijms23084128
APA StyleZou, J., Yu, L., Zhu, Y., Yang, S., Zhao, J., Zhao, Y., Jiang, M., Xie, S., Liu, H., Zhao, C., & Zhou, H. (2022). Transportin-3 Facilitates Uncoating of Influenza A Virus. International Journal of Molecular Sciences, 23(8), 4128. https://doi.org/10.3390/ijms23084128