Relative Telomere Length Is Associated with the Risk of Development and Severity of the Course of Age-Related Macular Degeneration in the Russian Population
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Study Population
4.2. Genomic DNA Extraction and Real-Time Polymerase Chain Reaction (RT-PCR) for Relative Telomere Length (RTL)
4.3. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Age-Related Macular Degeneration. Russian Clinical Guidelines [Text]. Moscow, 2021; pp. 7, 43. (In Russian). Available online: https://cr.minzdrav.gov.ru/recomend/114_2 (accessed on 7 June 2023).
- Flaxel, C.J.; Adelman, R.A.; Bailey, S.T.; Lim, J.I.; Vemulakonda, G.A. Age-Related Macular Degeneration Preferred Practice Pattern®; American Academy of Ophthalmology: San Francisco, CA, USA, 2019. [Google Scholar] [CrossRef] [Green Version]
- Wong, W.L.; Su, X.; Li, X.; Cheung, C.M.G.; Klein, R.; Cheng, C.Y.; Wong, T.Y. Global prevalence of age-related macular degeneration and disease burden projection for 2020 and 2040: A systematic review and meta-analysis. Lancet Glob Healt 2014, 2, e106–e116. [Google Scholar] [CrossRef]
- Avetisov, S.E.; Egorov, E.A.; Moshetov, L.K.; Neroev, V.V.; Takhchidi, H.P. Ophthalmology. In National Leadership; M.: GEOTAR-Media: Moscow, Russia, 2019; ISBN 978-5-9704-5125-0. (In Russian) [Google Scholar]
- GlobalData. EpiCast Report: Age-Related Macular Edema–Epidemiology Forecast to 2026, November 2017, GDHCER170-17. 2017. Available online: http://www.bigmarketresearch.com/report-enquiry/190821 (accessed on 7 June 2023).
- Joachim, N.; Mitchell, P.; Burlutsky, G.; Kifley, A.; Wang, J.J. The Incidence and Progression of Age-Related Macular Degeneration over 15 Years: The Blue Mountains Eye Study. Ophthalmology 2015, 122, 2482–2489. [Google Scholar] [CrossRef]
- Brandl, C.; Günther, F.; Zimmermann, M.E.; Hartmann, K.; Eberlein, G.; Barth, T.; Winkler, T.W.; Linkohr, B.; Heier, M.; Peters, A.; et al. Incidence, progression and risk factors of age-related macular degeneration in 35-95-year-old individuals from three jointly designed German cohort studies. BMJ Open Ophthalmol. 2022, 7, e000912. [Google Scholar] [CrossRef]
- Lambert, N.G.; ElShelmani, H.; Singh, M.K.; Mansergh, F.C.; Wride, M.A.; Padilla, M.; Keegan, D.; Hogg, R.E.; Ambati, B.K. Risk factors and biomarkers of age-related macular degeneration. Prog. Retin. Eye Res. 2016, 54, 64–102. [Google Scholar] [CrossRef] [Green Version]
- Hunt, M.S.; Chee, Y.E.; Saraf, S.S.; Chew, E.Y.; Lee, C.S.; Lee, A.Y.; Manookin, M.B. Association of Environmental Factors with Age-Related Macular Degeneration using the Intelligent Research in Sight Registry. Ophthalmol. Sci. 2022, 2, 100195, Erratum in Ophthalmol. Sci. 2023, 3, 100272. [Google Scholar] [CrossRef]
- Ulańczyk, Z.; Grabowicz, A.; Cecerska-Heryć, E.; Śleboda-Taront, D.; Krytkowska, E.; Mozolewska-Piotrowska, K.; Safranow, K.; Kawa, M.P.; Dołęgowska, B.; Machalińska, A. Dietary and Lifestyle Factors Modulate the Activity of the Endogenous Antioxidant System in Patients with Age-Related Macular Degeneration: Correlations with Disease Severity. Antioxidants 2020, 9, 954. [Google Scholar] [CrossRef]
- Di Carlo, E.; Augustin, A.J. Prevention of the Onset of Age-Related Macular Degeneration. J. Clin. Med. 2021, 10, 3297. [Google Scholar] [CrossRef]
- Aunan, J.R.; Watson, M.M.; Hagland, H.R.; Søreide, K. Molecular and biological hallmarks of ageing. Br. J. Surg. 2016, 103, e29–e46. [Google Scholar] [CrossRef] [Green Version]
- López-Otín, C.; Blasco, M.A.; Partridge, L.; Serrano, M.; Kroemer, G. The hallmarks of aging. Cell. 2013, 153, 1194–1217. [Google Scholar] [CrossRef] [Green Version]
- Armanios, M.; Blackburn, E.H. The telomere syndromes. Nat. Rev. Genet. 2012, 13, 693–704, Erratum in Nat. Rev. Genet. 2013, 14, 235. [Google Scholar] [CrossRef]
- Victorelli, S.; Passos, J.F. Telomeres and Cell Senescence-Size Matters Not. eBioMedicine 2017, 21, 14–20. [Google Scholar] [CrossRef] [Green Version]
- Gruber, H.J.; Semeraro, M.D.; Renner, W.; Herrmann, M. Telomeres and Age-Related Diseases. Biomedicines 2021, 9, 1335. [Google Scholar] [CrossRef]
- Rochette, P.J.; Brash, D.E. Human telomeres are hypersensitive to UV-induced DNA Damage and refractory to repair. PLoS Genet. 2010, 6, e1000926. [Google Scholar] [CrossRef] [Green Version]
- Zou, Y.; Gryaznov, S.M.; Shay, J.W.; Wright, W.E.; Cornforth, M.N. Asynchronous replication timing of telomeres at opposite arms of mammalian chromosomes. Proc. Natl. Acad. Sci. USA 2004, 101, 12928–12933. [Google Scholar] [CrossRef]
- Daniali, L.; Benetos, A.; Susser, E.; Kark, J.D.; Labat, C.; Kimura, M.; Desai, K.K.; Granick, M.; Aviv, A. Telomeres shorten at equivalent rates in somatic tissues of adults. Nat. Commun. 2013, 4, 1597. [Google Scholar] [CrossRef] [Green Version]
- Demanelis, K.; Jasmine, F.; Chen, L.S.; Chernoff, M.; Tong, L.; Delgado, D.; Zhang, C.; Shinkle, J.; Sabarinathan, M.; Lin, H.; et al. Determinants of telomere length across human tissues. Science 2020, 369, eaaz6876. [Google Scholar] [CrossRef]
- Telegina, D.V.; Kozhevnikova, O.S.; Kolosova, N.G. Molecular mechanisms of cell death in the retina during the development of age-related macular degeneration. Adv. Gerontol. 2016, 29, 424–432. (In Russian) [Google Scholar] [CrossRef]
- Weng, X.; Zhang, H.; Kan, M.; Ye, J.; Liu, F.; Wang, T.; Deng, J.; Tan, Y.; He, L.; Liu, Y. Leukocyte telomere length is associated with advanced age-related macular degeneration in the Han Chinese population. Exp. Gerontol. 2015, 69, 36–40. [Google Scholar] [CrossRef]
- Koller, A.; Brandl, C.; Lamina, C.; Zimmermann, M.E.; Summerer, M.; Stark, K.J.; Würzner, R.; Heid, I.M.; Kronenberg, F. Relative Telomere Length Is Associated with Age-Related Macular Degeneration in Women. Investig. Ophthalmol. Vis. Sci. 2022, 63, 30. [Google Scholar] [CrossRef]
- Rossiello, F.; Jurk, D.; Passos, J.F.; d’Adda di Fagagna, F. Telomere dysfunction in ageing and age-related diseases. Nat. Cell Biol. 2022, 24, 135–147. [Google Scholar] [CrossRef]
- Martínez, P.; Blasco, M.A. Heart-Breaking Telomeres. Circ. Res. 2018, 123, 787–802. [Google Scholar] [CrossRef]
- Immonen, I.; Seitsonen, S.; Saionmaa, O.; Fyhrquist, F. Leucocyte telomere length in age-related macular degeneration. Acta Ophthalmol. 2013, 91, 453–456. [Google Scholar] [CrossRef]
- Banevicius, M.; Gedvilaite, G.; Vilkeviciute, A.; Kriauciuniene, L.; Zemaitiene, R.; Liutkeviciene, R. Association of relative leukocyte telomere length and genetic variants in telomere-related genes (TERT, TERT-CLPTM1, TRF1, TNKS2, TRF2) with atrophic age-related macular degeneration. Ophthalmic Genet. 2021, 42, 189–194. [Google Scholar] [CrossRef]
- Joachim, N.; Colijn, J.M.; Kifley, A.; Lee, K.E.; Buitendijk, G.H.S.; Klein, B.E.K.; Myers, C.E.; Meuer, S.M.; Tan, A.G.; Holliday, E.G.; et al. Five-year progression of unilateral age-related macular degeneration to bilateral involvement: The Three Continent AMD Consortium report. Br. J. Ophthalmol. 2017, 101, 1185–1192. [Google Scholar] [CrossRef] [Green Version]
- Sanders, J.L.; Newman, A.B. Telomere length in epidemiology: A biomarker of aging, age-related disease, both, or neither? Epidemiol. Rev. 2013, 35, 112–131. [Google Scholar] [CrossRef] [Green Version]
- Lee, C.F.; Cheng, A.C.; Fong, D.Y. Eyes or subjects: Are ophthalmic randomized controlled trials properly designed and analyzed? Ophthalmology 2012, 119, 869–872. [Google Scholar] [CrossRef]
- Dong, R.; Ying, G.S. Characteristics of Design and Analysis of Ophthalmic Randomized Controlled Trials: A Review of Ophthalmic Papers 2020–2021. Ophthalmol. Sci. 2022, 3, 100266. [Google Scholar] [CrossRef] [PubMed]
- Stout, S.A.; Lin, J.; Hernandez, N.; Davis, E.P.; Blackburn, E.; Carroll, J.E.; Glynn, L.M. Validation of Minimally-Invasive Sample Collection Methods for Measurement of Telomere Length. Front. Aging Neurosci. 2017, 9, 397. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Le Marchand, L.; Lum-Jones, A.; Saltzman, B.; Visaya, V.; Nomura, A.M.; Kolonel, L.N. Feasibility of collecting buccal cell DNA by mail in a cohort study. Cancer Epidemiol. Biomarkers Prev. 2001, 10, 701–703. [Google Scholar]
- Woo, J.S.; Lu, D.Y. Procurement, Transportation, and Storage of Saliva, Buccal Swab, and Oral Wash Specimens. Methods Mol. Biol. 2019, 1897, 99–105. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.L.; Zhou, H.Y.; Xu, J.; Liu, N.P. Use of buccal swab as a source of genomic DNA for genetic screening in patients with age-related macular degeneration. Chin. J. Ophthalmol. 2012, 48, 114–118. [Google Scholar]
- Age-Related Eye Disease Study Research Group. The Age-Related Eye Disease Study (AREDS): Design implications. AREDS report no. 1. Control. Clin. Trials 1999, 20, 573–600. [Google Scholar] [CrossRef] [PubMed]
- Cawthon, R.M. Telomere length measurement by a novel monochrome multiplex quantitative PCR method. Nucleic Acids Res. 2009, 37, e21. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Characteristics | Group | p Value | |
---|---|---|---|
AMD, n = 96 | Control, n = 70 | ||
Age, years, mean ± SD | 70.96 ± 9.72 | 69.23 ± 11.91 | 0.459 |
45–59 years, n (%) | 18 (18.75) | 13 (18.57) | 0.969 |
60–74 years, n (%) | 38 (39.58) | 29 (41.43) | |
75–90 years, n (%) | 40 (41.67) | 28 (40.0) | |
Sex, n (%) | |||
female | 71 (73.96%) | 48 (68.57%) | 0.447 |
male | 25 (26.04%) | 22 (31.43%) | |
Smoking, n (%) | 13 (13.54%) | 11 (15.71%) | 0.694 |
Body mass index > 30, n (%) | 29 (30.21%) | 9 (12.86%) | 0.009 |
Hypertension, n (%) | 87 (90.62%) | 62 (88.57%) | 0.667 |
Cardiovascular disease, n (%) | 66 (68.75%) | 32 (45.71%) | 0.011 |
Diabetes mellitus, n (%) | 12 (12.50%) | 2 (2.86%) | 0.027 |
Physical inactivity, n (%) | 46 (47.92%) | 8 (11.43%) | <0.0001 |
Relative telomere length, mean ± SD | 0.77 ± 0.08 | 0.99 ± 0.13 | <0.0001 |
Relative telomere length, median (IQR) | 0.76 (0.09) | 0.99 (0.11) | <0.0001 |
Long telomeres, n (%) * | 2 (2.1) | 34 (48.6) | <0.00001 |
Short telomeres, n (%) * | 94 (96.9) | 36 (51.4) |
RTL | All, n = 166 | Women, n = 119 | Men, n = 47 | |||
---|---|---|---|---|---|---|
OR (95% CI) | p Value | OR (95% CI) | p Value | OR (95% CI) | p Value | |
Model unadjusted | 1.37–1.87 | 0.045 | 1.32 (0.93–1.89) | 0.127 | 1.53 (0.84–2.87) | 0.173 |
Model 1 adjusted for sex | 8.46 × 107 (7.94 × 105–2.55 × 1010) | <0.0001 | — | — | ||
Model 2 adjusted for age and sex | 6.96 × 106 (4.16 × 104–3.26 × 109) | <0.0001 | 9.53 × 106 (2.38 × 104–1.64 × 1010) | <0.0001 | 1.04 × 108 (2.02 × 103–2.33 × 1015) | 0.007 |
Model 3 adjusted for age, sex, and current smoking | 2.74 × 107 (9.93 × 104–2.56 × 1010) | <0.0001 | 9.48 × 106 (2.36 × 104–1.63 × 1010) | <0.0001 | 1.66 × 109 (8.09 × 103–4.28 × 1017) | 0.006 |
Model 4 adjusted for sex, cardiovascular disease, and physical inactivity | 6.00 × 107 (4.17 × 105–2.96 × 1010) | <0.0001 | 3.00 × 107 (1.46 × 105–2.59 × 1010) | <0.0001 | 1.66 × 109 (8.09 × 103–4.28 × 1017) | 0.014 |
Characteristic | Stage | p Value | |||
---|---|---|---|---|---|
Absence of AMD (AREDS 1), n = 143 | Early Stage (AREDS 2), n = 54 | Intermediate Stage (AREDS 3), n = 44 | Late Stage (AREDS 4), n = 91 | ||
Men, n (%) | 35 (24.47) | 20 (37.03) | 7 (15.9) | 24 (26.37) | 0.115 |
Women, n (%) | 108 (75.53) | 34 (62.97) | 37 (84.1) | 67 (73.63) | |
Age, years, mean ± SD | 68.85 ± 12.04 | 70.22 ± 9.97 | 71.64 ± 9.09 | 71.71 ± 9.29 | 0.318 |
Relative telomere length, mean ± SD | 0.99 ± 0.13 | 0.80 ± 0.08 | 0.77 ± 0.06 | 0.75 ± 0.08 | <0.00001 |
Spearman’s Correlation Coefficient (rho) | p Value | Kendall Correlation Coefficient (tay) | p Value | |
---|---|---|---|---|
All AREDS groups | −0.726 | <0.00001 | −0.596 | <0.00001 |
AREDS 1-AREDS 2 | −0.603 | <0.00001 | −0.496 | <0.00001 |
AREDS 1-AREDS 3 | −0.615 | <0.00001 | −0.505 | <0.00001 |
AREDS 1-AREDS 4 | −0.720 | <0.00001 | −0.582 | <0.00001 |
AREDS 2-AREDS 3 | −0.266 | 0.008 | −0.219 | 0.009 |
AREDS 2-AREDS 4 | −0.367 | <0.00001 | −0.302 | <0.00001 |
AREDS 3-AREDS 4 | −0.249 | 0.004 | −0.204 | 0.004 |
Factor | Factor Frequency, n (%) | Risk Change (95% CI) | Relative Risk (95% CI) | p Value | |
---|---|---|---|---|---|
No Factor | There Is a Factor | ||||
Relative telomere length < 0.8 | 15 (14.7%) | 50 (78.1%) | 63.4 (51.2–75.7) | 5.31 (3.27–8.63) | <0.0001 |
Primer Name | Sequences |
---|---|
telg | ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT |
telc | TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA |
Hbgu | CGGCGGCGGGCGGCGCGGGCTGGGCGGcttcatccacgttcaccttg |
Hbgd | GCCCGGCCCGCCGCGCCCGTCCCGCCGgaggagaagtctgccgtt |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dmitrenko, O.P.; Abramova, O.I.; Karpova, N.S.; Nurbekov, M.K.; Arshinova, E.S. Relative Telomere Length Is Associated with the Risk of Development and Severity of the Course of Age-Related Macular Degeneration in the Russian Population. Int. J. Mol. Sci. 2023, 24, 11360. https://doi.org/10.3390/ijms241411360
Dmitrenko OP, Abramova OI, Karpova NS, Nurbekov MK, Arshinova ES. Relative Telomere Length Is Associated with the Risk of Development and Severity of the Course of Age-Related Macular Degeneration in the Russian Population. International Journal of Molecular Sciences. 2023; 24(14):11360. https://doi.org/10.3390/ijms241411360
Chicago/Turabian StyleDmitrenko, Olga P., Olga I. Abramova, Nataliia S. Karpova, Malik K. Nurbekov, and Ekaterina S. Arshinova. 2023. "Relative Telomere Length Is Associated with the Risk of Development and Severity of the Course of Age-Related Macular Degeneration in the Russian Population" International Journal of Molecular Sciences 24, no. 14: 11360. https://doi.org/10.3390/ijms241411360
APA StyleDmitrenko, O. P., Abramova, O. I., Karpova, N. S., Nurbekov, M. K., & Arshinova, E. S. (2023). Relative Telomere Length Is Associated with the Risk of Development and Severity of the Course of Age-Related Macular Degeneration in the Russian Population. International Journal of Molecular Sciences, 24(14), 11360. https://doi.org/10.3390/ijms241411360