Comparison of the Effects of Essential Oils from Cannabis sativa and Cannabis indica on Selected Bacteria, Rumen Fermentation, and Methane Production—In Vitro Study
Abstract
:1. Introduction
2. Results
2.1. Analysis of Essential Oils
2.2. In Vitro Rumen Fermentation Characteristics
2.3. DNA Extraction and Analysis of Changes in the Composition of Microorganisms Using qPCR
3. Discussion
4. Materials and Methods
4.1. Chromatographical Analysis
4.2. Ruminal Inoculum and In Vitro Incubation
4.3. DNA Extraction and Analysis of Changes in the Composition of Microorganisms Using qPCR
4.4. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Benelli, G.; Pavela, R.; Petrelli, R.; Cappellacci, L.; Santini, G.; Fiorini, D.; Sut, S.; Dall, S.; Canale, A.; Maggi, F. The essential oil from industrial hemp (Cannabis sativa L.) by-products as an effective tool for insect pest management in organic crops. Ind. Crop. Prod. 2018, 122, 308–315. [Google Scholar] [CrossRef]
- Marzorati, S.; Friscione, D.; Picchi, E.; Verotta, L. Cannabidiol from inflorescences of Cannabis sativa L.: Green extraction and purification processes. Ind. Crop. Prod. J. 2020, 155, 112816. [Google Scholar] [CrossRef]
- Lowe, H.; Steele, B.; Bryant, J.; Toyang, N.; Ngwa, W. Non-cannabinoid metabolites of Cannabis sativa L. with therapeutic potential. Plants 2021, 10, 400. [Google Scholar] [CrossRef]
- Birenboim, M.; Chalupowicz, D.; Maurer, D.; Barel, S.; Chen, Y.; Fallik, E.; Paz-kagan, T.; Rapaport, T.; Sadeh, A.; Kengisbuch, D.; et al. Phytochemistry multivariate classification of cannabis chemovars based on their terpene and cannabinoid profiles. Phytochemistry 2022, 200, 113215. [Google Scholar] [CrossRef]
- Simiyu, D.C.; Jang, J.H.; Lee, O.R. Understanding Cannabis sativa L.: Current status of propagation, use, legalization, and haploid-inducer-mediated genetic engineering. Plants 2022, 11, 1236. [Google Scholar] [CrossRef]
- Malabadi, R.B.; Kolkar, K.P.; Chalannavar, R.K.; Baijnath, H. Cannabis sativa: Difference between medical Cannabis (marijuana or drug type) and industrial hemp. GSC Biol. Pharm. Sci. 2023, 24, 377–381. [Google Scholar] [CrossRef]
- Nissen, L.; Zatta, A.; Stefanini, I.; Grandi, S.; Sgorbati, B.; Biavati, B.; Monti, A. Characterization and antimicrobial activity of essential oils of industrial hemp varieties (Cannabis sativa L.). Fitoterapia 2010, 81, 413–419. [Google Scholar] [CrossRef]
- Rehman, M.; Fahad, S.; Du, G.; Cheng, X.; Yang, Y.; Tang, K.; Liu, L.; Liu, F.-H.; Deng, G. Evaluation of hemp (Cannabis sativa L.) as an industrial crop: A review. Environ. Sci. Pollut. Res. 2021, 28, 52832–52843. [Google Scholar] [CrossRef]
- Iseppi, R.; Brighenti, V.; Licata, M.; Lambertini, A.; Sabia, C.; Messi, P.; Pellati, F.; Benvenuti, S. Chemical characterization and evaluation of the antibacterial activity of essential oils from fibre-type Cannabis sativa L. (hemp). Molecules 2019, 24, 2302. [Google Scholar] [CrossRef] [PubMed]
- Orlando, G.; Adorisio, S.; Delfino, D.; Chiavaroli, A.; Brunetti, L.; Recinella, L.; Leone, S.; Antonio, M.D.; Zengin, G.; Acquaviva, A.; et al. Comparative investigation of composition, antifungal, and anti-inflammatory effects of the essential oil from three industrial hemp varieties from Italian cultivation. Antibiotics 2021, 10, 334. [Google Scholar] [CrossRef]
- Zheljazkov, V.D.; Sikora, V.; Dincheva, I.; Kacániová, M.; Astatkie, T.; Semerdjieva, I.B.; Latkovic, D. Industrial, CBD, and wild hemp: How different are their essential oil profile and antimicrobial activity? Molecules 2020, 25, 4631. [Google Scholar] [CrossRef]
- Machado, C.A.; Oliveira, F.O.; de Andrade, M.A.; Hodel, K.V.S.; Lepikson, H.; Machado, B.A.S. Steam distillation for essential oil extraction: An evaluation of technological advances based on an analysis of patent documents. Sustainability 2022, 14, 7119. [Google Scholar] [CrossRef]
- Calsamiglia, S.; Busquet, M.; Cardozo, P.W.; Castillejos, L.; Ferret, A. Invited review: Essential oils as modifiers of rumen microbial fermentation. J. Dairy Sci. 2007, 90, 2580–2595. [Google Scholar] [CrossRef]
- Synowiec, A.; Rys, M.; Bocianowski, J.; Wielgusz, K.; Byczyñska, M.; Heller, K.; Kalemba, D. Phytotoxic effect of fiber hemp essential oil on germination of some weeds and crops. J. Essent. Oil Bear. Plants 2016, 19, 262–276. [Google Scholar] [CrossRef]
- Hassan, F.; Arshad, M.A.; Ebeid, H.M.; Saif-ur Rehman, M.; Sajjad Khan, M.; Shahid, S.; Yang, C. Phytogenic additives can modulate rumen microbiome to mediate fermentation kinetics and methanogenesis through exploiting diet—Microbe interaction. Front. Vet. Sci. 2020, 7, 575801. [Google Scholar] [CrossRef]
- Rossi, P.; Cappelli, A.; Marinelli, O.; Valzano, M.; Pavoni, L.; Bonacucina, G.; Petrelli, R.; Pompei, P.; Mazzara, E.; Ricci, I.; et al. Mosquitocidal and anti-inflammatory properties of the essential oils obtained from monoecious, male, and female inflorescences of hemp (Cannabis sativa L.) and their encapsulation in nanoemulsions. Molecules 2020, 25, 3451. [Google Scholar] [CrossRef]
- Palmieri, S.; Maggio, F.; Pellegrini, M.; Ricci, A.; Serio, A.; Paparella, A.; Sterzo, L.C. Effect of the distillation time on the chemical composition, antioxidant potential and antimicrobial activity of essential oils from different Cannabis sativa L. cultivars. Molecules 2021, 26, 4770. [Google Scholar] [CrossRef]
- Cerino, P.; Buonerba, C.; Cannazza, G.; Auria, J.D.; Ottoni, E.; Fulgione, A.; Di Stasio, A.; Pierri, B.; Gallo, A. A review of hemp as food and nutritional supplement. Cannabis Cannabinoid Res. 2021, 6, 19–27. [Google Scholar] [CrossRef]
- Petrovici, A.R.; Simionescu, N.; Sandu, A.I.; Paraschiv, V.; Silion, M.; Pinteala, M. New insights on hemp oil enriched in cannabidiol: Decarboxylation, antioxidant properties and in vitro anticancer effect. Antioxidants 2021, 10, 738. [Google Scholar] [CrossRef]
- Franz, C.; Baser, K.H.C.; Windisch, W. Essential oils and aromatic plants in animal feeding—A European perspective. A review. Flavour Fragr. J. 2010, 25, 327–340. [Google Scholar] [CrossRef]
- Benlemlih, M.; Aarab, A.; Bakkali, M.; Arakrak, A.; Laglaoui, A. Effect of dietary fennel and thyme essential oil supplementation on zootechnical parameters and caecal microflora of growing rabbit. Rev. Microbiol. Ind. San Environ. 2014, 8, 16–25. [Google Scholar]
- Yacoub, O.S.M.; Embarek, A.; Abderahim, K.; Abdelmoula, E.; Bouchra, B.; Ali, O.; Aboubaker, E.H.; Omar, A.; Abdelhalim, M. Chemical composition and zootechnical effects of essential oil of fennel (Foeniculum vulgare Mill.) and anise (Pimpinella anisum L.) on turkey. J. World’s Poult. Res. 2015, 5, 90–97. [Google Scholar]
- Kleinhenz, M.D.; Weeder, M.; Montgomery, S.; Martin, M.; Curtis, A.; Magnin, G.; Lin, Z.; Griffin, J.; Coetzee, J.F. Short term feeding of industrial hemp with a high cannabidiolic acid (CBDA) content increases lying behavior and reduces biomarkers of stress and inflammation in Holstein steers. Sci. Rep. 2022, 12, 3683. [Google Scholar] [CrossRef]
- Aguzzi, C.; Perinelli, D.R.; Cespi, M.; Zeppa, L.; Mazzara, E.; Maggi, F.; Petrelli, R.; Bonacucina, G.; Nabissi, M. Encapsulation of hemp (Cannabis sativa L.) essential oils into nanoemulsions for potential therapeutic applications: Assessment of cytotoxicological profiles. Molecules 2023, 28, 6479. [Google Scholar] [CrossRef]
- Silva, S.N.S.; Chabrillat, T.; Kerros, S.; Guillaume, S.; Gandra, J.R.; De Carvalho, P.; Silva, F.F.; Mesquita, L.G.; Gordiano, L.A.; Camargo, G.M.F.; et al. Effects of plant extract supplementations or monensin on nutrient intake, digestibility, ruminal fermentation and metabolism in dairy cows. Anim. Feed Sci. Technol. 2021, 275, 2015. [Google Scholar] [CrossRef]
- Winders, T.M.; Holman, D.B.; Schmidt, K.N.; Luecke, S.M.; Smith, D.J.; Neville, B.W.; Dahlen, C.R.; Swanson, K.C.; Amat, S. Feeding hempseed cake alters the bovine gut, respiratory and reproductive microbiota. Sci. Rep. 2023, 13, 8121. [Google Scholar] [CrossRef]
- Silvestre, T.; Martins, L.F.; Cueva, S.F.; Wasson, D.E.; Stepanchenko, N.; Räisänen, S.E.; Sommai, S.; Hile, M.L.; Hristov, A.N. Lactational performance, rumen fermentation, nutrient use efficiency, enteric methane emissions, and manure greenhouse gas-emitting potential in dairy cows fed a blend of essential oils. J. Dairy Sci. 2023, 106, 7661–7674. [Google Scholar] [CrossRef]
- Klop, G.; Dijkstra, J.; Dieho, K.; Hendriks, W.H.; Bannink, A. Enteric methane production in lactating dairy cows with continuous feeding of essential oils or rotational feeding of essential oils and lauric acid. J. Dairy Sci. 2017, 100, 3563–3575. [Google Scholar] [CrossRef]
- Ibrahim, E.A.; Wang, M.; Radwan, M.M.; Wanas, A.S.; Majumdar, C.G.; Avula, B.; Wang, Y.; Khan, I.A.; Chandra, S.; Lata, H.; et al. Analysis of terpenes in Cannabis sativa L. using GC/MS: Method development, validation, and application. Planta Med. 2019, 85, 431–438. [Google Scholar] [CrossRef]
- Naz, S.; Hanif, M.A.; Bhatti, H.N.; Mahmood, T. Impact of supercritical fluid extraction and traditional distillation on the isolation of aromatic compounds from Cannabis indica and Cannabis sativa. J. Essent. Oil Bear. Plants 2017, 20, 175–184. [Google Scholar] [CrossRef]
- Abrahamsen, F.W.; Gurung, N.K.; Abebe, W.; Reddy, G.P.; Mullenix, K.; Adhikari, S. Effects of feeding varying levels of hempseed meal on dry matter intake, rumen fermentation, in vitro digestibility, blood metabolites, and growth performance of growing meat goats. Appl. Anim. Sci. 2021, 37, 681–688. [Google Scholar] [CrossRef]
- Addo, F.; Ominski, K.; Yang, C.; Plaizier, J.C. Quality and safety of hemp meal as a protein supplement for nonlactating dairy cows. J. Dairy Sci. 2023, 106, 7602–7612. [Google Scholar] [CrossRef]
- Winders, T.M.; Neville, B.W.; Swanson, K.C. Effects of hempseed cake on ruminal fermentation parameters, nutrient digestibility, nutrient flow, and nitrogen balance in finishing steers. J. Anim. Sci. 2023, 101, skac291. [Google Scholar] [CrossRef]
- Altman, A.W.; Kent-Dennis, C.; Klotz, J.L.; Mcleod, K.R.; Vanzant, E.S.; Harmon, D.L. Review: Utilizing industrial hemp (Cannabis sativa L.) by-products in livestock rations. Anim. Feed Sci. Technol. 2024, 307, 115850. [Google Scholar] [CrossRef]
- Castañeda-Correa, A.; Corral-Luna, A.; Hume, M.E.; Anderson, R.C.; Ruiz-Barrera, O.; Castillo-Castillo, Y.; Arzola-Alvarez, C. Effects of thymol and carvacrol, alone or in combination, on fermentation and microbial diversity during in vitro culture of bovine rumen microbes. J. Environ. Sci. Health Part B 2019, 54, 170–175. [Google Scholar] [CrossRef]
- Cobellis, G.; Trabalza-marinucci, M.; Carla, M.; Yu, Z. Evaluation of different essential oils in modulating methane and ammonia production, rumen fermentation, and rumen bacteria in vitro. Anim. Feed Sci. Technol. 2016, 215, 25–36. [Google Scholar] [CrossRef]
- Moo, C.L.; Yang, S.K.; Osman, M.A.; Yuswan, M.H.; Loh, J.Y.; Lim, W.M.; Lai, K.S. Antibacterial Activity and Mode of Action of β-caryophyllene on. Polish J. Microbiol. 2020, 69, 49–54. [Google Scholar] [CrossRef]
- Yoo, H.J.; Jwa, S.K. Inhibitory effects of β-caryophyllene on Streptococcus mutans biofilm. Arch. Oral Biol. 2018, 88, 42–46. [Google Scholar] [CrossRef]
- Cucinotta, L.; De Grazia, G.; Micalizzi, G.; Bontempo, L.; Camin, F.; Mondello, L.; Sciarrone, D. Simultaneous evaluation of the enantiomeric and carbon isotopic ratios of Cannabis sativa L. essential oils by multidimensional gas chromatography. Analytic. Bioanalyt. Chem. 2022, 414, 5643–5656. [Google Scholar] [CrossRef]
- Araiza-Rosales, E.E.; Herrera-Torres, E.; Carrete-Carreón, F.Ó.; Jiménez-Ocampo, R.; Gómez-Sánchez, D.; Pámanes-Carrasco, G.A. Nutrient concentrations, in vitro digestibility and rumen fermentation of agro-industrial residues of Cannabis sativa L. as a potential forage source for ruminants. Rev. Mex. Cienc. Pecu. 2023, 14, 366–383. [Google Scholar] [CrossRef]
- Hessle, A.; Eriksson, M.; Nadeau, E.; Turner, T.; Johansson, B.; Eriksson, M.; Nadeau, E.; Turner, T.; Cold-, B.J. Cold-pressed hempseed cake as a protein feed for growing cattle. Acta Agric. Scand Sect. A 2008, 58, 136–145. [Google Scholar] [CrossRef]
- Vastolo, A.; Calabrò, S.; Pacifico, S.; Ivan, B.; Cutrignelli, M.I. Chemical and nutritional characteristics of Cannabis sativa L. products. J. Anim. Physiol. Anim. Nutr. 2021, 105, 1–9. [Google Scholar] [CrossRef]
- Jensen, R.H.; Rønn, M.; Thorsteinsson, M.; Olijhoek, D.W.; Nielsen, M.O.; Nørskov, N.P. Untargeted metabolomics combined with solid phase fractionation for systematic characterization of bioactive compounds in hemp with methane mitigation potential. Metabolites 2022, 12, 77. [Google Scholar] [CrossRef]
- Wang, S.; Kreuzer, M.; Schwarm, A. Effect of unconventional oilseeds (safflower, poppy, hemp, camelina) on in vitro ruminal methane production and fermentation. J. Sci. Food Agric. 2017, 97, 3864–3870. [Google Scholar] [CrossRef]
- Wang, Y.; Yu, Q.; Wang, X.; Song, J.; Lambo, M.T.; Huang, J.; He, P.; Li, Y.; Zhang, Y. Replacing alfalfa hay with industrial hemp ethanol extraction byproduct and Chinese wildrye hay: Effects on lactation performance, plasma metabolites, and bacterial communities in Holstein cows. Front. Vet. Sci. 2023, 10, 1061219. [Google Scholar] [CrossRef]
- Wróbel, B.; Hryniewicz, M.; Kulkova, I.; Mazur, K.; Jakubowska, Z.; Borek, K.; Dobrzyński, J.; Konieczna, A.; Miecznikowski, A.; Piasecka-Jóźwiak, K.; et al. Fermentation quality and chemical composition of industrial hemp (Cannabis sativa L.) silage inoculated with bacterial starter cultures—A pilot study. Agronomy 2023, 13, 1371. [Google Scholar] [CrossRef]
- Zhou, X.; Zhan, N.; Zhang, J.; Gu, Q.; Dong, C.; Lin, B.; Zou, C. Microbiome and fermentation parameters in the rumen of dairy buffalo in response to ingestion associated with a diet supplemented with cysteamine and hemp seed oil. J. Anim. Physiol. Anim. Nutr. 2022, 106, 471–484. [Google Scholar] [CrossRef]
- Chatterjee, P.N.; Kamra, D.N.; Agarwal, N.; Patra, A.K. Influence of supplementation of tropical plant feed additives on in vitro rumen fermentation and methanogenesis. Anim. Prod. Sci. 2014, 54, 1770–1774. [Google Scholar] [CrossRef]
- Ndong, C.; Nchama, N.; Fabro, C.; Sepulcri, A.; Corazzin, M.; Baldini, M.; Sacc, E.; Foletto, V.; Piasentier, E.; Sepulcri, A.; et al. Hempseed by-product in diets of Italian simmental cull dairy cows and its effects on animal performance and meat quality. Animals 2022, 12, 1014. [Google Scholar] [CrossRef]
- Tekippe, J.A.; Tacoma, R.; Hristov, A.N.; Lee, C.; Oh, J.; Heyler, K.S.; Cassidy, T.W. Effect of essential oils on ruminal fermentation and lactation performance of dairy cows. J. Dairy Sci. 2013, 96, 7892–7903. [Google Scholar] [CrossRef]
- Spanghero, M.; Zanfi, C.; Fabbro, E.; Scicutella, N.; Camellini, C. Effects of a blend of essential oils on some end products of in vitro rumen fermentation. Anim. Feed Sci. Technol. 2008, 145, 364–374. [Google Scholar] [CrossRef]
- Tager, L.R.; Krause, K.M. Effects of essential oils on rumen fermentation, milk production, and feeding behavior in lactating dairy cows. J. Dairy Sci. 2011, 94, 2455–2464. [Google Scholar] [CrossRef]
- Temmar, R.; Forgeard, G.; Rougier, C.; Calsamiglia, S. Interactions among natural active ingredients to improve the efficiency of rumen fermentation in vitro. Animals 2021, 11, 1205. [Google Scholar] [CrossRef]
- Castillejos, L.; Calsamiglia, S.; Ferret, A. Effect of essential oil active compounds on rumen microbial fermentation and nutrient flow in in vitro systems. J. Dairy Sci. 2006, 89, 2649–2658. [Google Scholar] [CrossRef]
- Castillejos, L.; Calsamiglia, S.; Mart, J.; Wijlen, H. Ter In vitro evaluation of effects of ten essential oils at three doses on ruminal fermentation of high concentrate feedlot-type diets. Anim. Feed Sci. Technol. 2008, 145, 259–270. [Google Scholar] [CrossRef]
- Hristov, A.N.; Ropp, J.K.; Zaman, S.; Melgar, A. Effects of essential oils on in vitro ruminal fermentation and ammonia release. Anim. Feed Sci. Technol. 2008, 144, 55–64. [Google Scholar] [CrossRef]
- Joch, M.; Kudrna, V.; Hakl, J.; Bo, M.; Homolka, P.; Illek, J.; Tyrolová, Y.; Výborná, A. In vitro and in vivo potential of a blend of essential oil compounds to improve rumen fermentation and performance of dairy cows. Anim. Feed Sci. Technol. 2019, 251, 176–186. [Google Scholar] [CrossRef]
- Kim, H.; Jung, E.; Lee, H.G.; Kim, B.; Cho, S.; Lee, S.; Kwon, I.; Seo, J. Essential oil mixture on rumen fermentation and microbial community—an in vitro study. Asian-Australas J. Anim. Sci. 2019, 32, 808–814. [Google Scholar] [CrossRef]
- Roy, D.; Tom, S.K.; Sirohi, S.K.; Kumar, V.; Kumar, M. Efficacy of different essential oils in modulating rumen fermentation in vitro using buffalo rumen liquor. Vet. World 2014, 7, 213–218. [Google Scholar] [CrossRef]
- Santos, F.H.R.; Paula, M.R.; De Lezier, D.; Silva, J.T.; Santos, G.; Bittar, C.M.M. Essential oils for dairy calves: Effects on performance, scours, rumen fermentation and intestinal fauna. Animal 2015, 9, 958–965. [Google Scholar] [CrossRef]
- Benchaar, C.; Chaves, A.V.; Fraser, G.R.; Wang, Y.; Beauchemin, K.A.; Mcallister, T.A. Effects of essential oils and their components on in vitro rumen microbial fermentation. Can. J. Anim. Sci. 2007, 87, 413–419. [Google Scholar] [CrossRef]
- Garcia, F.; Brunetti, M.A.; Jos, M.; Moreno, M.V.; Turcato, M.C.S.; Lucini, E.; Frossasco, G.; Ferrer, J.M. The reduction of methane production in the in vitro ruminal fermentation of different substrates is linked with the chemical composition of the essential oil. Animals 2020, 10, 786. [Google Scholar] [CrossRef] [PubMed]
- Gunal, M.; Ishlak, A.; Abughazaleh, A.A.; Khattab, W. Essential oils effect on rumen fermentation and biohydrogenation under in vitro conditions. Czech J. Anim. Sci. 2014, 59, 450–459. [Google Scholar] [CrossRef]
- Joch, M.; Cermak, L.; Hakl, J.; Hucko, B.; Duskova, D.; Marounek, M. In vitro screening of essential oil active compounds for manipulation of rumen fermentation and methane mitigation. Asian Australas. J. Anim. Sci. 2016, 29, 952–959. [Google Scholar] [CrossRef] [PubMed]
- Nagaraja, T.G.; Titgemeyer, E.C. Ruminal acidosis in beef cattle: The current microbiological and nutritional outlook. J. Dairy Sci. 2007, 90, E17–E38. [Google Scholar] [CrossRef] [PubMed]
- Williams, A.G.; Withers, S.E. Induction of xylan-degrading enzymes in Butyrivibrio fibrisolvens. Curr. Microbiol. 1992, 25, 297–303. [Google Scholar] [CrossRef]
- Fernando, S.C.; Ii, H.T.P.; Najar, F.Z.; Sukharnikov, L.O.; Krehbiel, C.R.; Nagaraja, T.G.; Roe, B.A.; Desilva, U. Rumen microbial population dynamics during adaptation to a high-grain diet. Appl. Environ. Microbiol. 2010, 76, 7482–7490. [Google Scholar] [CrossRef]
- European Parliament and of the Council, Strasbourg, France; European Parliament and of the Council. Directive 2010/63/EU of 22 September 2010 on the Protection of Animals Used for Scientific Purposes. Off. J. Eur. Union 2010, 1-47.
- ANKOM Technology. ANKOM Gas Production System Operator’s Manual; ANKOM Technology: Macedon, NY, USA, 2018. [Google Scholar]
- McAuliffe, S.; Mee, J.F.; Lewis, E.; Galvin, N.; Hennessy, D. Feeding system effects on dairy cow rumen function and milk production. Animals 2022, 12, 523. [Google Scholar] [CrossRef]
- Dhakal, R.; Copani, G.; Cappellozza, B.I.; Milora, N.; Hansen, H.H. The effect of direct-fed microbials on in-vitro rumen fermentation of grass or maize silage. Fermentation 2023, 9, 347. [Google Scholar] [CrossRef]
- Abrahamse, P.A.; Vlaeminck, B.; Tamminga, S.; Dijkstra, J. The effect of silage and concentrate type on intake behavior, rumen function, and milk production in dairy cows in early and late lactation. J. Dairy Sci. 2008, 91, 4778–4792. [Google Scholar] [CrossRef]
- Baran, M.; Žitňan, R. Effect of monensin sodium on fermentation efficiency in sheep rumen (short communication). Arch. Tierz. Dummerstorf 2002, 45, 181–185. [Google Scholar] [CrossRef]
- Abdelmegeid, M.K.; Elolimy, A.A.; Zhou, Z.; Lopreiato, V.; Mccann, J.C.; Loor, J.J. Rumen-protected methionine during the peripartal period in dairy cows and its effects on abundance of major species of ruminal bacteria. J. Anim. Sci. Biotechnol. 2018, 9, 17. [Google Scholar] [CrossRef] [PubMed]
- Dubernet, S.; Desmasures, N.; Gue¤guen, M. A PCR-based method for identification of lactobacilli at the genus level. FEMS Microbiol. Lett. 2002, 214, 271–275. [Google Scholar] [CrossRef] [PubMed]
- Stevenson, D.M.; Weimer, P.J. Dominance of Prevotella and low abundance of classical ruminal bacterial species in the bovine rumen revealed by relative quantification real-time PCR. Appl. Microbiol. Biotechnol. 2007, 75, 165–174. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.L.; Bu, D.P.; Wang, J.Q.; Hu, Z.Y.; Li, D.; Wei, H.Y.; Zhou, L.Y.; Loor, J.J. Soybean oil and linseed oil supplementation affect profiles of ruminal microorganisms in dairy cows. Animal 2009, 3, 1562–1569. [Google Scholar] [CrossRef] [PubMed]
- Fliegerova, K.; Tapio, I.; Bonin, A.; Mrazek, J.; Luisa, M.; Shing, K.J.; Bani, P.; Bayat, A.; Vilkki, J.; Kope, J.; et al. Effect of DNA extraction and sample preservation method on rumen bacterial population. Anaerobe 2013, 80–84. [Google Scholar] [CrossRef]
- Maeda, H.; Fujimoto, C.; Haruki, Y.; Maeda, T.; Kokeguchi, S.; Petelin, M.; Arai, H.; Tanimoto, I.; Nishimura, F.; Takashiba, S. Quantitative real-time PCR using TaqMan and SYBR Green for Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, tetQ gene and total bacteria. FEMS Immunol. Med. Microbiol. 2003, 39, 81–86. [Google Scholar] [CrossRef]
No. | Peak Name | KI Exp. | KI Lit. | CAS | Identification | C. sativa | C. indica |
---|---|---|---|---|---|---|---|
1 | 2-octene, (E)- | 810 | 815 | 13389-42-9 | MS, KI | 0.043 | 0.045 |
2 | 4-Hydroxy-4-methyl-2-pentanone | 843 | 842 | 123-42-2 | MS, KI | 0.266 | 0.194 |
3 | Tricyclene | 919 | 923 | 508-32-7 | S, MS, KI | 0.395 | 0.212 |
4 | α-Thujene | 928 | 927 | 2-05-2867 | S, MS, KI | 0.192 | 0.114 |
5 | α-Pinene | 935 | 933 | 80-56-8 | S, MS, KI | 7.243 | 8.892 |
6 | Camphene | 950 | 953 | 79-92-5 | S, MS, KI | 0.272 | 0.172 |
7 | Sabinene | 974 | 972 | 3387-41-5 | S, MS, KI | 0.05 | 0.036 |
8 | β-Pinene | 976 | 978 | 127-91-3 | S, MS, KI | 4.148 | 4.081 |
9 | Myrcene | 992 | 991 | 123-35-3 | S, MS, KI | 13.772 | 0.084 |
10 | Ethyl hexanoate | 1001 | 1003 | 123-66-0 | S, MS, KI | 0.051 | 0.362 |
11 | p-Mentha-1(7),8-diene | 1009 | 1004 | 499-97-8 | MS, KI | 0.221 | 1.362 |
12 | Hexyl acetate | 1017 | 1012 | 142-92-7 | S, MS, KI | 0.085 | 0.296 |
13 | p-Cymene | 1024 | 1025 | 99-87-6 | S, MS, KI | 0.542 | 0.265 |
14 | Limonene | 1029 | 1030 | 138-86-3 | S, MS, KI | 7.273 | 2.22 |
15 | Eucalyptol | 1030 | 1032 | 470-82-6 | S, MS, KI | 0.892 | 0.147 |
16 | β-Ocimene (Z)- | 1041 | 1035 | 3338-55-4 | S, MS, KI | 0.145 | 1.064 |
17 | β-Ocimene (E)- | 1051 | 1046 | 3779-61-1 | S, MS, KI | 0.655 | 9.778 |
18 | Melon aldehyde | 1055 | 1053 | 106-72-9 | MS, KI | 0.088 | 0.004 |
19 | γ-Terpinene | 1059 | 1058 | 99-85-4 | S, MS, KI | 0.031 | 0.238 |
20 | cis-Sabinene hydrate | 1067 | 1069 | 15537-55-0 | S, MS, KI | 0.108 | 0.097 |
21 | Fenchone | 1085 | 1090 | 1195-79-5 | S, MS, KI | 0.037 | 0.001 |
22 | Terpinolene | 1086 | 1086 | 586-62-9 | S, MS, KI | 0.449 | 12.267 |
23 | 6,7-Epoxymyrcene | 1093 | 1096 | 29414-55-9 | MS, KI | 0.082 | 0.031 |
24 | Linalool | 1099 | 1101 | 78-70-6 | S, MS, KI | 2.064 | 0.176 |
25 | Heptenyl acetate | 1109 | 1104 | 6939-73-4 | MS, KI | 0.616 | 0.089 |
26 | trans-Pinene hydrate | 1117 | 1121 | 4948-29-2 | MS, KI | 0.383 | 0.059 |
27 | trans-Sabinol | 1135 | 1140 | 471-16-9 | MS, KI | 0.056 | 0.05 |
28 | Myroxide (E) | 1145 | 1141 | 28977-57-3 | MS, KI | 0.076 | 0.267 |
29 | β-Pinene oxide | 1159 | 1156 | 6931-54-0 | MS, KI | 0.041 | 0.05 |
30 | Isoborneol | 1162 | 1165 | 10385-78-1 | S, MS, KI | 0.111 | 0.018 |
31 | Linalool ethyl ether | 1174 | 1166 | 72845-33-1 | MS, KI | 0.366 | 0.198 |
32 | p-Cymen-8-ol | 1183 | 1189 | 1197-01-9 | S, MS, KI | 0.416 | 0.587 |
33 | Santolinyl acetate | 1187 | 1175 | 79507-88-3 | MS, KI | 0.429 | 0.098 |
34 | Hexyl butyrate | 1194 | 1195 | 2639-63-6 | MS, KI | 0.363 | 0.121 |
35 | Ethyl octanoate | 1199 | 1202 | 106-32-1 | MS, KI | 0.082 | 0.026 |
36 | cis-4 Caranone | 1209 | 1205 | 06.01.4176 | MS, KI | 0.041 | 0.076 |
37 | trans-Carveol | 1216 | 1223 | 1197-07-5 | MS, KI | 0.066 | 0.066 |
38 | Carvone | 1240 | 1246 | 99-49-0 | S, MS, KI | 0.044 | 0.009 |
39 | Dec-(5Z)-en-1-ol | 1274 | 1263 | 51652-47-2 | MS, KI | 0.034 | 0.062 |
40 | Phellandral | 1278 | 1277 | 21391-98-0 | S, MS, KI | 0.055 | 0.103 |
41 | iso-Dihydrocarveol acetate | 1332 | 1328 | 160868-58-6 | MS, KI | 0.06 | 0.03 |
42 | α-Cubebene | 1345 | 1349 | 31141-66-9 | S, MS, KI | 0.04 | 0.007 |
43 | α-Ylangene | 1364 | 1371 | 14912-44-8 | MS, KI | 0.123 | 0.05 |
44 | α-Copaene | 1368 | 1375 | 138874-68-7 | S, MS, KI | 0.069 | 0.026 |
45 | Longicyclene | 1382 | 1372 | 1137-12-8 | MS, KI | 0.303 | 0.04 |
46 | 7-epi-Sesquithujene | 1386 | 1387 | 159407-35-9 | MS, KI | 0.053 | 0.037 |
47 | Hexyl hexanoate | 1388 | 1390 | 6378-65-0 | MS, KI | 0.125 | 0.277 |
48 | β-Elemene | 1396 | 1390 | 33880-83-0 | MS, KI | 0.558 | 0.389 |
49 | Sesquithujene | 1402 | 1402 | 58319-06-5 | MS, KI | 0.115 | 0.05 |
51 | E-β-Caryophyllene | 1408 | 1413 | 87-44-5 | S, MS, KI | 18.451 | 24.096 |
52 | α-Santalene | 1413 | 1418 | 512-61-8 | MS, KI | 0.284 | 0.3 |
53 | γ-Elemene | 1427 | 1432 | 29873-99-2 | MS, KI | 0.885 | 0.265 |
54 | α-trans-Bergamotene | 1431 | 1432 | 13474-59-4 | S, MS, KI | 3.126 | 2.354 |
55 | α-Humulene | 1443 | 1445 | 24568-69-2 | S, MS, KI | 6.191 | 7.702 |
56 | Aromadendrene | 1447 | 1440 | 109119-91-7 | MS, KI | 0.375 | 0.842 |
57 | Sesquisabinene | 1457 | 1455 | 58319-04-3 | MS, KI | 1.973 | 2.648 |
58 | Valerena-4,7(11)-diene | 1467 | 1455 | 351222-66-7 | MS, KI | 0.141 | 0.16 |
59 | Dauca-5,8-diene | 1469 | 1473 | 142928-08-3 | MS, KI | 0.133 | 0.019 |
60 | 9-epi-(E)-Caryophyllene | 1474 | 1464 | 68832-35-9 | MS, KI | 1.791 | 1.946 |
61 | α-Curcumene | 1478 | 1480 | 644-30-4 | MS, KI | 0.412 | 0.19 |
62 | β-Selinene | 1483 | 1492 | 17066-67-0 | MS, KI | 1.298 | 1.34 |
63 | unknown a | 1486 | – | – | – | 0.004 | 0 |
64 | α-Bulnesene | 1496 | 1505 | 489-81-6 | MS, KI | 1.029 | 0.16 |
65 | β-Bisabolene | 1503 | 1508 | 4891-79-6 | MS, KI | 0.776 | 0.389 |
66 | γ-Patchoulene | 1507 | 1506 | 508-55-4 | MS, KI | 1.241 | 0.896 |
67 | δ-Cadinene | 1515 | 1518 | 16729-01-4 | S, MS, KI | 0.093 | 0.074 |
68 | β-Sesquiphellandrene | 1518 | 1523 | 20307-83-9 | MS, KI | 0.13 | 0.221 |
69 | γ-Cuprenene | 1523 | 1530 | 4895-23-2 | MS, KI | 3.078 | 0.895 |
70 | 7-epi-a-Selinene | 1529 | 1518 | 123123-37-5 | MS, KI | 4.188 | 1.591 |
71 | α-Bisabolene (E)- | 1540 | 1540 | 25532-79-0 | MS, KI | 1.128 | 0.268 |
72 | Selina-3,7(11)-diene | 1544 | 1546 | 222187-60-2 | MS, KI | 2.09 | 0.566 |
73 | (E)-Nerolidol | 1562 | 1561 | 40716-66-3 | S, MS, KI | 0.138 | 0.26 |
74 | Caryophylene oxide | 1569 | 1576 | 1209-61-6 | MS, KI | 4.198 | 4.674 |
75 | Spathulenol | 1575 | 1578 | 72203-24-8 | MS, KI | 0.09 | 0.015 |
76 | Viridiflorol | 1588 | 1594 | 19078-39-8 | S, MS, KI | 0.19 | 0.088 |
77 | Caryophyllene oxide | 1594 | 1587 | 1139-30-6 | S, MS, KI | 1.004 | 1.125 |
78 | Fokienol | 1597 | 1596 | 33440-00-5 | MS, KI | 0.166 | 0.012 |
79 | Guaiol | 1603 | 1603 | 13822-35-0 | MS, KI | 0.196 | 0.075 |
80 | Humulene epoxide II | 1613 | 1613 | 19888-34-7 | MS, KI | 0.143 | 0.084 |
81 | allo-Aromandendrene epoxide | 1646 | 1644 | 85760-81-2 | MS, KI | 0.208 | 0.073 |
82 | Agarospirol | 1656 | 1646 | 1460-73-7 | MS, KI | 0.086 | 0.002 |
83 | Allo-himachalol | 1660 | 1664 | 19435-77-9 | MS, KI | 0.101 | 0.104 |
84 | epi-α-Bisabolol | 1676 | 1679 | 23178-88-3 | MS, KI | 0.193 | 0.017 |
85 | Mayurone | 1706 | 1711 | 4677-90-1 | MS, KI | 0.207 | 0.027 |
86 | 1,10-Dihydronootkatone | 1753 | 1751 | 20489-53-6 | MS, KI | 0.063 | 0.017 |
87 | m-Camphorene | 1956 | 1946 | 20016-73-3 | MS, KI | 0.291 | 0.888 |
88 | p-Camphorene | 1987 | 1984 | 20016-72-2 | MS, KI | 0.135 | 0.496 |
89 | Geranyllinalool | 2031 | 2034 | 1113-21-9 | MS, KI | 0.07 | 0.01 |
90 | Cannabidiol | 2438 | 2441 | 13956-29-1 | MS, KI, S | tr | 0.03 |
Parameters | Treatments a | SEM | p-Value | |||||
---|---|---|---|---|---|---|---|---|
Con | Mon | C. sativa 50 | C. indica 50 | C. sativa 100 | C. indica 100 | |||
pH | ||||||||
6 h | 6.69 | 6.69 | 6.72 | 6.71 | 6.70 | 6.77 | 0. 011 | 0.235 |
24 h | 6.61 | 6.63 | 6.63 | 6.63 | 6.62 | 6.67 | 0.007 | 0.319 |
Total VFAs | ||||||||
6 h | 75.24A | 75.38A | 79.94B | 70.60C | 70.87C | 83.88C | 0.021 | 0.001 |
24 h | 83.39A | 85.77A | 93.20B | 88.08B | 93.99A | 67.12B | 0.106 | 0.001 |
Acetate | ||||||||
6 h | 52.11 A | 50.81 A | 58.30 B | 54.03 B | 51.55 AB | 60.12 B | 0.085 | 0.001 |
24 h | 59.48 A | 58.66 A | 69.06 B | 62.14 A | 67.89 B | 48.08 A | 0.169 | 0.001 |
Propionate | ||||||||
6 h | 20.83 A | 22.26 A | 19.34 AC | 14.27 B | 17.02 BC | 21.46 A | 0.073 | 0.001 |
24 h | 14.66 | 16.78 | 14.10 | 15.01 | 14.97 | 14.62 | 0.033 | 0.283 |
Butyrate | ||||||||
6 h | 17.97 A | 15.07 BC | 13.71 BC | 13.46 BC | 16.17 C | 15.24 BC | 0.039 | 0.001 |
24 h | 27.90 | 23.68 | 28.62 | 26.32 | 28.57 | 28.90 | 0.033 | 0.310 |
Acetate to propionate ratio | ||||||||
6 h | 2.54 AC | 2.28 A | 3.01 B | 3.79 B | 3.03 B | 2.80 BC | 0.118 | 0.001 |
24 h | 4.11 A | 3.54 A | 4.90 B | 4.14 A | 4.54 B | 3.29 A | 0.147 | 0.001 |
Fermentation efficiency, % | ||||||||
6 h | 76.45 A | 76.86 A | 74.95 B | 73.65 BC | 75.14 B | 75.43 B | 0.264 | 0.001 |
24 h | 80.63 | 79.39 | 81.00 | 80.33 | 80.39 | 80.43 | 0.246 | 0.189 |
NGR | ||||||||
6 h | 4.59 A | 4.97 A | 5.72 B | 5.50 A | 4.82 A | 5.49 B | 0.095 | 0.001 |
24 h | 5.63 | 5.16 | 6.38 | 5.72 | 6.08 | 4.93 | 0.223 | 0.041 |
Methane, mL·L–1 | ||||||||
6 h | 32.41 A | 24.96 B | 28.25 A | 29.28 A | 39.50 A | 23.44 B | 2.362 | 0.052 |
24 h | 40.70 A | 29.80 B | 58.79 BC | 46.90 A | 55.43 B | 56.30 B | 2.624 | 0.001 |
Lactate, mmol·L–1 | ||||||||
24 h | 7.62 | 6.18 | 6.72 | 6.75 | 6.89 | 6.81 | 0.382 | 0.127 |
Bacterial Strain | Primer Sequence for (5′-3′) | Primer Sequence Revers (5′-3′) | Reference |
---|---|---|---|
Lactobacillus spp. | CTCAAAACTAAACAAAGTTTC | CTTGTACACACCGCCCGTCA | [75] |
Streptococcus bovis | TTCCTAGAGATAGGAAGTTTCTTCGG | ATGATGGCAACTAACAATAGGGGT | [76] |
Butyrivibrio fibrisolvens | TAACATGAGTTTGATCCTGGCTC | CGTTACTCACCCGTCCGC | [77] |
Bacteria general 1 | GGATTAGATACCCTGGTAGT | CACGACACGAGCTGACG | [78] |
Bacteria general 2 | GTGSTGCAYGGYTGTCGTCA | ACGTCRTCCMCACCTTCCTC | [79] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tabiś, A.; Szumny, A.; Bania, J.; Pacyga, K.; Lewandowska, K.; Kupczyński, R. Comparison of the Effects of Essential Oils from Cannabis sativa and Cannabis indica on Selected Bacteria, Rumen Fermentation, and Methane Production—In Vitro Study. Int. J. Mol. Sci. 2024, 25, 5861. https://doi.org/10.3390/ijms25115861
Tabiś A, Szumny A, Bania J, Pacyga K, Lewandowska K, Kupczyński R. Comparison of the Effects of Essential Oils from Cannabis sativa and Cannabis indica on Selected Bacteria, Rumen Fermentation, and Methane Production—In Vitro Study. International Journal of Molecular Sciences. 2024; 25(11):5861. https://doi.org/10.3390/ijms25115861
Chicago/Turabian StyleTabiś, Aleksandra, Antoni Szumny, Jacek Bania, Katarzyna Pacyga, Kamila Lewandowska, and Robert Kupczyński. 2024. "Comparison of the Effects of Essential Oils from Cannabis sativa and Cannabis indica on Selected Bacteria, Rumen Fermentation, and Methane Production—In Vitro Study" International Journal of Molecular Sciences 25, no. 11: 5861. https://doi.org/10.3390/ijms25115861