Regulation and Response Mechanism of Acute Low-Salinity Stress during Larval Stages in Macrobrachium rosenbergii Based on Multi-Omics Analysis
Abstract
:1. Introduction
2. Results
2.1. Changes in Biochemical Parameters
2.2. Transcriptome Analysis of Differentially Expressed Genes (DEGs)
2.3. Expression Validation of Selected DEGs
2.4. Proteomic Analysis
2.5. Metabolome Analysis
2.6. Multi-Omics Correlation Analysis
3. Discussion
4. Materials and Methods
4.1. Animals and Experiments Design
4.2. Biochemical Parameters Measurement
4.3. RNA-Seq Library and Data Analysis
4.4. Detection of Differentially Enriched Genes by qRT-PCR
4.5. Proteome Sequencing and Analysis
4.6. Metabolomics
4.7. Statiscical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhang, H.Y.; Hou, J.L.; Liu, H.J.; Zhu, H.Y.; Xu, G.C.; Xu, J. Adaptive evolution of low-salinity tolerance and hypoosmotic regulation in a euryhaline teleost, Takifugu obscurus. Mar. Biol. 2020, 167, 90. [Google Scholar] [CrossRef]
- Norstog, J.L.; McCormick, S.D.; Kelly, J.T. Metabolic costs associated with seawater acclimation in a euryhaline teleost, the fourspine stickleback (Apeltes quadracus). Comp. Biochem. Phys. B 2022, 262, 110780. [Google Scholar] [CrossRef] [PubMed]
- Srisuk, C.; Choolert, C.; Bendena, W.G.; Longyant, S.; Sithigorngul, P.; Chaivisuthangkura, P. Molecular isolation and expression analysis of hemocyanin isoform 2 of Macrobrachium rosenbergii. J. Aquat. Anim. Health 2022, 34, 208–220. [Google Scholar] [CrossRef] [PubMed]
- Ying, N.; Wang, Y.; Song, X.; Qin, B.; Wu, Y.; Yang, L.; Fang, W. Transcriptome analysis of Macrobrachium rosenbergii: Identification of precocious puberty and slow-growing information. J. Invertebr. Pathol. 2022, 190, 107752. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Li, H.; Wei, J.; Hong, K.; Zhou, Q.; Liu, X.; Hong, X.; Li, W.; Liu, C.; Zhu, X.; et al. Multi-effects of acute salinity stress on osmoregulation, physiological metabolism, antioxidant capacity, immunity, and apoptosis in Macrobrachium rosenbergii. Antioxidants 2023, 12, 1836. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Wei, J.; Hong, K.; Zhou, N.; Liu, X.; Hong, X.; Li, W.; Zhao, J.; Chen, C.; Wu, L.; et al. Transcriptome analysis reveals the molecular response to salinity challenge in larvae of the giant freshwater prawn Macrobrachium rosenbergii. Front. Physiol. 2022, 13, 885035. [Google Scholar] [CrossRef]
- Wilder, M.N.; Do, T.T.; Atmomarsono, M.; Tran, T.T.; Truong, Q.P.; Yang, W.J. Characterization of Na/K-ATPase in Macrobrachium rosenbergii and the effects of changing salinity on enzymatic activity. Comp. Biochem. Phys. A 2000, 125, 377–388. [Google Scholar] [CrossRef]
- Intanai, I.; Taylor, E.W.; Whiteley, N.M. Effects of salinity on rates of protein synthesis and oxygen uptake in the post-larvae and juveniles of the tropical prawn Macrobrachium rosenbergii (de Man). Comp. Biochem. Phys. A 2009, 152, 372–378. [Google Scholar] [CrossRef]
- Kasan, N.A.; Ikhwanuddin, M.; Manan, H.; Zakaria, N.S.; Kamaruzzan, A.S.; Rahim, A.I.A.; Ishak, A.N. Assessment on water quality parameter and nutrients level of nyatuh river in relations with Macrobrachium Rosenbergii prawn populations. Trop. Life Sci. Res. 2023, 34, 51–66. [Google Scholar]
- Barman, H.K.; Patra, S.K.; Das, V.; Mohapatra, S.D.; Jayasankar, P.; Mohapatra, C.; Mohanta, R.; Panda, R.P.; Rath, S.N. Identification and characterization of differentially expressed transcripts in the gills of freshwater prawn (Macrobrachium rosenbergii) under salt stress. Sci. World J. 2012, 2012, 149361. [Google Scholar] [CrossRef]
- Fabri, L.M.; Moraes, C.M.; Costa, M.I.C.; Garçon, D.P.; Fontes, C.F.L.; Pinto, M.R.; McNamara, J.C.; Leone, F.A. Salinity-dependent modulation by protein kinases and the FXYD2 peptide of gill (Na+, K+)-ATPase activity in the freshwater shrimp Macrobrachium amazonicum (Decapoda, Palaemonidae). BBA-Biomembr. 2022, 1864, 183982. [Google Scholar] [CrossRef]
- Knysh, K.M.; Courtenay, S.C.; Grove, C.M.; van den Heuvel, M.R. The differential effects of salinity level on chlorpyrifos and imidacloprid toxicity to an estuarine amphipod. Bull. Environ. Contam. Toxicol. 2021, 106, 753–758. [Google Scholar] [CrossRef] [PubMed]
- Athamena, A.; Brichon, G.; Trajkovic-Bodennec, S.; Péqueux, A.; Chapelle, S.; Bodennec, J.; Zwingelstein, G. Salinity regulates N-methylation of phosphatidylethanolamine in euryhaline crustaceans hepatopancreas and exchange of newly-formed phosphatidylcholine with hemolymph. J. Comp. Physiol. B 2011, 181, 731–740. [Google Scholar] [CrossRef]
- Mabidi, A.; Bird, M.S.; Perissinotto, R. Increasing salinity drastically reduces hatching success of crustaceans from depression wetlands of the semi-arid Eastern Cape Karoo region, South Africa. Sci. Rep. 2018, 8, 5983. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Chen, J.; Shen, Y.; Bi, Y.; Hou, W.; Pan, G.; Wu, X. Transcriptional responses to low-salinity stress in the gills of adult female Portunus trituberculatus. Comp. Biochem. Phys. D 2019, 29, 86–94. [Google Scholar] [CrossRef] [PubMed]
- Derby, A.P.; Huff Hartz, K.E.; Fuller, N.W.; Landrum, P.F.; Reeve, J.D.; Poynton, H.C.; Connon, R.E.; Lydy, M.J. Effects of temperature and salinity on bioconcentration and toxicokinetics of permethrin in pyrethroid-resistant Hyalella azteca. Chemosphere 2022, 299, 134393. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Q.; Pan, L.; Ren, Q.; Wang, L.; Miao, J. Effect of salinity on regulation mechanism of neuroendocrine-immunoregulatory network in Litopenaeus vannamei. Fish. Shellfish. Immunol. 2016, 49, 396–406. [Google Scholar] [CrossRef]
- Kim, B.M.; Lee, Y.; Hwang, J.Y.; Kim, Y.K.; Kim, T.W.; Kim, I.N.; Kang, S.; Kim, J.H.; Rhee, J.S. Physiological and molecular responses of the Antarctic harpacticoid copepod Tigriopus kingsejongensis to salinity fluctuations—A multigenerational study. Environ. Res. 2022, 204, 112075. [Google Scholar] [CrossRef] [PubMed]
- Brown, J.; Whiteley, N.M.; Bailey, A.M.; Graham, H.; Hop, H.; Rastrick, S.P.S. Contrasting responses to salinity and future ocean acidification in arctic populations of the amphipod Gammarus setosus. Mar. Environ. Res. 2020, 162, 105176. [Google Scholar] [CrossRef]
- Nikapitiya, C.; Kim, W.S.; Park, K.; Kim, J.; Lee, M.; Kwak, I. Chitinase gene responses and tissue sensitivity in an intertidal mud crab (Macrophthalmus japonicus) following low or high salinity stress. Cell Stress. Chaperon. 2015, 20, 517–526. [Google Scholar] [CrossRef]
- Ikerd, J.L.; Burnett, K.G.; Burnett, L.E. Effects of salinity on the accumulation of hemocyte aggregates and bacteria in the gills of Callinectes sapidus, the Atlantic blue crab, injected with Vibrio campbellii. Comp. Biochem. Phys. A 2015, 183, 97–106. [Google Scholar] [CrossRef] [PubMed]
- Kreitmaier, P.; Katsoula, G.; Zeggini, E. Insights from multi-omics integration in complex disease primary tissues. Trends Genet. 2023, 39, 46–58. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Zhao, Q.; Wang, X.; Zhou, H.; Hu, J.; Gu, L.; Hu, Y.; Zeng, F.; Zhao, F.; Yue, C.; et al. Pathogenesis, multi-omics research, and clinical treatment of psoriasis. J. Autoimmun. 2022, 133, 102916. [Google Scholar] [CrossRef] [PubMed]
- Chong, D.; Jones, N.C.; Schittenhelm, R.B.; Anderson, A.; Casillas-Espinosa, P.M. Multi-omics integration and epilepsy: Towards a better understanding of biological mechanisms. Prog. Neurobiol. 2023, 227, 102480. [Google Scholar] [CrossRef] [PubMed]
- Orth, M.F.; Surdez, D.; Faehling, T.; Ehlers, A.C.; Marchetto, A.; Grossetête, S.; Volckmann, R.; Zwijnenburg, D.A.; Gerke, J.S.; Zaidi, S.; et al. Systematic multi-omics cell line profiling uncovers principles of Ewing sarcoma fusion oncogene-mediated gene regulation. Cell Rep. 2022, 41, 111761. [Google Scholar] [CrossRef] [PubMed]
- Liew, H.J.; Rahmah, S.; Tang, P.W.; Waiho, K.; Fazhan, H.; Rasdi, N.W.; Hamin, S.I.A.; Mazelan, S.; Muda, S.; Lim, L.S.; et al. Low water pH depressed growth and early development of giant freshwater prawn Macrobrachium rosenbergii larvae. Heliyon 2022, 8, e09989. [Google Scholar] [CrossRef] [PubMed]
- Colakoglu, H.E.; Yazlik, M.O.; Kaya, U.; Colakoglu, E.C.; Kurt, S.; Oz, B.; Bayramoglu, R.; Vural, M.R.; Kuplulu, S. MDA and GSH-Px activity in transition dairy cows under seasonal variations and their relationship with reproductive performance. J. Vet. Res. 2017, 61, 497–502. [Google Scholar] [CrossRef] [PubMed]
- Jacobson, G.A.; Ives, S.J.; Narkowicz, C.; Jones, G. Plasma glutathione peroxidase (GSH-Px) concentration is elevated in rheumatoid arthritis: A case-control study. Clin. Rheumatol. 2012, 31, 1543–1547. [Google Scholar] [CrossRef] [PubMed]
- Qin, F.; Pan, X.; Yang, J.; Li, S.; Shao, L.; Zhang, X.; Liu, B.; Li, J. Dietary Iodine Affected the GSH-Px to regulate the thyroid hormones in thyroid gland of rex rabbits. Biol. Trace Elem. Res. 2018, 181, 251–257. [Google Scholar] [CrossRef]
- Seymen, O.; Seven, A.; Candan, G.; Yigit, G.; Hatemi, S.; Hatemi, H. The effect of iron supplementation on GSH levels, GSH-Px, and SOD activities of erythrocytes in L-thyroxine administration. Acta Med. Okayama 1997, 51, 129–133. [Google Scholar]
- Yang, J.R.; Fu, Z.Y.; Yu, G.; Ma, Z.H.; Wang, X.M. Combined Effects of Temperature and Salinity on Antioxidants in the Immune System of the Pearl Oyster Pinctada fucata. Fishes 2022, 7, 260. [Google Scholar] [CrossRef]
- Miao, L.; St Clair, D.K. Regulation of superoxide dismutase genes: Implications in disease. Free Radic. Biol. Med. 2009, 47, 344–356. [Google Scholar] [CrossRef]
- Omar, B.A.; Flores, S.C.; McCord, J.M. Superoxide dismutase: Pharmacological developments and applications. Adv. Pharmacol. 1992, 23, 109–161. [Google Scholar] [PubMed]
- Zweier, J.L.; Hemann, C.; Kundu, T.; Ewees, M.G.; Khaleel, S.A.; Samouilov, A.; Ilangovan, G.; El-Mahdy, M.A. Cytoglobin has potent superoxide dismutase function. Proc. Natl. Acad. Sci. USA 2021, 118, e2105053118. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.; Zhou, Y.; Zhu, X.; Tang, H.; Zhang, X. Enterobacter cloacae: A probable etiological agent associated with slow growth in the giant freshwater prawn Macrobrachium rosenbergii. Aquaculture 2020, 530, 735826. [Google Scholar] [CrossRef]
- Lu, X.; Zhang, Z.; Yuan, D.; Zhou, Y.; Cao, J.; Zhang, H.; da Silva Vaz, I.; Zhou, J. The ecdysteroid receptor regulates salivary gland degeneration through apoptosis in Rhipicephalus haemaphysaloides. Parasit. Vectors 2021, 14, 612. [Google Scholar] [CrossRef] [PubMed]
- Nakatsuji, T.; Lee, C.Y.; Watson, R.D. Crustacean molt-inhibiting hormone: Structure, function, and cellular mode of action. Comp. Biochem. Phys. A 2009, 152, 139–148. [Google Scholar] [CrossRef] [PubMed]
- Pitts, N.L.; Mykles, D.L. Localization and expression of molt-inhibiting hormone and nitric oxide synthase in the central nervous system of the green shore crab, Carcinus maenas, and the blackback land crab, Gecarcinus lateralis. Comp. Biochem. Phys. A 2017, 203, 328–340. [Google Scholar] [CrossRef] [PubMed]
- Das, S.; Durica, D.S. Ecdysteroid receptor signaling disruption obstructs blastemal cell proliferation during limb regeneration in the fiddler crab, Uca pugilator. Mol. Cell Endocrinol. 2013, 365, 249–259. [Google Scholar] [CrossRef]
- Tarrant, A.M.; Behrendt, L.; Stegeman, J.J.; Verslycke, T. Ecdysteroid receptor from the American lobster Homarus americanus: EcR/RXR isoform cloning and ligand-binding properties. Gen. Comp. Endocrinol. 2011, 173, 346–355. [Google Scholar] [CrossRef]
- Liu, Z.; Huang, Z.; Zheng, X.; Zheng, Z.; Yao, D.; Zhang, Y.; Aweya, J.J. The juvenile hormone epoxide hydrolase homolog in Penaeus vannamei plays immune-related functions. Dev. Comp. Immunol. 2022, 132, 104410. [Google Scholar] [CrossRef] [PubMed]
- Jeon, M.J.; Yoo, J.W.; Lee, K.W.; Won, E.J.; Lee, Y.M. Microplastics disrupt energy metabolism in the brackish water flea Diaphanosoma celebensis. Comp. Biochem. Phys. C 2023, 271, 109680. [Google Scholar] [CrossRef] [PubMed]
- Sainath, S.B.; Swetha, C.H.; Reddy, P.S. What do we (need to) know about the melatonin in crustaceans? J. Exp. Zool. A Ecol. Genet. Physiol. 2013, 319, 365–377. [Google Scholar] [CrossRef] [PubMed]
- Dal Pont, G.; Po, B.; Wang, J.; Wood, C.M. How the green crab Carcinus maenas copes physiologically with a range of salinities. J. Comp. Physiol. B 2022, 192, 683–699. [Google Scholar] [CrossRef] [PubMed]
- Forward, R.B. Larval biology of the crab Rhithropanopeus harrisii (Gould): A synthesis. Biol. Bull. 2009, 216, 243–256. [Google Scholar] [CrossRef] [PubMed]
- Kuo, H.W.; Chang, C.C.; Cheng, W. Tyramine’s modulation of immune resistance functions in Litopenaeus vannamei and its signal pathway. Dev. Comp. Immunol. 2019, 95, 68–76. [Google Scholar] [CrossRef]
- Martinez, G.P.; Zabaleta, M.E.; Di Giulio, C.; Charris, J.E.; Mijares, M.R. The Role of Chloroquine and Hydroxychloroquine in Immune Regulation and Diseases. Curr. Pharm. Des. 2020, 26, 4467–4485. [Google Scholar] [CrossRef] [PubMed]
- Senylimaz-Tiebe, D.; Pfaff, D.H.; Virtue, S.; Schwarz, K.V.; Fleming, T.; Altamura, S.; Muckenthaler, M.U.; Okun, J.G.; Vidal-Puig, A.; Nawroth, P.; et al. Dietary stearic acid regulates mitochondria in vivo in humans. Nat. Commun. 2018, 9, 3129. [Google Scholar] [CrossRef] [PubMed]
- Yalameha, B.; Nejabati, H.R.; Nouri, M. Cardioprotective potential of vanillic acid. Clin. Exp. Pharmacol. Phys. 2022, 50, 193–204. [Google Scholar] [CrossRef]
- Wang, J.; Liu, Q.; Zhang, X.; Gao, G.; Niu, M.; Wang, H.; Chen, L.; Wang, C.; Mu, C.; Wang, F. Metabolic Response in the Gill of Portunus trituberculatus Under Short-Term Low Salinity Stress Based on GC-MS Technique. Front. Mar. Sci. 2022, 9, 881016. [Google Scholar] [CrossRef]
- Zhan, F.; Zhou, S.; Shi, F.; Li, Q.; Lin, L.; Qin, Z. Transcriptome analysis of Macrobrachium rosenbergii hemocytes in response to Staphylococcus aureus infection. Fish. Shellfish. Immunol. 2023, 139, 108927. [Google Scholar] [CrossRef] [PubMed]
- Qiao, R.; Sheng, C.; Lu, Y.; Zhang, Y.; Ren, H.; Lemos, B. Microplastics induce intestinal inflammation, oxidative stress, and disorders of metabolome and microbiome in zebrafish. Sci. Total Environ. 2019, 662, 246–253. [Google Scholar] [CrossRef] [PubMed]
- Pang, Z.; Chong, J.; Zhou, G.; de Lima Morais, D.A.; Chang, L.; Barrette, M.; Gauthier, C.; Jacques, P.É.; Li, S.; Xia, J. MetaboAnalyst 5.0: Narrowing the gap between raw spectra and functional insights. Nucleic Acids Res. 2021, 49, W388–W396. [Google Scholar] [CrossRef] [PubMed]
- Reimer, N.; Ulrich, H.; Busch, H.; Kock-Schoppenhauer, A.K.; Ingenerf, J. openEHR Mapper—A tool to fuse clinical and genomic data using the openEHR standard. Stud. Health Technol. Inform. 2021, 278, 86–93. [Google Scholar]
Gene | Primers |
---|---|
β-actin | F: CGACGGTCAGGTCATCACCA |
R: ACGTCGCACTTCATGATGGA | |
MIH | F: CCAGACAACGCAAGGGATCT |
R: TCGTCGCATACCCTGACAAC | |
RXR | F: GCGAGAAGCGGTCCAGGAGG |
R: GGTGGGGTCTGAGTTGAGTTCTGC | |
JHEH | F: CTTCCTGAGAGCAAGTGCCAAA |
R: AGGCTTCGTCAACAATGGCAAA | |
EcR | F: AAGAGCCGCATAAAGTGGAGAAGC |
R: AGGTCGGTCAGGATGTTCAGGAG | |
Caspase3 | F: CGGATTCAAACGCGATGACC |
R: GACGACAACGTGGTCTGACT | |
Caspase8 | F: GCGAAAGAACTACTCGGCCG |
R: AGCAGCAGCCAGGAACTTGT | |
Cyt-c | F: TGGGTGACGTAGAAAAGGGC |
R: TGCCTTGTTAGCGTCAGTGT | |
P53 | F: CCCTCGTCATCAGTTGCCAG |
R: TGAAGGAGTTGCTGGGGTTAC | |
NF-κB | F: AGATGCCGAGGAGGTATGGA |
R: GCGTCGTTGAAATGCGATGT | |
Bok | F: TCAGTACTTCAAATGCTAGTGCTG |
R: CGTCATAAACCGTCCCTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Xu, B.; Shen, P.; Cheng, H.; Fan, Y.; Gao, Q. Regulation and Response Mechanism of Acute Low-Salinity Stress during Larval Stages in Macrobrachium rosenbergii Based on Multi-Omics Analysis. Int. J. Mol. Sci. 2024, 25, 6809. https://doi.org/10.3390/ijms25126809
Li X, Xu B, Shen P, Cheng H, Fan Y, Gao Q. Regulation and Response Mechanism of Acute Low-Salinity Stress during Larval Stages in Macrobrachium rosenbergii Based on Multi-Omics Analysis. International Journal of Molecular Sciences. 2024; 25(12):6809. https://doi.org/10.3390/ijms25126809
Chicago/Turabian StyleLi, Xilian, Binpeng Xu, Peijing Shen, Haihua Cheng, Yunpeng Fan, and Qiang Gao. 2024. "Regulation and Response Mechanism of Acute Low-Salinity Stress during Larval Stages in Macrobrachium rosenbergii Based on Multi-Omics Analysis" International Journal of Molecular Sciences 25, no. 12: 6809. https://doi.org/10.3390/ijms25126809
APA StyleLi, X., Xu, B., Shen, P., Cheng, H., Fan, Y., & Gao, Q. (2024). Regulation and Response Mechanism of Acute Low-Salinity Stress during Larval Stages in Macrobrachium rosenbergii Based on Multi-Omics Analysis. International Journal of Molecular Sciences, 25(12), 6809. https://doi.org/10.3390/ijms25126809