Enhancing Therapeutic Approaches in Glioblastoma with Pro-Oxidant Treatments and Synergistic Combinations: In Vitro Experience of Doxorubicin and Photodynamic Therapy
Abstract
:1. Introduction
2. Results
2.1. The Impact of Pro-Oxidant Therapies on the Cellular Viability of GBM Cells as Monotherapies
2.2. The Impact of Pro-Oxidant Therapies on ROS Production in GBM Cells as Monotherapies
2.3. N-Acetylcysteine (NAC) Rescues Pro-Oxidant Cytotoxicity Induced by DOX and PDT Therapies
2.4. Synergistic Pro-Oxidant Combination of PDT and DOX Treatments
2.5. Reactive Oxidative Homeostasis Evaluation in GBM Cell Lines
2.6. Comprehensive Analysis of Oxidative Stress-Related Genes in Glioblastoma and Their Relationship with TP53 and PTEN Mutations
- TP53 WT—PTEN WT (n = 64): Patients with wild-type (WT) TP53 and PTEN genes.
- TP53 WT—PTEN mut (n = 30): Patients with WT TP53 and mutated (mut) PTEN genes.
- TP53 mut—PTEN WT (n = 31): Patients with mutated TP53 and WT PTEN genes.
- TP53 mut—PTEN mut (n = 20): Patients with mutated TP53 and PTEN genes.
3. Discussion
4. Materials and Methods
4.1. Cell Lines and Culture Conditions
4.2. Cell Uptake Analysis of DOX and Bioproduction of PpIX
4.3. Assessment of the Efficacy of DOX as a Single Treatment in GBM Cell Lines
4.4. Assessment of the Impact of TFD with Me-ALA on the Survival of GBM Cells
4.5. Reversal of Pro-Oxidant Cytotoxic Effects in Monotherapy with DOX and PDT through N-Acetylcysteine Intervention
4.6. Cytotoxicity Effect of Combination of Doxorubicin and PDT with Me-ALA
4.7. Determination of Synergy between Doxorubicin and PDT with Me-ALA
4.8. Evaluation of Intracellular Oxidative Stress after Mono and Combo Treatment
4.9. Gene Expression Analysis of Antioxidant Response in GBM Cell Lines
4.10. Expression Analysis of Cell Redox Homeostasis Genes in GBM Patient Samples
4.11. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Louis, D.N.; Perry, A.; Wesseling, P.; Brat, D.J.; Cree, I.A.; Figarella-Branger, D.; Hawkins, C.; Ng, H.K.; Pfister, S.M.; Reifenberger, G.; et al. The 2021 WHO Classification of Tumors of the Central Nervous System: A summary. Neuro. Oncol. 2021, 23, 1231–1251. [Google Scholar] [CrossRef] [PubMed]
- Ah-Pine, F.; Khettab, M.; Bedoui, Y.; Slama, Y.; Daniel, M.; Doray, B.; Gasque, P. On the origin and development of glioblastoma: Multifaceted role of perivascular mesenchymal stromal cells. Acta Neuropathol. Commun. 2023, 11, 104. [Google Scholar] [CrossRef] [PubMed]
- Oraiopoulou, M.E.; Tzamali, E.; Psycharakis, S.E.; Tzedakis, G.; Makatounakis, T.; Manolitsi, K.; Drakos, E.; Vakis, A.F.; Zacharakis, G.; Papamatheakis, J.; et al. The Temozolomide–Doxorubicin paradox in Glioblastoma in vitro–in silico preclinical drug-screening. Sci. Rep. 2024, 14, 3759. [Google Scholar] [CrossRef] [PubMed]
- Ostrowski, R.P.; Pucko, E.B. Harnessing oxidative stress for anti-glioma therapy. Neurochem. Int. 2022, 154, 105281. [Google Scholar] [CrossRef] [PubMed]
- Olivier, C.; Oliver, L.; Lalier, L.; Vallette, F.M. Drug Resistance in Glioblastoma: The Two Faces of Oxidative Stress. Front. Mol. Biosci. 2021, 7, 620677. [Google Scholar] [CrossRef] [PubMed]
- Salazar-Ramiro, A.; Ramírez-Ortega, D.; de La Cruz, V.P.; Hérnandez-Pedro, N.Y.; González-Esquivel, D.F.; Sotelo, J.; Pineda, B. Role of redox status in development of Glioblastoma. Front. Immunol. 2016, 7, 156. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.; Du, S.; Du, Y.; Ren, J.; Ying, G.; Yan, Z. Glutathione reductase mediates drug resistance in glioblastoma cells by regulating redox homeostasis. J. Neurochem. 2018, 144, 93–104. [Google Scholar] [CrossRef] [PubMed]
- Caverzán, M.D.; Beaugé, L.; Chesta, C.A.; Palacios, R.E.; Ibarra, L.E. Photodynamic therapy of Glioblastoma cells using doped conjugated polymer nanoparticles: An in vitro comparative study based on redox status. J. Photochem. Photobiol. B Biol. 2020, 212, 112045. [Google Scholar] [CrossRef] [PubMed]
- Dhungel, L.; Rowsey, M.E.; Harris, C.; Raucher, D. Synergistic Effects of Temozolomide and Doxorubicin in the Treatment of Glioblastoma Multiforme: Enhancing Efficacy through Combination Therapy. Molecules 2024, 29, 840. [Google Scholar] [CrossRef]
- Butt, O.H.; Zhou, A.Y.; Huang, J.; Leidig, W.A.; Silberstein, A.E.; Chheda, M.G.; Johanns, T.M.; Ansstas, G.; Liu, J.; Talcott, G.; et al. A phase II study of laser interstitial thermal therapy combined with doxorubicin in patients with recurrent glioblastoma. Neuro-Oncol. Adv. 2021, 3, vdab164. [Google Scholar] [CrossRef]
- Peter, S.; Alven, S.; Maseko, R.B.; Aderibigbe, B.A. Doxorubicin-Based Hybrid Compounds as Potential Anticancer Agents: A Review. Molecules 2022, 27, 4478. [Google Scholar] [CrossRef] [PubMed]
- Cappetta, D.; De Angelis, A.; Sapio, L.; Prezioso, L.; Illiano, M.; Quaini, F.; Rossi, F.; Berrino, L.; Naviglio, S.; Urbanek, K. Oxidative stress and cellular response to doxorubicin: A common factor in the complex milieu of anthracycline cardiotoxicity. Oxidative Med. Cell. Longev. 2017, 2017, 1521020. [Google Scholar] [CrossRef] [PubMed]
- Ibarra, L.E.; Camorani, S.; Agnello, L.; Pedone, E.; Pirone, L.; Chesta, C.A.; Palacios, R.E.; Fedele, M.; Cerchia, L. Selective Photo-Assisted Eradication of Triple-Negative Breast Cancer Cells through Aptamer Decoration of Doped Conjugated Polymer Nanoparticles. Pharmaceutics 2022, 14, 626. [Google Scholar] [CrossRef] [PubMed]
- Ibarra, L.E.; Vilchez, M.L.; Caverzán, M.D.; Milla Sanabria, L.N. Understanding the glioblastoma tumor biology to optimize photodynamic therapy: From molecular to cellular events. J. Neurosci. Res. 2021, 99, 1024–1047. [Google Scholar] [CrossRef] [PubMed]
- Bhanja, D.; Wilding, H.; Baroz, A.; Trifoi, M.; Shenoy, G.; Slagle-Webb, B.; Hayes, D.; Soudagar, Y.; Connor, J.; Mansouri, A. Photodynamic Therapy for Glioblastoma: Illuminating the Path toward Clinical Applicability. Cancers 2023, 15, 3427. [Google Scholar] [CrossRef] [PubMed]
- Akimoto, J.; Fukami, S.; Ichikawa, M.; Mohamed, A.; Kohno, M. Intraoperative photodiagnosis for malignant glioma using photosensitizer talaporfin sodium. Front. Surg. 2019, 6, 421595. [Google Scholar] [CrossRef] [PubMed]
- Songca, S.P. Combinations of Photodynamic Therapy with Other Minimally Invasive Therapeutic Technologies against Cancer and Microbial Infections. Int. J. Mol. Sci. 2023, 24, 10875. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Dube, C.; Gibert, M.; Cruickshanks, N.; Wang, B.; Coughlan, M.; Yang, Y.; Setiady, I.; Deveau, C.; Saoud, K.; et al. The p53 pathway in glioblastoma. Cancers 2018, 10, 297. [Google Scholar] [CrossRef]
- Alvarado-Ortiz, E.; de la Cruz-López, K.G.; Becerril-Rico, J.; Sarabia-Sánchez, M.A.; Ortiz-Sánchez, E.; García-Carrancá, A. Mutant p53 Gain-of-Function: Role in Cancer Development, Progression, and Therapeutic Approaches. Front. Cell Dev. Biol. 2021, 8, 607670. [Google Scholar] [CrossRef]
- Wang, W.; Cheng, B.; Miao, L.; Me, Y.; Wu, M. Mutant p53-R273H gains new function in sustained activation of EGFR signaling via suppressing miR-27a expression. Cell Death Dis. 2013, 4, e574. [Google Scholar] [CrossRef]
- Cordani, M.; Butera, G.; Pacchiana, R.; Masetto, F.; Mullappilly, N.; Riganti, C.; Donadelli, M. Mutant p53-Associated Molecular Mechanisms of ROS Regulation in Cancer Cells. Biomolecules 2020, 10, 361. [Google Scholar] [CrossRef] [PubMed]
- Lisek, K.; Campaner, E.; Ciani, Y.; Walerych, D.; Del Sal, G. Mutant p53 tunes the NRF2-dependent antioxidant response to support survival of cancer cells. Oncotarget 2018, 9, 20508–20523. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.S.; Duong, C.P.; Haupt, S.; Montgomery, K.G.; House, C.M.; Azar, W.J.; Pearson, H.B.; Fisher, O.M.; Read, M.; Guerra, G.R.; et al. Inhibiting the system xC−/glutathione axis selectively targets cancers with mutant-p53 accumulation. Nat. Commun. 2017, 8, 14844. [Google Scholar] [CrossRef]
- Achanta, G.; Huang, P. Role of p53 in Sensing Oxidative DNA Damage in Response to Reactive Oxygen Species-Generating Agents. Cancer Res. 2004, 64, 6233–6239. [Google Scholar] [CrossRef]
- Lamberti, M.J.; Morales Vasconsuelo, A.B.; Ferrara, M.G.; Rumie Vittar, N.B. Recapitulation of Hypoxic Tumor–stroma Microenvironment to Study Photodynamic Therapy Implications. Photochem. Photobiol. 2020, 96, 897–905. [Google Scholar] [CrossRef] [PubMed]
- Lou, L.; Zhou, S.; Tan, S.; Xiang, M.; Wang, W.; Yuan, C.; Gao, L.; Xiao, Q. Amplifying the efficacy of ALA-based prodrugs for photodynamic therapy using nanotechnology. Front. Pharmacol. 2023, 14, 1137707. [Google Scholar] [CrossRef]
- Hardiany, N.S.; Mulyawan, W.; Wanandi, S.I. Correlation between oxidative stress and tumor grade in glioma cells from patients in Jakarta. Med. J. Indones. 2012, 21, 122–127. [Google Scholar] [CrossRef]
- Faraji-Rad, M.; Khajavi, M.; Arjmand, M.H.; Shajari, E.; Alamdari, D.H. Pro-oxidant-antioxidant balance in patients with high grade glioblastoma multiform. Middle East J. Cancer 2015, 6, 79–83. [Google Scholar]
- Luo, S.; Lei, K.; Xiang, D.; Ye, K. NQO1 is regulated by PTEN in glioblastoma, mediating cell proliferation and oxidative stress. Oxidative Med. Cell. Longev. 2018, 2018, 9146528. [Google Scholar] [CrossRef]
- Lee, J.J.; Kim, B.C.; Park, M.J.; Lee, Y.S.; Kim, Y.N.; Lee, B.L.; Lee, J.S. PTEN status switches cell fate between premature senescence and apoptosis in glioma exposed to ionizing radiation. Cell Death Differ. 2010, 18, 666–677. [Google Scholar] [CrossRef]
- Bankoglu, E.E.; Tschopp, O.; Schmitt, J.; Burkard, P.; Jahn, D.; Geier, A.; Stopper, H. Role of PTEN in Oxidative Stress and DNA Damage in the Liver of Whole-Body Pten Haplodeficient Mice. PLoS ONE 2016, 11, e0166956. [Google Scholar] [CrossRef] [PubMed]
- Appenzeller-Herzog, C.; Riemer, J.; Christensen, B.; Sørensen, E.S.; Ellgaard, L. A novel disulphide switch mechanism in Ero1α balances ER oxidation in human cells. EMBO J. 2008, 27, 2977–2987. [Google Scholar] [CrossRef] [PubMed]
- Leone, A.; Roca, M.S.; Ciardiello, C.; Costantini, S.; Budillon, A. Oxidative Stress Gene Expression Profile Correlates with Cancer Patient Poor Prognosis: Identification of Crucial Pathways Might Select Novel Therapeutic Approaches. Oxidative Med. Cell. Longev. 2017, 2017, 2597581. [Google Scholar] [CrossRef] [PubMed]
- Xu, T.; Gao, P.; Huang, Y.; Wu, M.; Yi, J.; Zhou, Z.; Zhao, X.; Jiang, T.; Liu, H.; Qin, T.; et al. Git1-PGK1 interaction achieves self-protection against spinal cord ischemia-reperfusion injury by modulating Keap1/Nrf2 signaling. Redox Biol. 2023, 62, 102682. [Google Scholar] [CrossRef] [PubMed]
- Gorini, F.; Vassalle, C. Selenium and Selenoproteins at the Intersection of Type 2 Diabetes and Thyroid Pathophysiology. Antioxidants 2022, 11, 1188. [Google Scholar] [CrossRef] [PubMed]
- Rojo de la Vega, M.; Chapman, E.; Zhang, D.D. NRF2 and the Hallmarks of Cancer. Cancer Cell 2018, 34, 21–43. [Google Scholar] [CrossRef] [PubMed]
- Kawai, T.; Okochi, Y.; Ozaki, T.; Imura, Y.; Koizumi, S.; Yamazaki, M.; Abe, M.; Sakimura, K.; Yamashita, T.; Okamura, Y. Unconventional role of voltage-gated proton channels (VSOP/Hv1) in regulation of microglial ROS production. J. Neurochem. 2017, 142, 686–699. [Google Scholar] [CrossRef] [PubMed]
- Paulmurugan, R.; Afjei, R.; Sekar, T.V.; Babikir, H.A.; Massoud, T.F.; Paulmurugan, R.; Afjei, R.; Sekar, T.V.; Babikir, H.A.; Massoud, T.F. A protein folding molecular imaging biosensor monitors the effects of drugs that restore mutant p53 structure and its downstream function in glioblastoma cells. Oncotarget 2018, 9, 21495–21511. [Google Scholar] [CrossRef] [PubMed]
- Agrawal, K.; Asthana, S.; Kumar, D. Role of Oxidative Stress in Metabolic Reprogramming of Brain Cancer. Cancers 2023, 15, 4920. [Google Scholar] [CrossRef]
- Ramírez-Expósito, M.J.; Martínez-Martos, J.M. The Delicate Equilibrium between Oxidants and Antioxidants in Brain Glioma. Curr. Neuropharmacol. 2018, 17, 342–351. [Google Scholar] [CrossRef]
- Popa-Wagner, A.; Mitran, S.; Sivanesan, S.; Chang, E.; Buga, A.M. ROS and brain diseases: The good, the bad, and the ugly. Oxidative Med. Cell. Longev. 2013, 2013, 963520. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.J.; Seo, H.W.; Baek, J.H.; Lim, S.H.; Hwang, S.G.; Kim, E.H. Gene expression profiling of glioblastoma cell lines depending on TP53 status after tumor-treating fields (TTFields) treatment. Sci. Rep. 2020, 10, 12272. [Google Scholar] [CrossRef] [PubMed]
- Torrens-Mas, M.; Cordani, M.; Mullappilly, N.; Pacchiana, R.; Riganti, C.; Palmieri, M.; Pons, D.G.; Roca, P.; Oliver, J.; Donadelli, M. Mutant p53 induces SIRT3/MnSOD axis to moderate ROS production in melanoma cells. Arch. Biochem. Biophys. 2020, 679, 108219. [Google Scholar] [CrossRef] [PubMed]
- Wong, R.P.C.; Tsang, W.P.; Chau, P.Y.; Co, N.N.; Tsang, T.Y.; Kwok, T.T. p53-R273H gains new function in induction of drug resistance through down-regulation of procaspase-3. Mol. Cancer Ther. 2007, 6, 1054–1061. [Google Scholar] [CrossRef] [PubMed]
- Olafson, L.R.; Gunawardena, M.; Nixdorf, S.; McDonald, K.L.; Rapkins, R.W. The role of TP53 gain-of-function mutation in multifocal glioblastoma. J. Neurooncol. 2020, 147, 37–47. [Google Scholar] [CrossRef] [PubMed]
- Pedrote, M.M.; Motta, M.F.; Ferretti, G.D.S.; Norberto, D.R.; Spohr, T.C.L.S.; Lima, F.R.S.; Gratton, E.; Silva, J.L.; de Oliveira, G.A.P. Oncogenic Gain of Function in Glioblastoma Is Linked to Mutant p53 Amyloid Oligomers. iScience 2020, 23, 100820. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Chen, J.X.; Liu, J.P.; You, C.; Liu, Y.H.; Mao, Q. Gain of function of mutant TP53 in glioblastoma: Prognosis and response to temozolomide. Ann. Surg. Oncol. 2014, 21, 1337–1344. [Google Scholar] [CrossRef] [PubMed]
- Godoy, P.R.D.V.; Pour Khavari, A.; Rizzo, M.; Sakamoto-Hojo, E.T.; Haghdoost, S. Targeting NRF2, Regulator of Antioxidant System, to Sensitize Glioblastoma Neurosphere Cells to Radiation-Induced Oxidative Stress. Oxidative Med. Cell. Longev. 2020, 2020, 2534643. [Google Scholar] [CrossRef]
- Quach, S.; Schwartz, C.; Aumiller, M.; Foglar, M.; Schmutzer, M.; Katzendobler, S.; El Fahim, M.; Forbrig, R.; Bochmann, K.; Egensperger, R.; et al. Interstitial photodynamic therapy for newly diagnosed glioblastoma. J. Neurooncol. 2023, 162, 217–223. [Google Scholar] [CrossRef]
- von Achenbach, C.; Weller, M.; Szabo, E. Epidermal growth factor receptor and ligand family expression and activity in glioblastoma. J. Neurochem. 2018, 147, 99–109. [Google Scholar] [CrossRef]
- Carrasco-García, E.; Saceda, M.; Grasso, S.; Rocamora-Reverte, L.; Conde, M.; Gómez-Martínez, Á.; García-Morales, P.; Ferragut, J.A.; Martínez-Lacaci, I. Small tyrosine kinase inhibitors interrupt EGFR signaling by interacting with erbB3 and erbB4 in glioblastoma cell lines. Exp. Cell Res. 2011, 317, 1476–1489. [Google Scholar] [CrossRef] [PubMed]
- Lin, L.; Cai, J.; Tan, Z.; Meng, X.; Li, R.; Li, Y.; Jiang, C. Mutant IDH1 Enhances Temozolomide Sensitivity via Regulation of the ATM/CHK2 Pathway in Glioma. Cancer Res. Treat. 2021, 53, 367–377. [Google Scholar] [CrossRef]
- Zhang, X.; Guo, M.; Shen, L.; Hu, S. Combination of photodynamic therapy and temozolomide on glioma in a rat C6 glioma model. Photodiagnosis Photodyn. Ther. 2014, 11, 603–612. [Google Scholar] [CrossRef] [PubMed]
- Jiang, F.; Zhang, X.; Kalkanis, S.N.; Zhang, Z.G.; Yang, H.; Katakowski, M.; Hong, X.; Zheng, X.; Zhu, Z.; Chopp, M. Combination therapy with antiangiogenic treatment and photodynamic therapy for the nude mouse bearing U87 glioblastoma. Photochem. Photobiol. 2008, 84, 128–137. [Google Scholar] [CrossRef] [PubMed]
- Waris, G.; Ahsan, H. Reactive oxygen species: Role in the development of cancer and various chronic conditions. J. Carcinog. 2006, 5, 14. [Google Scholar] [CrossRef] [PubMed]
- Cordani, M.; Butera, G.; Dando, I.; Torrens-Mas, M.; Butturini, E.; Pacchiana, R.; Oppici, E.; Cavallini, C.; Gasperini, S.; Tamassia, N.; et al. Mutant p53 blocks SESN1/AMPK/PGC-1α/UCP2 axis increasing mitochondrial O2−· production in cancer cells. Br. J. Cancer 2018, 119, 994–1008. [Google Scholar] [CrossRef]
- Kitagishi, Y.; Matsuda, S. Redox regulation of tumor suppressor PTEN in cancer and aging (Review). Int. J. Mol. Med. 2013, 31, 511–515. [Google Scholar] [CrossRef] [PubMed]
- Ibarra, L.E.; Beaugé, L.; Arias-Ramos, N.; Rivarola, V.A.; Chesta, C.A.; López-Larrubia, P.; Palacios, R.E. Trojan horse monocyte-mediated delivery of conjugated polymer nanoparticles for improved photodynamic therapy of glioblastoma. Nanomedicine 2020, 15, 1687–1707. [Google Scholar] [CrossRef] [PubMed]
- Cerami, E.; Gao, J.; Dogrusoz, U.; Gross, B.E.; Sumer, S.O.; Aksoy, B.A.; Jacobsen, A.; Byrne, C.J.; Heuer, M.L.; Larsson, E.; et al. The cBio Cancer Genomics Portal: An Open Platform for Exploring Multidimensional Cancer Genomics Data. Cancer Discov. 2012, 2, 401–404. [Google Scholar] [CrossRef]
- Heberle, H.; Meirelles, V.G.; da Silva, F.R.; Telles, G.P.; Minghim, R. InteractiVenn: A web-based tool for the analysis of sets through Venn diagrams. BMC Bioinform. 2015, 16, 169. [Google Scholar] [CrossRef]
- Metsalu, T.; Vilo, J. ClustVis: A web tool for visualizing clustering of multivariate data using Principal Component Analysis and heatmap. Nucleic Acids Res. 2015, 43, W566–W570. [Google Scholar] [CrossRef] [PubMed]
Cell Line | DOX IC50 (µM) | PDT IC50 (mM of Me-ALA) | Resistance to Pro-Oxidant Therapies | Morphological Changes with DOX | Morphological Changes with PDT | ROS Levels with DOX | ROS Levels with PDT | Cellular Uptake of DOX | PpIX Production with Me-ALA | NAC Reversal of Cytotoxicity |
---|---|---|---|---|---|---|---|---|---|---|
U87MG | 0.14 ± 0.1 | 0.33 ± 0.05 | + | More alterations | More alterations | Higher | Highest | High | Highest | Significant at low conc. |
T98G | 0.5 ± 0.15 | 0.3 ± 0.1 | ++ | More alterations | More alterations | Lower | Higher | Intermediate | High | Partial at high conc. |
LN229 | 6.88 ± 0.6 | 0.8 ± 0.2 | +++ | Fewer alterations | Fewer alterations | Higher | Lower | High | High | Partial at high conc. |
Gene | Forward 5′-3′ | Reverse 3′-5′ | Product Length (bp) | NM |
---|---|---|---|---|
ACTB | ATTGCCGACAGGATGCAGAA | GCTGATCCACATCTGCTGGAA | 150 | NM_001101.5 |
GSR | TGGCACTTGCGTGAATGTTG | CACATAGGCATCCCGCTTTTC | 157 | NM_001195102.3 |
NFE2L2 | TCAGCGACGGAAAGAGTATGA | CCACTGGTTTCTGACTGGATGT | 174 | NM_006164.5 |
CAT | GGCGAGGCAGCTTGAGTTAA | CACCGCCTCGGCTTGTC | 331 | NM_001752.4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cesca, B.A.; Caverzan, M.D.; Lamberti, M.J.; Ibarra, L.E. Enhancing Therapeutic Approaches in Glioblastoma with Pro-Oxidant Treatments and Synergistic Combinations: In Vitro Experience of Doxorubicin and Photodynamic Therapy. Int. J. Mol. Sci. 2024, 25, 7525. https://doi.org/10.3390/ijms25147525
Cesca BA, Caverzan MD, Lamberti MJ, Ibarra LE. Enhancing Therapeutic Approaches in Glioblastoma with Pro-Oxidant Treatments and Synergistic Combinations: In Vitro Experience of Doxorubicin and Photodynamic Therapy. International Journal of Molecular Sciences. 2024; 25(14):7525. https://doi.org/10.3390/ijms25147525
Chicago/Turabian StyleCesca, Bruno Agustín, Matías Daniel Caverzan, María Julia Lamberti, and Luis Exequiel Ibarra. 2024. "Enhancing Therapeutic Approaches in Glioblastoma with Pro-Oxidant Treatments and Synergistic Combinations: In Vitro Experience of Doxorubicin and Photodynamic Therapy" International Journal of Molecular Sciences 25, no. 14: 7525. https://doi.org/10.3390/ijms25147525