Aspirin Stimulates the Osteogenic Differentiation of Human Adipose Tissue-Derived Stem Cells In Vitro
Abstract
:1. Introduction
2. Results
2.1. ASC Characterization
2.2. Mitochondrial Metabolic Activity of ASCs under Dose-Dependent ASA Exposure
2.3. ASC Morphology and Viability under Dose-Dependent ASA Exposure
2.4. ASC Proliferation under Dose-Dependent ASA Exposure
2.5. Histological Changes during Osteogenic Differentiation of ASCs under ASA Exposure
2.6. Gene Expression Changes during Osteogenic Differentiation of ASCs under ASA Exposure
3. Discussion
4. Materials and Methods
4.1. Donor Demographics and Ethics Statement
4.2. Cell Isolation and In Vitro Culture
4.3. Fluorescence Activated Cell Sorting (FACS)
4.4. Preparation of the ASA Stock Solution
4.5. AlamarBlue Viability Dye
4.6. Live/Dead Staining
4.7. DNA Quantification for Cell Proliferation Analysis
4.8. Osteogenic Differentiation and Quantification
4.9. RNA Isolation, cDNA Synthesis, and Quantitative Polymerase Chain Reaction
4.10. Statistical Evaluation and Data Illustration
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Panina, Y.A.; Yakimov, A.S.; Komleva, Y.K.; Morgun, A.V.; Lopatina, O.L.; Malinovskaya, N.A.; Shuvaev, A.N.; Salmin, V.V.; Taranushenko, T.E.; Salmina, A.B. Plasticity of Adipose Tissue-Derived Stem Cells and Regulation of Angiogenesis. Front. Physiol. 2018, 9, 1656. [Google Scholar] [CrossRef] [PubMed]
- Zuk, P.A. The Adipose-derived Stem Cell: Looking Back and Looking Ahead. Mol. Biol. Cell 2010, 21, 1783–1787. [Google Scholar] [CrossRef] [PubMed]
- Zuk, P.A.; Zhu, M.; Ashjian, P.; De Ugarte, D.A.; Huang, J.I.; Mizuno, H.; Alfonso, Z.C.; Fraser, J.K.; Benhaim, P.; Hedrick, M.H. Human adipose tissue is a source of multipotent stem cells. Mol. Biol. Cell 2002, 13, 4279–4295. [Google Scholar] [CrossRef]
- Zuk, P.A.; Zhu, M.I.; Mizuno, H.; Huang, J.; Futrell, J.W.; Katz, A.J.; Benhaim, P.; Lorenz, H.P.; Hedrick, M.H. Multilineage cells from human adipose tissue: Implications for cell-based therapies. Tissue Eng. 2001, 7, 211–228. [Google Scholar] [CrossRef] [PubMed]
- Müller, A.M.; Mehrkens, A.; Schäfer, D.J.; Jaquiery, C.; Güven, S.İ.N.A.N.; Lehmicke, M.; Martinetti, R.; Farhadi, I.; Jakob, M.; Scherberich, A.; et al. Towards an intraoperative engineering of osteogenic and vasculogenic grafts from the stromal vascular fraction of human adipose tissue. Eur. Cells Mater. 2010, 19, 127–135. [Google Scholar] [CrossRef] [PubMed]
- Gattazzo, F.; Urciuolo, A.; Bonaldo, P. Extracellular matrix: A dynamic microenvironment for stem cell niche. Biochim. Biophys. Acta—Gen. Subj. 2014, 1840, 2506–2519. [Google Scholar] [CrossRef]
- Bodle, J.C.; Hanson, A.D.; Loboa, E.G. Adipose-derived stem cells in functional bone tissue engineering: Lessons from bone mechanobiology. Tissue Eng.—Part B Rev. 2011, 17, 195–211. [Google Scholar] [CrossRef]
- Pittenger, M.F.; Mackay, A.M.; Beck, S.C.; Jaiswal, R.K.; Douglas, R.; Mosca, J.D.; Moorman, M.A.; Simonetti, D.W.; Craig, S.; Marshak, D.R. Multilineage potential of adult human mesenchymal stem cells. Science 1999, 284, 143–147. [Google Scholar] [CrossRef] [PubMed]
- Knippenberg, M.; Helder, M.N.; Zandieh Doulabi, B.; Wuisman, P.I.J.M.; Klein-Nulend, J. Osteogenesis versus chondrogenesis by BMP-2 and BMP-7 in adipose stem cells. Biochem. Biophys. Res. Commun. 2006, 342, 902–908. [Google Scholar] [CrossRef]
- Li, Y.; Luo, Z.; Xu, X.; Li, Y.; Zhang, S.; Zhou, P.; Sui, Y.; Wu, M.; Luo, E.; Wei, S. Aspirin enhances the osteogenic and anti-inflammatory effects of human mesenchymal stem cells on osteogenic BFP-1 peptide-decorated substrates. J. Mater. Chem. B. 2017, 5, 7153–7163. [Google Scholar] [CrossRef]
- Abd Rahman, F. Gene expression profiling on effect of aspirin on osteogenic differentiation of periodontal ligament stem cells. BDJ Open 2021, 7, 35. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Ding, N.; Zhang, T.; Sun, Q.; Han, B.; Yu, T. A Tetra-PEG Hydrogel Based Aspirin Sustained Release System Exerts Beneficial Effects on Periodontal Ligament Stem Cells Mediated Bone Regeneration. Front. Chem. 2019, 7, 682. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Chen, C.; Liu, S.; Liu, D.; Xu, X.; Chen, X.; Shi, S. Acetylsalicylic acid treatment improves differentiation and immunomodulation of SHED. J. Dent. Res. 2015, 94, 209–218. [Google Scholar] [CrossRef] [PubMed]
- Vukovic, M.; Lazarevic, M.; Mitic, D.; Karisik, M.J.; Ilic, B.; Andric, M.; Jevtic, B.; Roganovic, J.; Milasin, J. Acetylsalicylic-acid (ASA) regulation of osteo/odontogenic differentiation and proliferation of human dental pulp stem cells (DPSCs) in vitro. Arch. Oral Biol. 2022, 144, 105564. [Google Scholar] [CrossRef]
- Yuan, M.; Zhan, Y.; Hu, W.; Li, Y.; Xie, X.; Miao, N.; Jin, H.; Zhang, B. Aspirin promotes osteogenic differentiation of human dental pulp stem cells. Int. J. Mol. Med. 2018, 42, 1967–1976. [Google Scholar] [CrossRef]
- Xie, Y.; Pan, M.; Gao, Y.; Zhang, L.; Ge, W.; Tang, P. Dose-dependent roles of aspirin and other non-steroidal anti-inflammatory drugs in abnormal bone remodeling and skeletal regeneration. Cell Biosci. 2019, 9, 103. [Google Scholar] [CrossRef] [PubMed]
- Yamaza, T.; Miura, Y.; Bi, Y.; Liu, Y.; Akiyama, K.; Sonoyama, W.; Patel, V.; Gutkind, S.; Young, M.; Gronthos, S.; et al. Pharmacologic stem cell based intervention as a new approach to osteoporosis treatment in rodents. PLoS ONE 2008, 3, e2615. [Google Scholar] [CrossRef]
- Zeng, Y.P.; Yang, C.; Li, Y.; Fan, Y.; Yang, H.J.; Liu, B.; Sang, H.X. Aspirin inhibits osteoclastogenesis by suppressing the activation of NF-κB and MAPKs in RANKL-induced RAW264.7 cells. Mol. Med. Rep. 2016, 14, 1957–1962. [Google Scholar] [CrossRef] [PubMed]
- Chin, K.Y. A Review on the Relationship between Aspirin and Bone Health. J. Osteoporos. 2017, 2017, 3710959. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Xiao, X.; Shi, Q.; Tang, X.; Tian, Y. Low dose aspirin associated with greater bone mineral density in older adults. Sci. Rep. 2022, 12, 14887. [Google Scholar] [CrossRef]
- Carbone, L.D.; Tylavsky, F.A.; Cauley, J.A.; Harris, T.B.; Lang, T.F.; Bauer, D.C.; Barrow, K.D.; Kritchevsky, S.B. Association between bone mineral density and the use of nonsteroidal anti-inflammatory drugs and aspirin: Impact of cyclooxygenase selectivity. J. Bone Miner. Res. 2003, 18, 1795–1802. [Google Scholar] [CrossRef]
- Bauer, D.C.; Orwoll, E.S.; Fox, K.M.; Vogt, T.M.; Lane, N.E.; Hochberg, M.C.; Stone, K.; Nevitt, M.C. Aspirin and NSAID use in older women: Effect on bone mineral density and fracture risk. Study of Osteoporotic Fractures Research Group. J. Bone Miner. Res. 1996, 11, 29–35. [Google Scholar] [CrossRef]
- Bunting, S.; Moncada, S.; Vane, J.R. The prostacyclin--thromboxane A2 balance: Pathophysiological and therapeutic implications. Br. Med. Bull. 1983, 39, 271–276. [Google Scholar] [CrossRef] [PubMed]
- Patrono, C. Aspirin. In Platelets; Elsevier: Amsterdam, The Netherlands, 2019; pp. 921–936. [Google Scholar]
- Patrignani, P.; Patrono, C. Aspirin, platelet inhibition and cancer prevention. Platelets 2018, 29, 779–785. [Google Scholar] [CrossRef]
- Patrono, C.; García Rodríguez, L.A.; Landolfi, R.; Baigent, C. Low-dose aspirin for the prevention of atherothrombosis. N. Engl. J. Med. 2005, 353, 2373–2383. [Google Scholar] [CrossRef]
- Rezabakhsh, A.; Mahmoodpoor, A.; Soleimanpour, M.; Shahsavarinia, K.; Soleimanpour, H. Clinical applications of aspirin as a multi-potent drug beyond cardiovascular implications: A proof of concept for anesthesiologists—A narrative review. Anesthesiol. Pain Med. 2021, 11, e118909. [Google Scholar] [CrossRef]
- Bourin, P.; Bunnell, B.A.; Casteilla, L.; Dominici, M.; Katz, A.J.; March, K.L.; Redl, H.; Rubin, J.P.; Yoshimura, K.; Gimble, J.M. Stromal cells from the adipose tissue-derived stromal vascular fraction and culture expanded adipose tissue-derived stromal/stem cells: A joint statement of the International Federation for Adipose Therapeutics and Science (IFATS) and the International So. Cytotherapy 2013, 15, 641–648. [Google Scholar] [CrossRef]
- Kuhlmann, C.; Schenck, T.L.; Tluczynski, K.; Aszodi, A.; Metzger, P.; Giunta, R.; Wiggenhauser, P.S. Experimental approach to nasal septal cartilage regeneration with adipose tissue-derived stem cells and decellularized porcine septal cartilage. Xenotransplantation 2020, 28, e12660. [Google Scholar] [CrossRef] [PubMed]
- Du, M.; Pan, W.; Duan, X.; Yang, P.; Ge, S. Lower dosage of aspirin promotes cell growth and osteogenic differentiation in murine bone marrow stromal cells. J. Dent. Sci. 2016, 11, 315–322. [Google Scholar] [CrossRef] [PubMed]
- Si, Z.; Wang, X.; Sun, C.; Kang, Y.; Xu, J.; Wang, X.; Hui, Y. Adipose-derived stem cells: Sources, potency, and implications for regenerative therapies. Biomed. Pharmacother. 2019, 114, 108765. [Google Scholar] [CrossRef] [PubMed]
- Strioga, M.; Viswanathan, S.; Darinskas, A.; Slaby, O.; Michalek, J. Same or not the same? comparison of adipose tissue-derived versus bone marrow-derived mesenchymal stem and stromal cells. Stem Cells Dev. 2012, 21, 2724–2752. [Google Scholar] [CrossRef] [PubMed]
- Trojahn Kølle, S.F.; Oliveri, R.S.; Glovinski, P.V.; Elberg, J.J.; Fischer-Nielsen, A.; Drzewiecki, K.T. Importance of mesenchymal stem cells in autologous fat grafting: A systematic review of existing studies. J. Plast. Surg. Hand Surg. 2012, 46, 59–68. [Google Scholar] [CrossRef] [PubMed]
- Sterodimas, A.; De Faria, J.; Nicaretta, B.; Papadopoulos, O.; Papalambros, E.; Illouz, Y.G. Cell-assisted lipotransfer. Aesthetic Surg. J. 2010, 30, 78–81. [Google Scholar] [CrossRef] [PubMed]
- Schelbergen, R.F.; Van Dalen, S.; Ter Huurne, M.; Roth, J.; Vogl, T.; Noel, D.; Jorgensen, C.; van den Berg, W.B.; van de Loo, F.A.; Blom, A.B.; et al. Treatment efficacy of adipose-derived stem cells in experimental osteoarthritis is driven by high synovial activation and reflected by S100A8/A9 serum levels. Osteoarthr. Cartil. 2014, 22, 1158–1166. [Google Scholar] [CrossRef] [PubMed]
- Kokai, L.E.; Marra, K.; Rubin, J.P. Adipose stem cells: Biology and clinical applications for tissue repair and regeneration. Transl. Res. 2014, 163, 399–408. [Google Scholar] [CrossRef] [PubMed]
- Sterodimas, A.; De Faria, J.; Nicaretta, B.; Pitanguy, I. Tissue engineering with adipose-derived stem cells (ADSCs): Current and future applications. J. Plast. Reconstr. Aesthetic. Surg. 2010, 63, 1886–1892. [Google Scholar] [CrossRef]
- Tevlin, R.; desJardins-Park, H.; Huber, J.; DiIorio, S.E.; Longaker, M.T.; Wan, D.C. Musculoskeletal tissue engineering: Adipose derived stromal cell implementation for the treatment of osteoarthritis. Biomaterials 2022, 286, 121544. [Google Scholar] [CrossRef] [PubMed]
- Zhan, Y.; He, Z.; Liu, X.; Miao, N.; Lin, F.; Xu, W.; Mu, S.; Mu, H.; Yuan, M.; Cao, X.; et al. Aspirin-induced attenuation of adipogenic differentiation of bone marrow mesenchymal stem cells is accompanied by the disturbed epigenetic modification. Int. J. Biochem. Cell Biol. 2018, 98, 29–42. [Google Scholar] [CrossRef] [PubMed]
- Hao, W.; Shi, S.; Zhou, S.; Wang, X.; Nie, S. Aspirin inhibits growth and enhances cardiomyocyte differentiation of bone marrow mesenchymal stem cells. Eur. J. Pharmacol. 2018, 827, 198–207. [Google Scholar] [CrossRef]
- Fattahi, R.; Mohebichamkhorami, F.; Khani, M.M.; Soleimani, M.; Hosseinzadeh, S. Aspirin effect on bone remodeling and skeletal regeneration: Review article. Tissue Cell 2022, 76, 101753. [Google Scholar] [CrossRef]
- Alfonso, L.; Ai, G.; Spitale, R.C.; Bhat, G.J. Molecular targets of aspirin and cancer prevention. Br. J. Cancer 2014, 111, 61–67. [Google Scholar] [CrossRef]
- Dovizio, M.; Bruno, A.; Tacconelli, S.; Patrignani, P. Mode of action of aspirin as a chemopreventive agent. In Prospects for Chemoprevention of Colorectal Neoplasia. Recent Results in Cancer Research; Springer: Berlin/Heidelberg, Germany, 2013; Volume 191, pp. 39–65. [Google Scholar]
- Drummond, A.H.; Macintyre, D.E.; Olverman, H.J.; Gordon, J.L. Aspirin At Therapeutic Concentrations Does Not Affect 5-Hydroxytryptamine Uptake By Platelets. Br. J. Pharmacol. 1977, 59, 661–662. [Google Scholar] [CrossRef]
- Jiang, Y.; Qin, H.; Wan, H.; Yang, J.; Yu, Q.; Jiang, M.; Yu, B. Asprin-loaded strontium-containing α-calcium sulphate hemihydrate/nano-hydroxyapatite composite promotes regeneration of critical bone defects. J. Cell. Mol. Med. 2020, 24, 13690–13702. [Google Scholar] [CrossRef]
- Komori, T. Regulation of Proliferation, Differentiation and Functions of Osteoblasts by Runx2. Int. J. Mol. Sci. 2019, 20, 1694. [Google Scholar] [CrossRef]
- Zhang, Y.; Khan, D.; Delling, J.; Tobiasch, E. Mechanisms underlying the osteo- and adipo-differentiation of human mesenchymal stem cells. Sci. World J. 2012, 2012, 793823. [Google Scholar] [CrossRef]
- Enomoto, H.; Furuichi, T.; Zanma, A.; Yamana, K.; Yoshida, C.; Sumitani, S.; Yamamoto, H.; Enomoto-Iwamoto, M.; Iwamoto, M.; Komori, T. Runx2 deficiency in chondrocytes causes adipogenic changes in vitro. J. Cell Sci. 2004, 117 Pt 3, 417–425. [Google Scholar] [CrossRef]
- Gomathi, K.; Akshaya, N.; Srinaath, N.; Moorthi, A.; Selvamurugan, N. Regulation of Runx2 by post-translational modifications in osteoblast differentiation. Life Sci. 2020, 245, 117389. [Google Scholar] [CrossRef]
- Simonsen, J.L.; Rosada, C.; Serakinci, N.; Justesen, J.; Stenderup, K.; Rattan, S.I.; Jensen, T.G.; Kassem, M. Telomerase expression extends the proliferative life-span and maintains the osteogenic potential of human bone marrow stromal cells. Nat. Biotechnol. 2002, 20, 592–596. [Google Scholar] [CrossRef]
- Li, Y.; Bai, Y.; Pan, J.; Wang, H.; Li, H.; Xu, X.; Fu, X.; Shi, R.; Luo, Z.; Li, Y.; et al. A hybrid 3D-printed aspirin-laden liposome composite scaffold for bone tissue engineering. J. Mater. Chem. B 2019, 7, 619–629. [Google Scholar] [CrossRef] [PubMed]
- Kuhlmann, C.; Schenck, T.L.; Aszodi, A.; Giunta, R.E.; Wiggenhauser, P.S. Zone-dependent architecture and biochemical composition of decellularized porcine nasal cartilage modulate the activity of adipose tissue-derived stem cells in cartilage regeneration. Int. J. Mol. Sci. 2021, 22, 9917. [Google Scholar] [CrossRef] [PubMed]
- Wiggenhauser, P.S.; Kuhlmann, C.; Blum, J.; Giunta, R.E.; Schenck, T. Influence of software parameters on measurements in automatized image-based analysis of fat tissue histology. Acta Histochem. 2020, 122, 151537. [Google Scholar] [CrossRef]
Antibody | Conjugate | Isotype | Manufacturer |
---|---|---|---|
CD44 | Pacific Blue | Mouse IgG1, k | BioLegend, USA |
CD29 | FITC | Mouse IgG, k | EBioScience (San Diego, CA, USA), Thermo Fisher Scientific, USA |
CD13 | BV711 | Mouse IgG, k | BioLegend, USA |
CD73 | AF700 | Rat IgG, k | BioLegend, USA |
CD90 | BV786 | Mouse IgG, k | BioLegend, USA |
CD105 | APC | Mouse IgG, k | BioLegend, USA |
CD31 | PE-Cy7 | Mouse IgG, k | BioLegend, USA |
CD45 | PerCP | Mouse IgG, k | BioLegend, USA |
CD235a | PE | Mouse IgG, k | BioLegend, USA |
Gene | Full Name | Forward Primer Sequence (5′ → 3′) | Reverse Primer Sequence (5′ → 3′) | Length | NCBI RefSeq |
---|---|---|---|---|---|
ALPL | Alkaline Phosphatase | CAAGCACTCCCACTTCATC | CGTCACGTTGTTCCTGTTC | 2536 bp | NM_000478 |
COL2A1 | Collagen type II alpha 1 chain | TCCATTCATCCCACCCTCTC | AGTTTCCTGCCTCTGCCTTG | 5059 bp | NM_001844.5 |
HPRT1 | Hypoxanthine phosphoribosyltransferase 1 | AGATGGTCAAGGTCGCAAG | AAGGGCATATCCTACAACAAAC | 1395 bp | NM_000194 |
MKI67 | Marker of proliferation Ki-67 | AATCACTAAAATGCCCTGCC | CTTCTTTCACACCTACTTTCCC | 11636 bp | NM_001145966 |
NANOG | Nanog homebox | TCTCTCCTCTTCCTTCCTCC | AGTTCTGGTCTTCTGTTTCTTG | 1395 bp | NM_024865.4 |
OCN/BGLAP | Bone gamma-carboxyglutamate protein | TCACACTCCTCGCCCTATTG | GTCTCTTCACTACCTCGCTG | 506 bp | NM_199173 |
OPN/SPP1 | Secreted phosphoprotein 1 | AAGTAAGTCCAACGAAAGCC | ACCAGTTCATCAGATTCATCAG | 1519 bp | NM_000582.3 |
OCT4/POU5F1 | POU domain, class 5, transcription factor 1 isoform 2 | AAAGAGAAAGCGAACCAGTATC | TACAGAACCACACTCGGAC | 1579 bp | NP_001167002.1 |
RUNX2 | RUNX Family transcription factor 2 | TCTCACTGCCTCTCACTTG | ACACACATCTCCTCCCTTC | 5474 bp | NM_001015051.4 |
SOX2 | SRY-box transcription factor 2 | GCTCGCAGACCTACATGAAC | GGAGGAAGAGGTAACCACAG | 2512 bp | NM_003106 |
SOX9 | SRY-box transcription factor 9 | AGTTTCTTTGTATTCCTCACCC | TCAAAACACACACACACCC | 3931 bp | NM_000346.4 |
Step | Cycles | Profile | Temperature | Retention Time | Goto | Loops |
---|---|---|---|---|---|---|
1 | 1 | Initial denaturation | 95 °C | 02:00 | 0 | 0 |
2 | 40× | Denaturation | 95 °C | 00:30 | 0 | 0 |
3 | Annealing | 60 °C | 01:00 | 0 | 0 | |
4 | Scan | 68 °C | 00:30 | 2 | 39 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Funke, S.; Wiggenhauser, P.S.; Grundmeier, A.; Taha, S.; Fuchs, B.; Birt, A.; Koban, K.; Giunta, R.E.; Kuhlmann, C. Aspirin Stimulates the Osteogenic Differentiation of Human Adipose Tissue-Derived Stem Cells In Vitro. Int. J. Mol. Sci. 2024, 25, 7690. https://doi.org/10.3390/ijms25147690
Funke S, Wiggenhauser PS, Grundmeier A, Taha S, Fuchs B, Birt A, Koban K, Giunta RE, Kuhlmann C. Aspirin Stimulates the Osteogenic Differentiation of Human Adipose Tissue-Derived Stem Cells In Vitro. International Journal of Molecular Sciences. 2024; 25(14):7690. https://doi.org/10.3390/ijms25147690
Chicago/Turabian StyleFunke, Sarah, Paul Severin Wiggenhauser, Anna Grundmeier, Sara Taha, Benedikt Fuchs, Alexandra Birt, Konstantin Koban, Riccardo E. Giunta, and Constanze Kuhlmann. 2024. "Aspirin Stimulates the Osteogenic Differentiation of Human Adipose Tissue-Derived Stem Cells In Vitro" International Journal of Molecular Sciences 25, no. 14: 7690. https://doi.org/10.3390/ijms25147690