A Newly Incompatibility F Replicon Allele (FIB81) in Extensively Drug-Resistant Escherichia coli Isolated from Diseased Broilers
Abstract
:1. Introduction
2. Results
2.1. Identification of Bacterial Isolates
2.2. Antimicrobial Susceptibility Patterns of Bacterial Isolates
2.3. Antimicrobial Susceptibility Patterns of the SDS-Cured Isolates
2.4. Occurrence of IncF Replicons among Bacterial Isolates
2.5. IncF (FIB) Alleles Subtyping
3. Discussion
4. Materials and Methods
4.1. Sample Collection
4.2. Bacterial Isolation and Identification
4.3. Antimicrobial Susceptibilities of the Identified Strains
4.4. Curing of Plasmids
4.5. Plasmid DNA Extraction
4.6. IncF Replicon Typing
4.7. IncF Replicon Sequencing and Sequence Analysis
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Khan, A.A.; Melvin, C.D.; Dagdag, E.B. Identification and molecular characterization of Salmonella spp. from unpasteurized orange juices and identification of new serotype Salmonella strain S. enterica serovar Tempe. Food Microbiol. 2007, 24, 539–543. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Wang, H.; Li, T.; Liu, F.; Cheng, Y.; Guo, X.; Wen, G.; Luo, Q.; Shao, H.; Pan, Z.; et al. Characterization of Salmonella spp. isolated from chickens in Central China. BMC Vet. Res. 2020, 16, 299. [Google Scholar] [CrossRef] [PubMed]
- Carattoli, A.; Bertini, A.; Villa, L.; Falbo, V.; Hopkins, K.L.; Threlfall, E.J. Identification of plasmids by PCR-based replicon typing. J. Microbiol. Methods 2005, 63, 219–228. [Google Scholar] [CrossRef]
- Yang, Q.-E.; Sun, J.; Li, L.; Deng, H.; Liu, B.-T.; Fang, L.-X.; Liao, X.-P.; Liu, Y.-H. IncF plasmid diversity in multi-drug resistant Escherichia coli strains from animals in China. Front. Microbiol. 2015, 6, 964. [Google Scholar] [CrossRef]
- Leinyuy, J.F.; Ali, I.M.; Karimo, O.; Tume, C.B. Patterns of antibiotic resistance in Enterobacterales isolates from broiler chicken in the west region of Cameroon: A Cross-Sectional Study. Can. J. Infect. Dis. Med. Microbiol. 2022, 2022, 4180336. [Google Scholar] [CrossRef] [PubMed]
- Carattoli, A. Plasmids and the spread of resistance. Int. J. Med. Microbiol. 2013, 303, 298–304. [Google Scholar] [CrossRef]
- Hawkey, P.M.; Jones, A.M. The changing epidemiology of resistance. J. Antimicrob. Chemother. 2009, 64 (Suppl. 1), i3–i10. [Google Scholar] [CrossRef]
- Zzaman, S.; Abhyankar, M.M.; Bastia, D. Reconstitution of F factor DNA replication in vitro with purified proteins. J. Biol. Chem. 2004, 279, 17404–17410. [Google Scholar] [CrossRef]
- Nordström, K. Plasmid R1-replication and its control. Plasmid 2006, 55, 1–26. [Google Scholar] [CrossRef]
- Stougaard, P.; Molin, S.; Nordstrom, K. RNAs involved in copy-number control and incompatibility of plasmid R1. Proc. Natl. Acad. Sci. USA 1981, 78, 6008–6012. [Google Scholar] [CrossRef]
- Abd El-Aziz, N.K.; Gharib, A.A. Coexistence of plasmid-mediated quinolone resistance determinants and AmpC-Beta- Lactamases in Escherichia coli strains in Egypt. Cell. Mol. Biol. 2015, 61, 29–35. [Google Scholar] [PubMed]
- Rogers, B.A.; Sidjabat, H.E.; Paterson, D.L.; Kennedy, K.; Collignon, P.; Jones, M. Prolonged carriage of resistant E. coli by returned travellers: Clonality, risk factors and bacterial characteristics. Eur. J. Clin. Microbiol. Infect. Dis. 2012, 31, 2413–2420. [Google Scholar] [CrossRef] [PubMed]
- Thomas, C.M.; Nielsen, K.M. Mechanisms of, and barriers to, horizontal gene transfer between bacteria. Nat. Rev. Microbiol. 2005, 3, 711–721. [Google Scholar] [CrossRef]
- Tamminen, M.; Virta, M.; Fani, R.; Fondi, M. Large-scale analysis of plasmid relationships through gene-sharing networks. Mol. Biol. Evol. 2012, 29, 1225–1240. [Google Scholar] [CrossRef] [PubMed]
- Halary, S.; Leigh, J.W.; Cheaib, B.; Lopez, P.; Bapteste, E. Network analyses structure genetic diversity in independent genetic worlds. Proc. Natl. Acad. Sci. USA 2010, 107, 127–132. [Google Scholar] [CrossRef] [PubMed]
- Millan, A.S.; Peña-Miller, R.; Toll-Riera, M.; Halbert, Z.V.; McLean, A.R.; Cooper, B.S.; MacLean, R.C. Positive selection and compensatory adaptation interact to stabilize non-transmissible plasmids. Nat. Commun. 2014, 5, 5208. [Google Scholar] [CrossRef] [PubMed]
- Lartigue, M.-F.; Poirel, L.; Aubert, D.; Nordmann, P. In vitro analysis of IS Ecp1B -mediated mobilization of naturally occurring β-Lactamase gene bla CTX-M of Kluyvera ascorbata. Antimicrob. Agents Chemother. 2006, 50, 1282–1286. [Google Scholar] [CrossRef] [PubMed]
- Lopatkin, A.J.; Huang, S.; Smith, R.P.; Srimani, J.K.; Sysoeva, T.A.; Bewick, S.; Karig, D.K.; You, L. Antibiotics as a selective driver for conjugation dynamics. Nat. Microbiol. 2016, 1, 16044. [Google Scholar] [CrossRef] [PubMed]
- Johnson, T.J.; Nolan, L.K. Pathogenomics of the virulence plasmids of Escherichia coli. Microbiol. Mol. Biol. Rev. 2009, 73, 750–774. [Google Scholar] [CrossRef]
- Baquero, F.; Negri, M.C.; Morosini, M.I.; Blázquez, J. The antibiotic selective process: Concentration-specific amplification of low-level resistant populations. In CIBA Foundation Symposia; Wiley: Hoboken, NJ, USA, 1997. [Google Scholar] [CrossRef]
- Gustafson, R.H.; Bowen, R.E. Antibiotic use in animal agriculture. J. Appl. Microbiol. 1997, 83, 531–541. [Google Scholar] [CrossRef]
- Wang, X.C.; Lei, C.W.; Kang, Z.Z.; Zhang, Y.; Wang, H.N. IS26-mediated genetic rearrangements in Salmonella genomic island 1 of Proteus mirabilis. Front. Microbiol. 2019, 10, 2245. [Google Scholar] [CrossRef] [PubMed]
- Pan, Y.; Zhang, T.; Yu, L.; Zong, Z.; Zhao, S.; Li, R.; Wang, Q.; Yuan, L.; Hu, G.; He, D. IS 1294 reorganizes plasmids in a multidrug-resistant Escherichia coli Strain. Microbiol. Spectr. 2021, 9, e0050321. [Google Scholar] [CrossRef] [PubMed]
- Mohamed, E.R.; Ali, M.Y.; Waly, N.G.F.M.; Halby, H.M.; El-baky, R.M.A. The Inc FII plasmid and its contribution in the transmission of blaNDM-1 and blaKPC-2 in Klebsiella pneumoniae in Egypt. Antibiotics 2019, 8, 266. [Google Scholar] [CrossRef]
- Villa, L.; García-Fernández, A.; Fortini, D.; Carattoli, A. Replicon sequence typing of IncF plasmids carrying virulence and resistance determinants. J. Antimicrob. Chemother. 2010, 65, 2518–2529. [Google Scholar] [CrossRef] [PubMed]
- Ekundayo, O.K. Plasmid profile and plasmid curing of some Enterobacterales resistant to ampicillin isolated from food, human stool, chicken stool in Ekiti State. Int. J. Curr. Microbiol. Appl. Sci. 2021, 10, 2344–2362. [Google Scholar] [CrossRef]
- Woodward, D.L.; Rodgers, F.G. Surveillance of antimicrobial resistance in Salmonella, Shigella and Vibrio cholerae in Latin America and the Caribbean: A collaborative project. Can. J. Infect. Dis. 2000, 11, 181–185. [Google Scholar]
- Wang, L.; Di Luca, M.; Tkhilaishvili, T.; Trampuz, A.; Gonzalez Moreno, M. Synergistic activity of fosfomycin, ciprofloxacin, and gentamicin against Escherichia coli and Pseudomonas aeruginosa biofilms. Front. Microbiol. 2019, 10, 2522. [Google Scholar] [CrossRef]
- Dionisio, F.; Conceição, I.C.; Marques, A.C.R.; Fernandes, L.; Gordo, I. The evolution of a conjugative plasmid and its ability to increase bacterial fitness. Biol. Lett. 2005, 1, 250–252. [Google Scholar] [CrossRef]
- Wein, T.; Hülter, N.F.; Mizrahi, I.; Dagan, T. Emergence of plasmid stability under non-selective conditions maintains antibiotic resistance. Nat. Commun. 2019, 10, 2595. [Google Scholar] [CrossRef]
- Dahshan, H.; Abd-Elall, A.M.M.; Megahed, A.M.; Abd-El-Kader, M.A.; Nabawy, E.E. Veterinary antibiotic resistance, residues, and ecological risks in environmental samples obtained from poultry farms, Egypt. Environ. Monit. Assess. 2015, 187, 2. [Google Scholar] [CrossRef]
- Awad, A.; Gwida, M.; Khalifa, E.; Sadat, A. Phenotypes, antibacterial-resistant profile, and virulence-associated genes of Salmonella serovars isolated from retail chicken meat in Egypt. Vet World. 2020, 13, 440. [Google Scholar] [CrossRef] [PubMed]
- Enany, S.; Zakeer, S.; Diab, A.A.; Bakry, U.; Sayed, A.A. Whole genome sequencing of Klebsiella pneumoniae clinical isolates sequence type 627 isolated from Egyptian patients. PLoS ONE 2022, 17, e0265884. [Google Scholar] [CrossRef] [PubMed]
- Tartor, Y.H.; Abd El-Aziz, N.K.; Gharieb, R.M.A.; El Damaty, H.M.; Enany, S.; Soliman, E.A.; Abdellatif, S.S.; Attia, A.S.A.; Bahnass, M.M.; El-Shazly, Y.A.; et al. Whole-genome sequencing of gram-negative bacteria isolated from bovine mastitis and raw milk: The first emergence of colistin mcr-10 and fosfomycin fosA5 resistance genes in Klebsiella pneumoniae in Middle East. Front. Microbiol. 2021, 12, 770813. [Google Scholar] [CrossRef] [PubMed]
- Soliman, A.M.; Ramadan, H.; Yu, L.; Hisatsune, J.; Sugai, M.; Elnahriry, S.S.; Nariya, H.; El-Domany, R.A.; Shimamoto, T.; Jackson, C.R.; et al. Complete genome sequences of two Escherichia coli clinical isolates from Egypt carrying mcr-1 on IncP and IncX4 plasmids. Front. Microbiol. 2022, 13, 989045. [Google Scholar] [CrossRef] [PubMed]
- Adenipekun, E.O.; Jackson, C.R.; Ramadan, H.; Iwalokun, B.A.; Frye, J.G.; Barrett, J.B.; Hiott, L.M.; Woodley, T.A.; House, S.L.; McMillan, E.A.; et al. Plasmid replicons and β-lactamase-encoding genes of multidrug-resistant Escherichia coli isolated from humans and food animals in Lagos, Southwest Nigeria. Microb. Drug Resist. 2019, 25, 1410–1423. [Google Scholar] [CrossRef]
- Khajanchi, B.K.; Foley, S.L. Antimicrobial resistance and increased virulence of Salmonella. Microorganisms 2022, 10, 1829. [Google Scholar] [CrossRef] [PubMed]
- Nemr, N.; Kishk, R.M.; Elsaid, N.M.A.B.; Louis, N.; Fahmy, E.; Khattab, S. Knowledge, attitude, and practice (KAP) of antimicrobial prescription and its resistance among health care providers in the COVID-19 era: A cross-sectional study. PLoS ONE 2023, 10, e0289711. [Google Scholar] [CrossRef] [PubMed]
- El-Sokkary, R.; Kishk, R.; Mohy El-Din, S.; Nemr, N.; Mahrous, N.; Alfishawy, M.; Morsi, S.; Abdalla, W.; Ahmed, M.; Tash, R. Antibiotic use and resistance among prescribers: Current status of knowledge, attitude, and practice in Egypt. Infect. Drug Resist. 2021, 14, 1209–1218. [Google Scholar] [CrossRef] [PubMed]
- Abd El-Aziz, N.K.; Ammar, A.M.; Hamdy, M.M.; Gobouri, A.A.; Azab, E.; Sewid, A.H. First report of aacC5-aadA7Δ4 gene cassette array and phage tail tape measure protein on class 1 integrons of Campylobacter species isolated from animal and human sources in Egypt. Animals 2020, 10, 2067. [Google Scholar] [CrossRef]
- Elmowalid, G.A.; Ahmad, A.A.M.; Hassan, M.N.; El-Aziz, N.K.; Abdelwahab, A.M.; Elwan, S.I. Molecular detection of new shv β-lactamase variants in clinical Escherichia coli and Klebsiella pneumoniae isolates from Egypt. Comp. Immunol. Microbiol. Infect. Dis. 2018, 60, 35–41. [Google Scholar] [CrossRef]
- Talaat, M.; Saied, T.; Kandeel, A.; El-Ata, G.A.; El-Kholy, A.; Hafez, S.; Osman, A.; Razik, M.A.; Ismail, G.; El-Masry, S.; et al. A Point prevalence survey of antibiotic use in 18 hospitals in Egypt. Antibiotics 2014, 3, 450–460. [Google Scholar] [CrossRef] [PubMed]
- Smith, J.T.; Lewin, C.S. Mechanisms of antimicrobial resistance and implications for epidemiology. Vet. Microbiol. 1993, 35, 233–242. [Google Scholar] [CrossRef] [PubMed]
- Thomas, L.; Espedido, B.; Watson, S.; Iredell, J. Forewarned is forearmed: Antibiotic resistance gene surveillance in critical care. J. Hosp. Infect. 2005, 60, 291–293. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.; Tang, J.; Khare, T.; Kumar, V. The alarming antimicrobial resistance in ESKAPEE pathogens: Can essential oils come to the rescue? Fitoterapia 2020, 140, 104433. [Google Scholar] [CrossRef]
- Shriram, V.; Jahagirdar, S.; Latha, C.; Kumar, V.; Dhakephalkar, P.; Rojatkar, S.; Shitole, M.G. Antibacterial and antiplasmid activities of Helicteres isora L. Indian J. Med. Res. 2010, 132, 94–99. [Google Scholar]
- Ahmad, A.A.M.; Gharib, A.A.; Elshorbgy, I.; Elewasy, O.A.; Elmowalid, G.A. Nigella sativa oil extract: A natural novel specific conjugal transfer inhibitor of vancomycin resistance from van A/B- resistant Enterococcus faecium to Staphylococcus aureus. J. Appl. Microbiol. 2022, 133, 619–629. [Google Scholar] [CrossRef] [PubMed]
- ISO 11290-1:2017; Microbiology of Food and Animal Feeding Stuffs—Horizontal method for the detection of Salmonella spp. International Organisation for Standardisation: Geneva, Switzerland, 2002.
- Koutsianos, D.; Athanasiou, L.V.; Mossialos, D.; Franzo, G.; Cecchinato, M.; Koutoulis, K.C. Investigation of serotype prevalence of Escherichia coli strains isolated from layer poultry in Greece and interactions with other infectious agents. Vet. Sci. 2022, 9, 152. [Google Scholar] [CrossRef] [PubMed]
- Sanderson, K.E.; Zeigler, D.R. Storing, shipping, and maintaining records on bacterial strains. Methods Enzymol. 1991, 204, 248–264. [Google Scholar] [PubMed]
- Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Disk Susceptibility Tests, 13th ed.; CLSI Standard M02; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
- Rankin, D.I. Test Methods: MIC Testing. In Manual of Antimicrobial Susceptibility Testing; Coyle, B.M., Ed.; American Society for Microbiology: Washington, DC, USA, 2005; pp. 53–62. [Google Scholar]
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
- Tambekar, D.; Dhanorkar, D.; Gulhane, S.; Khandelwal, V.; Dudhane, M. Antibacterial susceptibility of some urinary tract pathogens to commonly used antibiotics. Afr. J. Biotechnol. 2006, 5, 1562–1565. [Google Scholar]
- Chen, W.; Fang, T.; Zhou, X.; Zhang, D.; Shi, X.; Shi, C. IncHI2 plasmids are predominant in antibiotic-resistant Salmonella isolates. Front. Microbiol. 2016, 7, 1566. [Google Scholar] [CrossRef] [PubMed]
- Lihan, S.; Lee, S.Y.; Toh, S.C.; Leong, S.S. Plasmid-mediated antibiotic resistant Escherichia coli in sarawak rivers and aquaculture farms, Northwest of Borneo. Antibiotics 2021, 10, 776. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [PubMed]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar]
- Kimura, M.A. Simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef]
- SAS Institute Inc. SAS/STAT Statistics user’s guide. In Statistical Analytical System, 5th ed.; SAS Institute Inc.: Cary, NC, USA, 2012. [Google Scholar]
AMA | No. of Resistant E. coli (%) | No. of Resistant Salmonella spp. (%) | p-Value |
---|---|---|---|
AMP | 26 (83.87) | 31 (86.11) | 0.1467 |
SAM | 25 (80.65) | 31 (86.11) | 0.0889 |
AMC | 20 (64.52) | 24 (66.67) | 0.3333 |
CRO | 17 (54.84) | 14 (38.89) | 0.4752 |
CFP | 8 (25.81) | 12 (33.33) | 0.2925 |
CTX | 18 (58.06) | 12 (33.33) | 0.1514 |
DO | 15 (48.39) | 13 (36.11) | 0.6287 |
CIP | 17 (54.84) | 9 (25.00) | 0.0496 * |
CN | 14 (45.16) | 12 (33.33) | 0.6236 |
C | 14 (45.16) | 11 (30.56) | 0.4577 |
AZM | 18 (58.06) | 9 (25) | 0.0284 * |
SXT | 16 (51.61) | 13 (36.11) | 0.4709 |
FOS | 15 (48.39) | 3 (8.33) | 0.0010 * |
CT | 26 (83.87) | 31 (86.11) | 0.1467 |
Strains (n = 12) | Code No. | Sensitivity Pattern | Resistance Pattern |
---|---|---|---|
E. coli O125 (n = 3) | 10 | SXT, C | AMP, SAM, AMC, CRO, CFP, CTX, DO, CIP, CN, AZM, FOS, CT |
6 | CFP | AMP, SAM, AMC, CRO, CTX, DO, CIP, CN, C, AZM, SXT, FOS, CT | |
3 | Nil | AMP, SAM, AMC, CRO, CFP, CTX, DO, CIP, CN, C, AZM, SXT, FOS, CT | |
S. Typhimurium (n = 1) | 8 | SXT, CIP, FOS | AMP, SAM, AMC, CRO, CFP, CTX, DO, CN, C, AZM, CT |
S. Enteritidis (n = 4) | 7 | CFP, CRO, FOS | AMP, SAM, AMC, CTX, DO, CIP, CN, C, AZM, SXT, CT |
4 | AZM, CN | AMP, SAM, AMC, CRO, CFP, CTX, DO, CIP, C, SXT, FOS, CT | |
9 | AZM, CN, CFP, FOS | AMP, SAM, AMC, CRO, CTX, DO, CIP, C, SXT, CT | |
5 | AZM, FOS | AMP, SAM, AMC, CRO, CFP, CTX, DO, CIP, CN, C, SXT, CT | |
S. Pullorum (n = 1) | 6 | CN, CRO, FOS | AMP, SAM, AMC, CFP, CTX, DO, CIP, C, AZM, SXT, CT |
S. Gallinarium (n = 2) | 10 | AZM, CIP, CRO, CFP, FOS | AMP, SAM, AMC, CTX, DO, CN, C, SXT, CT |
1 | Nil | AMP, SAM, AMC, CRO, CFP, CTX, DO, CIP, CN, C, AZM, SXT, FOS, CT | |
S. Arizona (n = 1) | 2 | FOS | AMP, SAM, AMC, CRO, CFP, CTX, DO, CIP, CN, C, AZM, SXT, CT |
Bacterial Isolates | Code No. | Resistance to a Number of Antibiotics/ Cured Resistance Markers | IncF Replicon Pattern before SDS Curing | IncF Replicon after SDS Curing | ||
---|---|---|---|---|---|---|
FII | FIA | FIB | ||||
E. coli O125 (n = 3) | 10 | 12/Nil | − | − | FIB (81) | Nil |
6 | 13/Nil | |||||
3 | 14/C, CN, CFP, CRO, CIP | |||||
S. Typhimurium (n = 1) | 8 | 11/AZM, CN | + | + | − | FIIs |
S. Enteritidis (n = 4) | 7 | 11/CIP | − | + | − | Nil |
4 | 12/SXT, C, FOS | − | + | + | FIA, FIB | |
9 | 10/CN, CRO | − | − | + | FIB | |
5 | 12/CT C, CFP, CN, SXT, CRO | − | + | − | Nil | |
S. Pullorum (n = 1) | 6 | 11/SXT, C | + | − | + | FIIs, FIB |
S. Gallinarium (n = 2) | 10 | 9/CN | + | − | + | Nil |
1 | 14/FOS | − | + | + | FIA, FIB | |
S. Arizona (n = 1) | 2 | 13/Nil | − | + | − | FIA |
Bacterial Strain | Primer Name | Primer Sequence (5′–3′) | PCR Run | Amplicon (bP) | References |
---|---|---|---|---|---|
Salmonella spp. | FIA | F: CCATGCTGGTTCTAGAGAAGGTG R: GTATATCCTTACTGGCTTCCGCAG | Duplex | 462 | [3] |
FIBS | F: TGCTTTTATTCTTAAACTATCCAC R: CTCCCGTCGCTTCAGGGCATT | 683 | [3,25] | ||
FIIS | F: CTAAAGAATTTTGATGGCTGGC R: CAGTCACTTCTGCCTGCAC | Simplex | 259–260 | [25] | |
E. coli | FIA | F: CCATGCTGGTTCTAGAGAAGGTG R: GTATATCCTTACTGGCTTCCGCAG | Duplex | 462 | [3] |
FIB | F: TCTGTTTATTCTTTTACTGTCCAC R: CTCCCGTCGCTTCAGGGCATT | 683 | [3,25] | ||
FII | F: CTGATCGTTTAAGGAATTTT R: CACACCATCCTGCACTTA | Simplex | 258–262 | [25] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ammar, A.M.; Abd El-Aziz, N.K.; Aggour, M.G.; Ahmad, A.A.M.; Abdelkhalek, A.; Muselin, F.; Smuleac, L.; Pascalau, R.; Attia, F.A. A Newly Incompatibility F Replicon Allele (FIB81) in Extensively Drug-Resistant Escherichia coli Isolated from Diseased Broilers. Int. J. Mol. Sci. 2024, 25, 8347. https://doi.org/10.3390/ijms25158347
Ammar AM, Abd El-Aziz NK, Aggour MG, Ahmad AAM, Abdelkhalek A, Muselin F, Smuleac L, Pascalau R, Attia FA. A Newly Incompatibility F Replicon Allele (FIB81) in Extensively Drug-Resistant Escherichia coli Isolated from Diseased Broilers. International Journal of Molecular Sciences. 2024; 25(15):8347. https://doi.org/10.3390/ijms25158347
Chicago/Turabian StyleAmmar, Ahmed M., Norhan K. Abd El-Aziz, Mohamed G. Aggour, Adel A. M. Ahmad, Adel Abdelkhalek, Florin Muselin, Laura Smuleac, Raul Pascalau, and Fatma A. Attia. 2024. "A Newly Incompatibility F Replicon Allele (FIB81) in Extensively Drug-Resistant Escherichia coli Isolated from Diseased Broilers" International Journal of Molecular Sciences 25, no. 15: 8347. https://doi.org/10.3390/ijms25158347