Next Article in Journal
Three Years On: The Role of Pegcetacoplan in Paroxysmal Nocturnal Hemoglobinuria (PNH) since Its Initial Approval
Previous Article in Journal
Genome-Wide Analysis of the Gibberellin-Oxidases Family Members in Four Prunus Species and a Functional Analysis of PmGA2ox8 in Plant Height
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 25
Issue 16
10.3390/ijms25168695
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Studying Pathogenetic Contribution of a Variant of Unknown Significance, p.M659I (c.1977G > A) in MYH7, to the Development of Hypertrophic Cardiomyopathy Using CRISPR/Cas9-Engineered Isogenic Induced Pluripotent Stem Cells

by
Sophia V. Pavlova
1,*,†,
Angelina E. Shulgina
1,†,
Suren M. Zakian
1,2 and
Elena V. Dementyeva
1
1
Federal Research Centre Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, 630090 Novosibirsk, Russia
2
Institute of Chemical Biology and Fundamental Medicine, Siberian Branch of the Russian Academy of Sciences, 630090 Novosibirsk, Russia
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2024, 25(16), 8695; https://doi.org/10.3390/ijms25168695
Submission received: 27 June 2024 / Revised: 6 August 2024 / Accepted: 6 August 2024 / Published: 9 August 2024
(This article belongs to the Special Issue Advances, Pitfalls and Future Perspectives for CRISPR/Cas9 Mediated Genome Editing 4.0)
Browse Figures
Versions Notes

Abstract

:
Hypertrophic cardiomyopathy (HCM) is a cardiovascular pathology that is caused by variants in genes encoding sarcomere-associated proteins. However, the clinical significance of numerous variants in HCM-associated genes is still unknown. CRISPR/Cas9 is a tool of nucleotide sequence editing that allows for the unraveling of different biological tasks. In this study, introducing a mutation with CRISPR/Cas9 into induced pluripotent stem cells (iPSCs) of a healthy donor and the directed differentiation of the isogenic iPSC lines into cardiomyocytes were used to assess the pathogenicity of a variant of unknown significance, p.M659I (c.1977G > A) in MYH7, which was found previously in an HCM patient. Using two single-stranded donor oligonucleotides with and without the p.M659I (c.1977G > A) mutation, together with CRISPR/Cas9, an iPSC line heterozygous at the p.M659I (c.1977G > A) variant in MYH7 was generated. No CRISPR/Cas9 off-target activity was observed. The iPSC line with the introduced p.M659I (c.1977G > A) mutation in MYH7 retained its pluripotent state and normal karyotype. Compared to the isogenic control, cardiomyocytes derived from the iPSCs with the introduced p.M659I (c.1977G > A) mutation in MYH7 recapitulated known HCM features: enlarged size, elevated diastolic calcium level, changes in the expression of HCM-related genes, and disrupted energy metabolism. These findings indicate the pathogenicity of the variant.

1. Introduction

Hypertrophic cardiomyopathy (HCM) is one of the most common cardiovascular diseases. It affects 1 of 500 people in the general population. HCM is characterized by thickened left ventricle walls and interventricular septum, diastolic dysfunction, progressive heart failure, and a high risk of arrhythmia and sudden death [1]. Up to 60% of HCM cases are inherited [2]. Most HCM-causing variants were identified in genes encoding sarcomeric proteins that belong to the contractile apparatus of cardiomyocytes. About 80% of inherited HCM cases are accounted for by variants in MYH7 and MYBPC3 that encode β-myosin heavy chain and myosin-binding protein C, respectively. More than 12% of cases are due to variants in TNNT2, TNNI3, and TPM1 that encode cardiac troponinT, cardiac troponin I, and α-tropomyosin. In rare cases, HCM-causing variants were found in genes encoding other contractile sarcomeric proteins (ACTC1, MYL2, MYL3, TNNC1), Z-disc proteins (ACTN2, ANKRD1, CSRP3, FLNC, LDB3, MYOZ2, NEXN, TCAP, VCL), sarcomere-associated proteins (DES, FHL1), as well as proteins involved in the regulation of calcium homeostasis (CALR3, CASQ2, JPH2, PLN) [3,4]. Nevertheless, pathogenetic mechanisms underlying HCM are still poorly understood. A significant progress in HCM studying has been made using generation of induced pluripotent stem cells (iPSCs) from HCM patients carrying pathogenic variants and subsequent differentiation of the iPSCs into cardiomyocytes. The approach simplified the obtainment of cardiomyocytes with HCM-associated mutations and allowed us to shed more light on the mechanisms of disease development at the molecular and cellular levels [5,6,7,8,9,10].
CRISPR/Cas9 is a unique tool of genome editing with multiple applications in fundamental biology and biomedicine. A combination of CRISPR/Cas9 and the iPSC technology opens new prospects in studying cardiovascular diseases, including HCM [11,12,13]. The technique allows for the generation of isogenic iPSC lines that share genetic backgrounds and differ only by the presence/absence of a certain mutation. The differentiation of isogenic iPSC lines into cardiomyocytes and the comparison of properties of the cardiomyocytes make it possible to examine the net impact of the mutation on disease development. Using CRISPR/Cas9, several pathogenic variants were introduced into iPSCs to examine HCM molecular mechanisms [14,15,16,17,18]. Another way of applying CRISPR/Cas9 is correcting a pathogenic mutation in patient-specific iPSCs to generate isogenic control [19,20]. In addition, generating isogenic iPSCs with CRISPR/Cas9 is used for checking the pathogenicity of variants of unknown significance. The technology has been already used to determine the clinical significance of a number of genetic variants for HCM development [21,22]. This task seems to be very relevant because the implementation of next-generation sequencing methods in clinical practice has resulted in the identification of novel variants and genes associated with cardiovascular diseases. The clinical significance of more than 40% of the variants remains unknown [11].
A 38-year-old male patient diagnosed with obstructive HCM was previously found in a genetic screening of HCM patients [23]. The patient was characterized by asymmetric hypertrophy of the left ventricle, thickened interventricular septum (29–30 mm), congestive heart failure (NYHA Class II–III), moderate mitral valve regurgitation, an enlargement of both atria, SAM (systolic anterior motion) syndrome, and arterial hypertension. An analysis of the patient’s clinical exome revealed a heterozygous p.M659I (c.1977G > A) variant in MYH7 (rs1241603111, MIM *160760 for the gene, MIM #192600 for MYH7-associated HCM). The substitution is localized to a functionally important actin-binding region of the myosin motor domain. The variant is absent in gnomAD (https://gnomad.broadinstitute.org/, accessed on 14 July 2024), and its minor allele frequency is currently unknown. It was found in HCM patients in a few studies [24,25]. The p.M659I (c.1977G > A) variant in MYH7 is supposed to be pathogenic based on the data of an in silico analysis (Table 1, [23]) and AlphaMissense prediction [26]. However, the substitution is classified as a variant of uncertain significance in ClinVar, and its role in HCM development needs to be clarified.
In this study, we tried to determine the pathogenicity of the p.M659I (c.1977G > A) variant in MYH7. The mutation was introduced into the iPSCs of a healthy donor with CRISPR/Cas9 and single-stranded donor oligonucleotides. A modification of the approach was developed to generate iPSCs heterozygous at the substitution. iPSC-derived cardiomyocytes with the p.M659I (c.1977G > A) mutation introduced with CRISPR/Cas9 in MYH7 were shown to display several HCM features, such as an enlarged cardiomyocyte size, elevated diastolic calcium level, changes in the expression of several HCM-related genes, and disrupted energy metabolism, which supports population and in silico data on the pathogenicity of the variant.

2. Results

2.1. Introducing p.M659I (c.1977G > A) Mutation with CRISPR/Cas9 in MYH7 of Healthy Donor iPSCs

The p.M659I (c.1977G > A) mutation was introduced with CRISPR/Cas9 and single-stranded donor oligonucleotides in MYH7 Exon 18 of iPSCs of the ICGi022-A line previously derived from the healthy donor [27]. CRISPR/Cas9 was delivered to the cells in the form of ribonucleoprotein complexes of single-guide RNA and Cas9_NLS. As the patient was a heterozygous carrier of the variant, we decided to use a combination of two single-stranded donor oligonucleotides for generating iPSCs heterozygous at the substitution. One donor oligonucleotide contained the p.M659I (c.1977G > A) mutation, and the other corresponded to the nucleotide sequence of MYH7 Exon 18 of the healthy donor. Both donor oligonucleotides also comprised a synonymous substitution that modified PAM (Protospacer Adjacent Motif) sequence to protect MYH7 alleles from repetitive CRISPR/Cas9 editing (Figure 1a).
Seventy iPSC clones have been generated after the iPSC electroporation with CRISPR/Cas9 and the single-stranded donor oligonucleotides. Non-homologous end joining occurred in 41 (58.57%) of the iPSC clones. Double-strand breaks were repaired via homologous recombination in six (8.57%) of the iPSC clones. In two of the iPSC clones with homologous recombination, only the donor oligonucleotide that corresponded to the nucleotide sequence of MYH7 Exon 18 of the healthy donor was used. The target c.1977G > A substitution was detected in four iPSC clones with homologous recombination. However, in three iPSC clones, the second allele contained indels. Thus, only one iPSC line heterozygous at the p.M659I (c.1977G > A) mutation in MYH7 was generated as a result of using both types of donor oligonucleotides for double-strand break reparation, which was confirmed by homozygous synonymous substitution in PAM (Figure 1b). No CRISPR/Cas9 off-target activity was found after sequencing the top-five CRISPR/Cas9 off-target sites in the iPSC line with the introduced p.M659I (c.1977G > A) mutation in MYH7 and the original ICGi022-A line (Figure S1). The CRISPR/Cas9 off-target sites were predicted using IDT (https://www.idtdna.com/, accessed on 18 November 2022).
The iPSC line with the p.M659I (c.1977G > A) mutation, which was introduced with CRISPR/Cas9 in MYH7, retained pluripotent properties: expressed pluripotency markers, such as the OCT4, NANOG, SOX2 transcription factors and TRA-1-60 surface antigen, and gave rise to derivatives of three germ layers during spontaneous differentiation in embryoid bodies (Figure 2a,b). The expression level of OCT4, NANOG, and SOX2 in the iPSC line was comparable to that in the original ICGi022-A line used for MYH7 editing (Figure 2c). The iPSC line with the introduced p.M659I (c.1977G > A) mutation in MYH7 also had a normal karyotype (46,XX (Figure 2d)) and was negative for mycoplasma contamination (Figure 2e).

2.2. Cardiomyocytes Derived from iPSCs with Introduced p.M659I (c.1977G > A) Mutation in MYH7 Demonstrate HCM Features

To study the impact of the p.M659I (c.1977G > A) variant in MYH7 on HCM development, we differentiated the iPSC line with the introduced p.M659I (c.1977G > A) mutation in MYH7, an iPSC line from the patient with the variant, ICGi019-B [28], and two iPSC lines from healthy donors [27] (including the original ICGi022-A line) into cardiomyocytes. A protocol based on modulating the Wnt signaling pathway with the GSK3β protein kinase inhibitor (CHIR99021) and a Wnt inhibitor (IWP2 or Wnt-C59) was used to generate cardiomyocytes. The cardiomyocytes were purified via metabolic selection in a glucose-free medium supplemented with bovine serum albumin, ascorbic acid, and sodium DL-lactate [29].
One of the most common HCM features in iPSC-based models of the disease is an enlarged size of cardiomyocytes [5,6,7,9,10,30]. The cardiomyocytes derived from the iPSCs with the introduced p.M659I (c.1977G > A) mutation in MYH7, patient-specific iPSCs, and iPSCs from healthy donors were visualized by immunofluorescence staining with antibodies to sarcomeric α-actinin, a cardiomyocyte-specific marker (Figure 3a). The calculation of iPSC-derived cardiomyocyte areas showed that the cardiomyocytes carried the p.M659I (c.1977G > A) mutation in MYH7 (introduced with CRISPR/Cas9 or patient-specific) had an increased size in comparison with those differentiated from the iPSCs of healthy donors (Figure 3b).
Another feature that was revealed in iPSC-based HCM models and was supposed to precede cardiomyocyte hypertrophy is elevated intracellular diastolic calcium level [5,6,9,15,19,30,31]. A calcium-dependent fluorescent dye, Fluo-8 AM, was used to compare diastolic calcium levels in the cardiomyocytes derived from the iPSCs with the introduced p.M659I (c.1977G > A) mutation in MYH7, patient-specific iPSCs, and iPSCs from healthy donors. In the cardiomyocytes that carried the p.M659I (c.1977G > A) mutation in MYH7 (introduced with CRISPR/Cas9 or patient-specific), the diastolic calcium level was demonstrated to be elevated compared to those differentiated from the iPSCs of healthy donors (Figure 3c).
A disruption of mitochondria functioning was also found in some iPSC-based HCM models [14,19,20]. We assessed mitochondrial respiration (oxygen consumption rate, OCR) in cardiomyocytes derived from the iPSC line with the introduced p.M659I (c.1977G > A) mutation in MYH7 and the original ICGi022-A line (healthy donor) using Seahorse technology (Agilent, Santa Clara, CA, USA). To study mitochondrial respiration, the protocol of cardiac iPSC differentiation was modified. After metabolic selection, cardiomyocytes were cultured for 2 weeks in the presence of 2 µM CHIR99021 and for another 2 weeks in a medium for cardiomyocyte maturation, which contained low glucose and high oxidative substrate concentrations [32]. In iPSC-derived cardiomyocytes with the introduced p.M659I (c.1977G > A) mutation in MYH7, basal OCR was significantly lower than in those of the healthy donor (p-value = 0.0002). At the same time, no differences in the maximal OCR and spare capacity were revealed (Figure 4a). Extracellular acidification rate (ECAR) reflecting glycolysis level was also investigated. Basal ECAR was decreased in iPSC-derived cardiomyocytes with introduced p.M659I (c.1977G > A) mutation in MYH7 compared to those of the healthy donor (p-value < 0.0001) (Figure 4b).
In the cardiomyocytes derived from the iPSC line with the introduced p.M659I (c.1977G > A) mutation in MYH7 and the original ICGi022-A line with the maturation stage, the gene expression pattern was also examined by RT-qPCR. The expression levels of well-known HCM-associated genes (NPPA, GATA4, MEF2C) [5,6,30,31], sarcomere genes (MYH7, MYL2, TNNT2) [5,6,7,30], as well as genes involved in the calcium release from the sarcoplasmic reticulum and its re-uptake (RYR2, ATP2A2, PLN) [5,6,7,8,30] and genes of the antioxidant defense system (NFE2L2, SOD1) [33,34] were compared. Several HCM-related genes (NPPA, MYL2, TNNT2) were shown to be upregulated, whereas MYH7 was downregulated in the cardiomyocytes with the introduced p.M659I (c.1977G > A) mutation in MYH7 (Figure 4c). The expression level of GATA4, MEF2C, and the genes involved in calcium homeostasis regulation and antioxidant defense did not differ significantly between cardiomyocytes derived from the iPSC line with the introduced p.M659I (c.1977G > A) mutation in MYH7 and the original ICGi022-A line.
Thus, introducing the p.M659I (c.1977G > A) mutation with CRISPR/Cas9 in MYH7 caused the appearance of HCM traits: increased cardiomyocyte size and diastolic calcium level, changes in the gene expression pattern, and decreased energy metabolism (mitochondrial respiration and glycolysis).

3. Discussion

iPSC editing with CRISPR/Cas9 and the investigation of relevant differentiated derivatives of isogenic iPSCs allow for the unraveling of the contribution of genetic variants of unknown significance in disease pathogenesis [11,12,13]. In this study, the approach was applied to establish the clinical significance of the p.M659I (c.1977G > A) variant in MYH7, which was found earlier in the genetic screening of HCM patients [23]. The amino acid substitution is located in a protein region that is highly conserved in vertebrates [35]. Sensitivity to amino acid changes was demonstrated by several studies that found pathogenic variants associated with cardiomyopathies in the region [35,36]. In silico analysis suggests that a substitution in close proximity to p.M659I (p.L655M) in β-myosin heavy chain disrupts the actin–myosin interaction, which leads to weaker binding energy and the inefficient functioning of the complex [35]. Rare frequency and all the in silico data indicate the pathogenicity of the variant. However, functional studies are needed to decipher its clinical significance.
In our previous study, we also used the electroporation of CRISPR/Cas9 in the form of ribonucleoprotein complexes and single-stranded donor oligonucleotides with a mutation to the iPSCs of the healthy donor for introducing a variant of unknown significance, p.Asn515del (c.1543_1545delAAC), in MYBPC3 [37]. All the iPSC clones with the introduced p.Asn515del mutation demonstrated editing events in both alleles of MYBPC3: nine iPSC clones carried the p.Asn515del mutation in one allele and indels in the other, whereas three iPSC clones were homozygous at the deletion. Considering the capacity of CRISPR/Cas9 ribonucleoprotein complexes to induce efficiently double-strand breaks in both alleles, we aimed at generating iPSCs heterozygous at the p.M659I (c.1977G > A) variant in MYH7, as it occurs in the HCM patient. To achieve the goal, we modified the editing process by using two types of donor oligonucleotides: not only the one that contained the mutation but also the one that corresponded to nucleotide sequence of the healthy donor. However, only one iPSC clone out of 70 (1.43%) demonstrated homologous recombination with both types of donor oligonucleotides, and that clone was heterozygous at the p.M659I (c.1977G > A) mutation in MYH7. Thus, two single-stranded donor oligonucleotides (with and without mutation) can be used for generating iPSCs heterozygous at mutations of interest. This may be important for studying HCM and other cardiomyopathies with autosomal dominant inheritance [38]. However, the method needs to be further optimized to increase the efficiency of obtaining iPSCs with desired editing events.
There is a hypothesis suggesting that HCM-causing sarcomeric mutations result in increased myofilament calcium sensitivity, which in turn leads to increased ATP consumption at the sarcomeres and a lack of ATP molecules for other cell processes. One of the processes is ATP-dependent calcium re-uptake to the sarcoplasmic reticulum via ATP2A2. Decreased efficiency of calcium re-uptake results in an elevated diastolic calcium level in cardiomyocytes, which can cause diastolic dysfunction and arrhythmias in HCM [39]. The increased calcium level in cardiomyocytes, in turn, triggers the calcineurin-NFAT signaling pathway that leads to NFAT re-localization to the nucleus and the activation of hypertrophy mediators such as GATA4 and MEF2C [5,6]. In line with this suggestion, we found an increased diastolic calcium level and enlarged size of the cardiomyocytes derived from iPSCs carrying the p.M659I (c.1977G > A) mutation in MYH7 (introduced with CRISPR/Cas9 or patient-specific) compared to those derived from iPSCs of the healthy donors. The data on gene expression in the cardiomyocytes derived from the iPSC line with the introduced p.M659I (c.1977G > A) mutation in MYH7 and the original ICGi022-A line of the healthy donor revealed upregulation of natriuretic peptide A (NPPA), which was shown to be one of the hypertrophy hallmarks in numerous studies of iPSC-based HCM models [5,6,30,31] and transcriptomes of HCM patients’ heart tissues [40,41,42,43,44]. Interestingly, the expression level of two hypertrophy mediators, GATA4 and MEF2C [6,30], was similar in both types of cardiomyocytes. This suggests that some other mediators may be essential for cardiomyocyte hypertrophy in the case of the p.M659I (c.1977G > A) variant in MYH7. The hypertrophy of the cardiomyocytes with the introduced p.M659I (c.1977G > A) mutation in MYH7 was confirmed not only by NPPA upregulation but also by the elevated expression level of two sarcomere genes (MYL2, TNNT2) that were often upregulated in iPSC-based HCM models [6,7,30]. At the same time, MYH7 was downregulated in the cardiomyocytes with the introduced p.M659I (c.1977G > A) mutation in MYH7. It is worth noting that the expression level of the gene is mutation-specific and can be both upregulated [6,30] and downregulated [5] in iPSC-based HCM models. Despite the increased diastolic calcium level, no differences in the expression pattern of genes involved in calcium homeostasis regulation (RYR2, ATP2A2, PLN) between the cardiomyocytes with the introduced p.M659I (c.1977G > A) mutation in MYH7 and from the original ICGi022-A line were observed. Previous studies of iPSC-based HCM models revealed that the expression level of the calcium homeostasis genes depended on mutation and could be both upregulated and downregulated or demonstrated no changes between “diseased” and control cardiomyocytes [5,6,7,8,30]. Thus, the enlarged size, the upregulation of a number of HCM-related genes, and the elevated diastolic calcium level that were found in cardiomyocytes derived from the iPSCs with the introduced p.M659I (c.1977G > A) mutation in MYH7 indicate the pathogenicity of the variant.
Another consequence of calcium accumulation at the sarcomeres is a calcium deficit within the mitochondria, which may inhibit oxidative phosphorylation and ATP production and increase reactive oxygen species (ROS) concentration over time [39]. We decided to investigate mitochondrial respiration in cardiomyocytes derived from the iPSC line with the introduced p.M659I (c.1977G > A) mutation in MYH7 and the original ICGi022-A line of the healthy donor. However, iPSC-derived cardiomyocytes are characterized by metabolic immaturity and use predominantly glycolysis, but not oxidative phosphorylation [45]. Several studies demonstrated that the oxidative phosphorylation level in iPSC-derived cardiomyocytes might be augmented when cultured in the maturation medium [32,46]. This prompted us to modify the protocol of directed cardiac iPSC differentiation for examining mitochondrial respiration. A stage of cultivation in the medium promoting cardiomyocyte maturation was added. We showed that the basal oxygen consumption rate (OCR) was decreased in cardiomyocytes with the p.M659I (c.1977G > A) mutation in MYH7 introduced with CRISPR/Cas9 compared to those of the healthy donor. No impact of the p.M659I (c.1977G > A) mutation in MYH7 on the maximal OCR and spare capacity was observed. Nevertheless, some studies revealed an increase in basal and the maximal OCR in iPSC-derived cardiomyocytes with two other mutations in the β-myosin motor domain and a mutation in cardiac α-actin (ACTC1) [14,19,20]. To further verify the energy deficiency theory and appearance of oxidative stress due to ROS accumulation, we also compared the expression level of two genes of antioxidant defense (NFE2L2 and SOD1) [33,34] between the cardiomyocytes derived from the iPSC line with the introduced p.M659I (c.1977G > A) mutation in MYH7 and the original ICGi022-A line but found no significant differences. This finding is in agreement with previous data on different basal and maximal OCR but similar ROS levels in iPSC-derived cardiomyocytes with and without a pathogenic variant in MYH7 [14]. Thus, our results support, to some extent, the energy deficiency theory in HCM, but the impact of the p.M659I (c.1977G > A) variant in MYH7 on the energy metabolism and oxidative stress in cardiomyocytes should be investigated in more detail.

4. Materials and Methods

4.1. Editing MYH7 with CRISPR/Cas9 in iPSCs of Healthy Donor

Single-guide RNA and donor oligonucleotides were designed using Benchling and IDT (https://www.benchling.com/ and https://www.idtdna.com/, accessed on 13 May 2022) (Table 2). First, 100 pmol of single-guide RNA (Synthego, Redwood City, CA, USA) and 20 pmol of Cas9_NLS (NEB, Ipswich, MA, USA) were incubated for 20 min at room temperature. The ribonucleoprotein complexes, together with 300 ng of 1:1 mixture of two single-stranded donor oligonucleotides with and without the c.1977G > A (p.M659I) mutation (Biolegio, Nijmegen, The Netherlands), were electroporated into 1 × 105 iPSCs of the ICGi022-A line [27] on a Neon Transfection System (Thermo Fisher Scientific, Waltham, MA, USA) using program: 1100 V, 30 ms, 1 time. The electroporated cells were transferred to a feeder layer in an iPSC medium without antibiotics supplemented with 10 ng/mL Y-27632 (Sigma–Aldrich, Darmstadt, Germany). Forty-eight hours later, the cells were subcloned into 96-well plates. iPSC clones were cultured at 37 °C in 5% CO2 in the iPSC medium: KnockOut DMEM supplemented with 15% KnockOut Serum Replacement, 0.1 mM MEM Non-Essential Amino Acids Solution, 1× penicillin-streptomycin, 1 mM GlutaMAX (all reagents from Thermo Fisher Scientific, Waltham, MA, USA), 0.05 mM 2-mercaptoethanol (Amresco, Solon, OH, USA), and 10 ng/mL bFGF (SCI-store, Moscow, Russia). iPSC clones were passaged with TrypLE™ Express Enzyme (Thermo Fisher Scientific, Waltham, MA, USA) at a ratio of 1:10 every 4–5 days.

4.2. Analysis of Introduced Mutations and CRISPR/Cas9 off-Target Activity

Genomic DNA was isolated from iPSCs using Wizard® Genomic DNA Purification Kit (Promega, Madison, WI, USA). Regions contained Exon 18 of MYH7 or predicted CRISPR/Cas9 off-target sites were amplified by PCR with BioMaster HS-Taq PCR-Color (2×) (Biolabmix, Novosibirsk, Russia) on a T100 Thermal Cycler (Bio-Rad, Hercules, CA, USA) using program: 95 °C—3 min; 35 cycles: 95 °C—30 s, 62 °C—30 s, 72 °C—30 s; 72 °C—5 min. The primers used are provided in Table 2. Sanger sequencing of PCR products was conducted using Big Dye Terminator V. 3.1. Cycle Sequencing Kit (Applied Biosystems, Austin, TX, USA) and analyzed at the SB RAS Genomics Core Facility (Novosibirsk, Russia).

4.3. Spontaneous In Vitro Differentiation

Spontaneous differentiation of iPSCs was performed in embryoid bodies as described earlier [47]. iPSCs were incubated for 40 min with 0.15% Collagenase IV (Thermo Fisher Scientific, Waltham, MA, USA). The suspension was centrifuged for 5 min at 200 g. Cells were transferred on Petri dishes coated with 1% agarose (Helicon) and were cultured for 2 weeks in DMEM/F12 (1:1) medium supplemented with 15% KnockOut Serum Replacement, 0.1 mM MEM Non-Essential Amino Acids Solution, 1× penicillin-streptomycin, 1 mM GlutaMAX (all reagents from Thermo Fisher Scientific, Waltham, MA, USA) for embryoid body formation. Medium was changed every 3 days. The embryoid bodies were plated on 8-well chambered coverglass (Thermo Fisher Scientific, Waltham, MA, USA) coated with Matrigel (Corning, New York, NY, USA) and cultivated for another week under the same conditions.

4.4. Immunofluorescence Staining

Cells were fixed for 10 min in 4% paraformaldehyde (Sigma–Aldrich, Darmstadt, Germany), permeabilized for 10 min in 0.4% Triton-X100 (Sigma–Aldrich, Darmstadt, Germany), and incubated for 30 min with 1% bovine serum albumin (VWR, Solon, OH, USA) (all steps were performed at room temperature). Cells were further incubated overnight at 4 °C with primary antibodies and for 1 h at room temperature with secondary antibodies. The antibodies used are provided in Table 2. After each incubation with antibodies, cells were washed twice for 15 min with PBS. Nuclei were counterstained with DAPI (Sigma–Aldrich, Darmstadt, Germany). Images were recorded using a Nikon Eclipse Ti-E and NIS Elements software (Nikon, Tokyo, Japan).

4.5. RT-qPCR

RNA was isolated with TRIzol Reagent and purified from possible DNA contaminations using Invitrogen™ DNA-free™ DNA Removal Kit (all reagents from Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcription of 1 µg of RNA was performed with the M-MuLV reverse transcriptase (Biolabmix, Novosibirsk, Russia). All procedures were conducted according to the manufacturers’ protocols. RT-qPCR was performed with BioMaster HS-qPCR SYBR Blue 2× (Biolabmix, Novosibirsk, Russia) on a LightCycler 480 System (Roche, Basel, Switzerland) and QuantStudio™ 5 Real-Time PCR System (Applied Biosystems, Life Technologies Holdings Pte. Ltd., Singapore) for gene expression analysis in iPSCs and iPSC-derived cardiomyocytes, respectively, using program: 95 °C—5 min; 40 cycles: 95 °C—10 s, 60 °C—1 min. CT values were normalized to B2M using the ΔΔCT method for the pluripotency genes. Data on gene expression in iPSC-derived cardiomyocytes were analyzed in qbase+ V3.4. B2M and GAPDH were used as reference genes. All the primers are provided in Table 2.

4.6. Karyotyping

Cell treatment and metaphase collection were performed as described previously [48]. iPSCs were plated at a ratio of 1:4 on four wells of 12-well plate 48 h before metaphase collection. iPSC medium was changed to the fresh one and different concentrations of Colcemide (from 25 to 50 ng/mL) were added 2.5 h before metaphase collection. Cells were disaggregated with TrypLE™ Express Enzyme (Thermo Fisher Scientific, Waltham, MA, USA). Hypotonic treatment was performed for 20 min at 37 °C in 0.28% KCl. Cells were fixed in the Carnoy’s solution (methanol–acetic acid 3:1). Karyotype of the iPSC clone was analyzed at the Tomsk National Research Medical Center of the Russian Academy of Sciences using a Zeiss Axio Scope.A1 (Zeiss, Oberkochen, Germany) and Ikaros KARyOtyping Software (MetaSystems, Altlussheim, Germany). Fifty metaphase plates were analyzed.

4.7. Mycoplasma Detection

Mycoplasma contamination of the iPSC clone was detected by PCR with BioMaster HS-Taq PCR-Color (2×) (Biolabmix, Novosibirsk, Russia) on a T100 Thermal Cycler (Bio-Rad, Hercules, CA, USA) using program: 95 °C—3 min; 35 cycles: 95 °C—15 s, 67 °C—15 s, 72 °C—20 s; 72 °C—5 min. The primers used are listed in Table 2.

4.8. Directed iPSC Differentiation into Cardiomyocytes

iPSCs were cultured for two-to-three passages in Essential 8 Medium (Thermo Fisher Scientific, Waltham, MA, USA) on wells coated with Matrigel (Corning, New York, NY, USA). iPSCs were plated at a ratio of 1:6–1:10 on Matrigel-coated 12-well plates. After cells reached 80–90% confluency, RPMI 1640 medium supplemented with 1× penicillin-streptomycin, 1× B27 Supplement minus insulin (all reagents from Thermo Fisher Scientific, Waltham, MA, USA), and 6 µM CHIR99021 (Sigma–Aldrich, Darmstadt, Germany) was added for 48 h to induce differentiation. Seventy-two hours after, RPMI 1640 medium supplemented with 1× penicillin-streptomycin, 1× B27 Supplement minus insulin, and 5 µM IWP2 (Sigma–Aldrich, Darmstadt, Germany) or 2 µM Wnt-C59 (Selleck Chemicals, Houston, TX, USA), was added for another 48 h. Starting from Day 7 of differentiation, cells were cultivated in RPMI 1640 medium supplemented with 1× penicillin-streptomycin and 1× B27 Supplement (Thermo Fisher Scientific, Waltham, MA, USA) (RPMI/B27 medium). On Day 9 of differentiation, cells were subjected to metabolic selection for 7–9 days in RPMI 1640 medium without D-glucose (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 1× penicillin-streptomycin, 213 µg/mL L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (Sigma–Aldrich, Darmstadt, Germany), 500 µg/mL bovine serum albumin (VWR, Solon, OH, USA), and 5 mM sodium DL-lactate (Sigma–Aldrich, Darmstadt, Germany) [29]. Purified cardiomyocytes were dissociated with 0.25% trypsin, plated on Matrigel-coated wells, and cultivated in the RPMI/B27 medium.

4.9. Analysis of Cardiomyocyte Size

To define cardiomyocyte boundaries, immunofluorescence staining with antibodies to sarcomeric α-actinin (Table 2) was performed as described in the Immunofluorescence Staining Section (Section 4.4). Images of cardiomyocytes in random fields of view were used to calculate cell surfaces in ImageJ 1.53k. No less than 100 cardiomyocytes were analyzed for each iPSC line.

4.10. Calcium Imaging

iPSC-derived cardiomyocytes were incubated in the RPMI/B27 medium with 4 µg/mL Fluo-8 AM (Abcam, Cambridge, UK) for 30 min in a CO2 incubator (Binder, Tuttlingen, Germany). The medium was then replaced with Tyrode’s solution (140 mM NaCl, 4.5 mM KCl, 10 mM glucose, 10 mM HEPES, 1 mM MgCl2, 1.8 mM CaCl2, and 1% penicillin-streptomycin, pH 7.4) (Sigma–Aldrich, Darmstadt, Germany) that was warmed to 37 °C. Calcium-dependent fluorescence was recorded for 10 s at 100 ms exposure on a Nikon Eclipse Ti-E with NIS Elements software (Nikon, Tokyo, Japan). To determine diastolic calcium-dependent fluorescence, the videos were processed with ImageJ 1.53k, including subtraction of background fluorescence noise.

4.11. Seahorse

After metabolic selection, cardiomyocytes were plated on Matrigel-coated 6-wells and cultured for 2 weeks in the RPMI/B27 medium supplemented with 2 µM CHIR99021 (Sigma–Aldrich, Darmstadt, Germany). On Day 30 of differentiation, cardiomyocytes were plated on Matrigel-coated 12-wells at a ratio of 8.5–9.5 × 105 cells per well and cultivated for 2 weeks in the cardiomyocyte maturation medium [32]: DMEM with L-glutamine but without D-glucose (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 3 mM glucose, 10 mM L-lactate, 5 mM Creatine monohydrate, 2 mM L-carnitine, 0.5 mM L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (all reagents from Sigma–Aldrich, Darmstadt, Germany), 5 µg/mL Vitamin B12, 0.82 µM Biotin, 2 mM Taurine (all reagents from HiMedia, Thane, India), 0.1 mM MEM Non-Essential Amino Acids Solution, 1× B27 Supplement, 1% KoSR, 1× penicillin-streptomycin, and 0.5% (w/v) Albumax (all reagents from Thermo Fisher Scientific, Waltham, MA, USA).
On Day 45 of differentiation, cardiomyocytes were plated on Matrigel-coated Seahorse XFp Cell Culture Miniplates (Agilent, Santa Clara, CA, USA) at a ratio of 4 × 104 cells per well and were cultured for a week in the cardiomyocyte maturation medium. Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured on a Seahorse XF HS Mini Analyzer using Seahorse XFp Cell Mito Stress Test Kit (Agilent, Santa Clara, CA, USA) with 1.5 µM oligomycin, 2 µM FCCP, and 0.5 µM rotenone/antimycin A according to the manufacturer’s protocols. The data obtained were analyzed in Wave 2.6.3 (Agilent, Santa Clara, CA, USA) and were normalized to average cell number in five random 20× fields of view for each well. Cardiomyocytes were visualized using immunofluorescence staining with antibodies to sarcomeric α-actinin on a Nikon Eclipse Ti-E with NIS Elements software (Nikon, Tokyo, Japan).

4.12. Statistics

Statistical significance of differences between iPSC-derived cardiomyocytes in size and diastolic calcium level was determined using one-way ANOVA with Tukey’s correction for multiple comparisons and Kruskal–Wallis test with Dunn’s test for multiple comparisons, respectively. Differences between iPSC-derived cardiomyocytes in OCR, ECAR, and gene expression level were verified by Mann–Whitney U test. p-values < 0.05 were considered to be significant. p-values for gene expression level in iPSC-derived cardiomyocytes were calculated in qbase+ V3.4. The other calculations, box plots, and column bar graphs were conducted in GraphPad Prism Version 5.00 for Windows. The data are presented as mean with minimal and maximal values and mean ± SEM for box plots and column bar graphs, respectively.

5. Conclusions

Using CRISPR/Cas9, a variant of unknown significance, p.M659I (c.1977G > A) in MYH7, was introduced into iPSCs of a healthy donor. The application of two single-stranded donor oligonucleotides (with and without the p.M659I (c.1977G > A) mutation in MYH7) allowed for the generation of an iPSC line heterozygous at the substitution. No CRISPR/Cas9 off-target activity was revealed. Despite MYH7 editing, the iPSC line retained pluripotent state and normal karyotype. Cardiomyocytes derived from the iPSC line with the introduced p.M659I (c.1977G > A) mutation in MYH7 reproduced characteristic HCM traits such as enlarged size, changes in the expression level of HCM-related genes, elevated diastolic calcium level, and some abnormalities in energy metabolism compared to those derived from the original iPSC line. These findings are in agreement with population and in silico data and strongly support the pathogenicity of the variant. This work is a first attempt of functional studies for clarifying the clinical significance of the p.M659I (c.1977G > A) variant in MYH7, which may be important for the interpretation of the genetic screening data of HCM patients. In addition, the isogenic iPSC lines generated in the work may be used for examining the molecular mechanisms of the disease triggered by the p.M659I (c.1977G > A) variant in MYH7, especially the way how the variant may influence energy metabolism and oxidative stress in cardiomyocytes.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms25168695/s1.

Author Contributions

Conception and design: S.V.P., E.V.D. and S.M.Z. Experiments and data interpretation: A.E.S., S.V.P. and E.V.D. Contribution of reagents/materials/analysis tools/administrative and financial support: E.V.D. and S.M.Z. Manuscript writing: S.V.P. and E.V.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Russian Science Foundation, grant No. 22-15-00271.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of FSBI Federal Neurosurgical Center (Protocol No. 1 dated 14 March 2017).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The data on the iPSC line characterization are available in the Human Pluripotent Stem Cell Registry (https://hpscreg.eu/cell-line/ICGi022-A-8, accessed on 19 December 2023).

Acknowledgments

Immunofluorescence microscopy was performed using resources of the Common Facilities Centre of Microscopic Analysis of Biological Objects supported by the State project of ICG SB RAS (FWNR-2022-0015). Energy metabolism was studied using resources of the Common Facilities Centre “SPF-vivarium of the ICG SB RAS” supported by the State project of the ICG SB RAS (FWNR-2022-2023). Equipment of the Institute of Chemical Biology and Fundamental Medicine was also used in the study.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Maron, B.J. Hypertrophic Cardiomyopathy: A Systematic Review. JAMA 2002, 287, 1308–1320. [Google Scholar] [CrossRef] [PubMed]
  2. Marian, A.J.; Braunwald, E. Hypertrophic cardiomyopathy: Genetics, pathogenesis, clinical manifestations, diagnosis, and therapy. Circ. Res. 2017, 121, 749–770. [Google Scholar] [CrossRef] [PubMed]
  3. Pasipoularides, A. Challenges and Controversies in Hypertrophic Cardiomyopathy: Clinical, Genomic and Basic Science Perspectives. Rev. Esp. Cardiol. (Engl. Ed.) 2018, 71, 132–138. [Google Scholar] [CrossRef] [PubMed]
  4. Akhtar, M.; Elliott, P. The genetics of hypertrophic cardiomyopathy. Glob. Cardiol. Sci. Pract. 2018, 2018, 36. [Google Scholar] [CrossRef] [PubMed]
  5. Han, L.; Li, Y.; Tchao, J.; Kaplan, A.D.; Lin, B.; Li, Y.; Mich-Basso, J.; Lis, A.; Hassan, N.; London, B.; et al. Study familial hypertrophic cardiomyopathy using patient-specific induced pluripotent stem cells. Cardiovasc. Res. 2014, 104, 258–269. [Google Scholar] [CrossRef] [PubMed]
  6. Lan, F.; Lee, A.S.; Liang, P.; Sanchez-Freire, V.; Nguyen, P.K.; Wang, L.; Han, L.; Yen, M.; Wang, Y.; Sun, N.; et al. Abnormal calcium handling properties underlie familial hypertrophic cardiomyopathy pathology in patient-specific induced pluripotent stem cells. Cell Stem Cell 2013, 12, 101–113. [Google Scholar] [CrossRef] [PubMed]
  7. Ojala, M.; Prajapati, C.; Pölönen, R.P.; Rajala, K.; Pekkanen-Mattila, M.; Rasku, J.; Larsson, K.; Aalto-Setälä, K. Mutation-specific phenotypes in hiPSC-derived cardiomyocytes carrying either myosin-binding protein C or α-tropomyosin mutation for hypertrophic cardiomyopathy. Stem Cells Int. 2016, 2016, 1684792. [Google Scholar] [CrossRef] [PubMed]
  8. Ramachandra, C.J.A.; Kp, M.M.J.; Chua, J.; Hernandez-Resendiz, S.; Liehn, E.A.; Knöll, R.; Gan, L.M.; Michaëlsson, E.; Jonsson, M.K.B.; Ryden-Markinhuhta, K.; et al. Inhibiting cardiac myeloperoxidase alleviates the relaxation defect in hypertrophic cardiomyocytes. Cardiovasc. Res. 2022, 118, 517–530. [Google Scholar] [CrossRef] [PubMed]
  9. Sakai, T.; Naito, A.T.; Kuramoto, Y.; Ito, M.; Okada, K.; Higo, T.; Nakagawa, A.; Shibamoto, M.; Yamaguchi, T.; Sumida, T.; et al. Phenotypic screening using patient-derived induced pluripotent stem cells identified Pyr3 as a candidate compound for the treatment of infantile hypertrophic cardiomyopathy. Int. Heart J. 2018, 59, 1096–1105. [Google Scholar] [CrossRef]
  10. Zhou, W.; Bos, J.M.; Ye, D.; Tester, D.J.; Hrstka, S.; Maleszewski, J.J.; Ommen, S.R.; Nishimura, R.A.; Schaff, H.V.; Kim, C.S.; et al. Induced Pluripotent Stem Cell–Derived Cardiomyocytes from a Patient with MYL2-R58Q-Mediated Apical Hypertrophic Cardiomyopathy Show Hypertrophy, Myofibrillar Disarray, and Calcium Perturbations. J. Cardiovasc. Transl. Res. 2019, 12, 394–403. [Google Scholar] [CrossRef]
  11. Guo, H.; Liu, L.; Nishiga, M.; Cong, L.; Wu, J.C. Deciphering pathogenicity of variants of uncertain significance with CRISPR-edited iPSCs. Trends Genet. 2021, 37, 1109–1123. [Google Scholar] [CrossRef] [PubMed]
  12. Liu, N.; Olson, E.N. CRISPR Modeling and Correction of Cardiovascular Disease. Circ. Res. 2022, 130, 1827–1850. [Google Scholar] [CrossRef] [PubMed]
  13. Nguyen, Q.; Lim, K.R.Q.; Yokota, T. Genome editing for the understanding and treatment of inherited cardiomyopathies. Int. J. Mol. Sci. 2020, 21, 733. [Google Scholar] [CrossRef]
  14. Mosqueira, D.; Mannhardt, I.; Bhagwan, J.R.; Lis-Slimak, K.; Katili, P.; Scott, E.; Hassan, M.; Prondzynski, M.; Harmer, S.C.; Tinker, A.; et al. CRISPR/Cas9 editing in human pluripotent stem cell-cardiomyocytes highlights arrhythmias, hypocontractility, and energy depletion as potential therapeutic targets for hypertrophic cardiomyopathy. Eur. Heart J. 2018, 39, 3879–3892. [Google Scholar] [CrossRef] [PubMed]
  15. Wang, L.; Kim, K.; Parikh, S.; Cadar, A.G.; Bersell, K.R.; He, H.; Pinto, J.R.; Kryshtal, D.O.; Knollmann, B.C. Hypertrophic cardiomyopathy-linked mutation in troponin T causes myofibrillar disarray and pro-arrhythmic action potential changes in human iPSC cardiomyocytes. J. Mol. Cell. Cardiol. 2018, 114, 320–327. [Google Scholar] [CrossRef] [PubMed]
  16. Yang, K.C.; Breitbart, A.; De Lange, W.J.; Hofsteen, P.; Futakuchi-Tsuchida, A.; Xu, J.; Schopf, C.; Razumova, M.V.; Jiao, A.; Boucek, R.; et al. Novel Adult-Onset Systolic Cardiomyopathy Due to MYH7 E848G Mutation in Patient-Derived Induced Pluripotent Stem Cells. JACC Basic Transl. Sci. 2018, 3, 728–740. [Google Scholar] [CrossRef] [PubMed]
  17. Cohn, R.; Thakar, K.; Lowe, A.; Ladha, F.A.; Pettinato, A.M.; Romano, R.; Meredith, E.; Chen, Y.S.; Atamanuk, K.; Huey, B.D.; et al. A Contraction Stress Model of Hypertrophic Cardiomyopathy due to Sarcomere Mutations. Stem Cell Rep. 2019, 12, 71–83. [Google Scholar] [CrossRef] [PubMed]
  18. Vander Roest, A.S.; Liu, C.; Morck, M.M.; Kooiker, K.B.; Jung, G.; Song, D.; Dawood, A.; Jhingran, A.; Pardon, G.; Ranjbarvaziri, S.; et al. Hypertrophic cardiomyopathy β-cardiac myosin mutation (P710R) leads to hypercontractility by disrupting super relaxed state. Proc. Natl. Acad. Sci. USA 2021, 118, e2025030118. [Google Scholar] [CrossRef] [PubMed]
  19. Bhagwan, J.R.; Mosqueira, D.; Chairez-Cantu, K.; Mannhardt, I.; Bodbin, S.E.; Bakar, M.; Smith, J.G.W.; Denning, C. Isogenic models of hypertrophic cardiomyopathy unveil differential phenotypes and mechanism-driven therapeutics. J. Mol. Cell. Cardiol. 2020, 145, 43–53. [Google Scholar] [CrossRef]
  20. Chai, A.C.; Cui, M.; Chemello, F.; Li, H.; Chen, K.; Tan, W.; Atmanli, A.; McAnally, J.R.; Zhang, Y.; Xu, L.; et al. Base editing correction of hypertrophic cardiomyopathy in human cardiomyocytes and humanized mice. Nat. Med. 2023, 29, 401–411. [Google Scholar] [CrossRef]
  21. Ma, N.; Zhang, J.Z.; Itzhaki, I.; Zhang, S.L.; Chen, H.; Haddad, F.; Kitani, T.; Wilson, K.D.; Tian, L.; Shrestha, R.; et al. Determining the pathogenicity of a genomic variant of uncertain significance using CRISPR/Cas9 and human-induced pluripotent stem cells. Circulation 2018, 138, 2666–2681. [Google Scholar] [CrossRef] [PubMed]
  22. Smith, J.G.W.; Owen, T.; Bhagwan, J.R.; Mosqueira, D.; Scott, E.; Mannhardt, I.; Patel, A.; Barriales-Villa, R.; Monserrat, L.; Hansen, A.; et al. Isogenic Pairs of hiPSC-CMs with Hypertrophic Cardiomyopathy/LVNC-Associated ACTC1 E99K Mutation Unveil Differential Functional Deficits. Stem Cell Rep. 2018, 11, 1226–1243. [Google Scholar] [CrossRef]
  23. Dementyeva, E.V.; Vyatkin, Y.V.; Kretov, E.I.; Elisaphenko, E.A.; Medvedev, S.P.; Zakian, S.M. Genetic analysis of patients with hypertrophic cardiomyopathy. Genes Cells 2020, 15, 68–73. [Google Scholar] [CrossRef]
  24. Bashyam, M.D.; Purushotham, G.; Chaudhary, A.K.; Rao, K.M.; Acharya, V.; Mohammad, T.A.; Nagarajaram, H.A.; Hariram, V.; Narasimhan, C. A low prevalence of MYH7/MYBPC3 mutations among Familial Hypertrophic Cardiomyopathy patients in India. Mol. Cell. Biochem. 2012, 360, 373–382. [Google Scholar] [CrossRef]
  25. Richard, P.; Charron, P.; Carrier, L.; Ledeuil, C.; Cheav, T.; Pichereau, C.; Benaiche, A.; Isnard, R.; Dubourg, O.; Burban, M.; et al. Hypertrophic cardiomyopathy: Distribution of disease genes, spectrum of mutations, and implications for a molecular diagnosis strategy. Circulation 2003, 107, 2227–2232. [Google Scholar] [CrossRef] [PubMed]
  26. Cheng, J.; Novati, G.; Pan, J.; Bycroft, C.; Žemgulyte, A.; Applebaum, T.; Pritzel, A.; Wong, L.H.; Zielinski, M.; Sargeant, T.; et al. Accurate proteome-wide missense variant effect prediction with AlphaMissense. Science 2023, 381, eadg7492. [Google Scholar] [CrossRef] [PubMed]
  27. Malakhova, A.A.; Grigor’eva, E.V.; Pavlova, S.V.; Malankhanova, T.B.; Valetdinova, K.R.; Vyatkin, Y.V.; Khabarova, E.A.; Rzaev, J.A.; Zakian, S.M.; Medvedev, S.P. Generation of induced pluripotent stem cell lines ICGi021-A and ICGi022-A from peripheral blood mononuclear cells of two healthy individuals from Siberian population. Stem Cell Res. 2020, 48, 101952. [Google Scholar] [CrossRef] [PubMed]
  28. Dementyeva, E.V.; Kovalenko, V.R.; Zhiven, M.K.; Ustyantseva, E.I.; Kretov, E.I.; Vyatkin, Y.V.; Zakian, S.M. Generation of two clonal iPSC lines, ICGi019-A and ICGi019-B, by reprogramming peripheral blood mononuclear cells of a patient suffering from hypertrophic cardiomyopathy and carrying a heterozygous p.M659I mutation in MYH7. Stem Cell Res. 2020, 46, 101840. [Google Scholar] [CrossRef] [PubMed]
  29. Burridge, P.W.; Matsa, E.; Shukla, P.; Lin, Z.C.; Churko, J.M.; Ebert, A.D.; Lan, F.; Diecke, S.; Huber, B.; Mordwinkin, N.M.; et al. Chemically defined generation of human cardiomyocytes. Nat. Methods 2014, 11, 855–860. [Google Scholar] [CrossRef]
  30. Guo, G.; Wang, L.; Li, X.; Fu, W.; Cao, J.; Zhang, J.; Liu, Y.; Liu, M.; Wang, M.; Zhao, G.; et al. Enhanced myofilament calcium sensitivity aggravates abnormal calcium handling and diastolic dysfunction in patient-specific induced pluripotent stem cell-derived cardiomyocytes with MYH7 mutation. Cell Calcium 2024, 117, 102822. [Google Scholar] [CrossRef]
  31. Shafaattalab, S.; Li, A.Y.; Gunawan, M.G.; Kim, B.; Jayousi, F.; Maaref, Y.; Song, Z.; Weiss, J.N.; Solaro, R.J.; Qu, Z.; et al. Mechanisms of arrhythmogenicity of hypertrophic cardiomyopathy-associated troponin T (TNNT2) variant I79N. Front. Cell Dev. Biol. 2021, 9, 787581. [Google Scholar] [CrossRef]
  32. Feyen, D.A.M.; McKeithan, W.L.; Bruyneel, A.A.N.; Spiering, S.; Hörmann, L.; Ulmer, B.; Zhang, H.; Briganti, F.; Schweizer, M.; Hegyi, B.; et al. Metabolic Maturation Media Improve Physiological Function of Human iPSC-Derived Cardiomyocytes. Cell Rep. 2020, 32, 107925. [Google Scholar] [CrossRef] [PubMed]
  33. Chen, Q.M.; Maltagliati, A.J. Nrf2 at the heart of oxidative stress and cardiac protection. Physiol. Genomics 2018, 50, 77–97. [Google Scholar] [CrossRef] [PubMed]
  34. Menezes Junior, A.D.S.; França-E-Silva, A.L.G.; Oliveira, H.L.; Lima, K.B.A.; Porto, I.O.P.; Pedroso, T.M.A.; Silva, D.M.E.; Freitas, A.F., Jr. Genetic mutations and mitochondrial redox signaling as modulating factors in hypertrophic cardiomyopathy: A scoping review. Int. J. Mol. Sci. 2024, 25, 5855. [Google Scholar] [CrossRef] [PubMed]
  35. Hesaraki, M.; Bora, U.; Pahlavan, S.; Salehi, N.; Mousavi, S.A.; Barekat, M.; Rasouli, S.J.; Baharvand, H.; Ozhan, G.; Totonchi, M. A Novel Missense Variant in Actin Binding Domain of MYH7 Is Associated With Left Ventricular Noncompaction. Front. Cardiovasc. Med. 2022, 9, 839862. [Google Scholar] [CrossRef] [PubMed]
  36. Antoniutti, G.; Caimi-Martinez, F.G.; Álvarez-Rubio, J.; Morlanes-Gracia, P.; Pons-Llinares, J.; Rodríguez-Picón, B.; Fortuny-Frau, E.; Torres-Juan, L.; Heine-Suner, D.; Ripoll-Vera, T. Genotype-Phenotype Correlation in Hypertrophic Cardiomyopathy: New Variant p.Arg652Lys in MYH7. Genes 2022, 13, 320. [Google Scholar] [CrossRef] [PubMed]
  37. Pavlova, S.V.; Shayakhmetova, L.S.; Pronyaeva, K.A.; Shulgina, A.E.; Zakian, S.M.; Dementyeva, E.V. Generation of Induced Pluripotent Stem Cell Lines ICGi022-A-3, ICGi022-A-4, and ICGi022-A-5 with p.Asn515del Mutation Introduced in MYBPC3 Using CRISPR/Cas9. Russ. J. Dev. Biol. 2023, 54, 96–103. [Google Scholar] [CrossRef]
  38. Watkins, H.; Ashrafian, H.; Redwood, C. Inherited cardiomyopathies. N. Engl. J. Med. 2011, 364, 1643–1656. [Google Scholar] [CrossRef] [PubMed]
  39. Ramachandra, C.J.A.; Mai Ja, K.P.M.; Lin, Y.-H.; Shim, W.; Boisvert, W.A.; Hausenloy, D.J. Induced pluripotent stem cells for modelling energetic alterations in hypertrophic cardiomyopathy. Cond. Med. 2019, 2, 142–151. [Google Scholar]
  40. Malgija, B.; Kumar, N.S.; Piramanayagam, S. Collective transcriptomic deregulation of hypertrophic and dilated cardiomyopathy—Importance of fibrotic mechanism in heart failure. Comput. Biol. Chem. 2018, 73, 85–94. [Google Scholar] [CrossRef]
  41. Pei, J.; Schuldt, M.; Nagyova, E.; Gu, Z.; El Bouhaddani, S.; Yiangou, L.; Jansen, M.; Calis, J.J.A.; Dorsch, L.M.; Blok, C.S.; et al. Multi-omics integration identifies key upstream regulators of pathomechanisms in hypertrophic cardiomyopathy due to truncating MYBPC3 mutations. Clin. Epigenet. 2021, 13, 61. [Google Scholar] [CrossRef] [PubMed]
  42. Xu, J.; Liu, X.; Dai, Q. Integration of transcriptomic data identifies key hallmark genes in hypertrophic cardiomyopathy. BMC Cardiovasc. Disord. 2021, 21, 330. [Google Scholar] [CrossRef] [PubMed]
  43. Wehrens, M.; de Leeuw, A.E.; Wright-Clark, M.; Eding, J.E.C.; Boogerd, C.J.; Molenaar, B.; van der Kraak, P.H.; Kuster, D.W.D.; van der Velden, J.; Michels, M.; et al. Single-cell transcriptomics provides insights into hypertrophic cardiomyopathy. Cell Rep. 2022, 39, 110809. [Google Scholar] [CrossRef] [PubMed]
  44. Lu, J.; Ren, J.; Liu, J.; Lu, M.; Cui, Y.; Liao, Y.; Zhou, Y.; Gao, Y.; Tang, F.; Wang, J.; et al. High-resolution single-cell transcriptomic survey of cardiomyocytes from patients with hypertrophic cardiomyopathy. Cell Prolif. 2024, 57, e13557. [Google Scholar] [CrossRef] [PubMed]
  45. Tanosaki, S.; Tohyama, S.; Kishino, Y.; Fujita, J.; Fukuda, K. Metabolism of human pluripotent stem cells and differentiated cells for regenerative therapy: A focus on cardiomyocytes. Inflamm. Regen. 2021, 41, 5. [Google Scholar] [CrossRef] [PubMed]
  46. Smolina, N.; Khudiakov, A.; Kostareva, A. Assaying Mitochondrial Respiration as an Indicator of Cellular Metabolism and Fitness. Methods Mol. Biol. 2023, 2644, 3–14. [Google Scholar] [CrossRef] [PubMed]
  47. Dementyeva, E.V.; Pavlova, S.V.; Chernyavsky, A.M.; Zakian, S.M. Generation of an induced pluripotent stem cell line, ICGi029-A, by reprogramming peripheral blood mononuclear cells of a patient suffering from hypertrophic cardiomyopathy and carrying a heterozygous p.N515del mutation in MYBPC3. Stem Cell Res. 2021, 53, 102344. [Google Scholar] [CrossRef]
  48. Sorogina, D.A.; Grigor’eva, E.V.; Malakhova, A.A.; Pavlova, S.V.; Medvedev, S.P.; Vyatkin, Y.V.; Khabarova, E.A.; Rzaev, J.A.; Zakian, S.M. Creation of Induced Pluripotent Stem Cells ICGi044-B and ICGi044-C Using Reprogramming of Peripheral Blood Mononuclear Cells of a Patient with Parkinson’s Disease Associated with c.1492T>G Mutation in the GLUD2 Gene. Russ. J. Dev. Biol. 2023, 54, 104–111. [Google Scholar] [CrossRef]
Ijms 25 08695 g001
Figure 1. Introducing p.M659I (c.1977G > A) variant in MYH7. (a) Design of single-guide RNA and single-stranded donor oligonucleotides for MYH7 editing. Nucleotide sequence of a part of MYH7 Intron 17 and Exon 18 is provided. The localization of protospacer for the single-guide RNA, PAM, and the single-stranded donor oligonucleotides is shown in grey, magenta, and yellow, respectively. Positions of the target c.1977G > A substitution and synonymous substitution in PAM are indicated with red rectangles. (b) One iPSC clone heterozygous at p.M659I (c.1977G > A) mutation in MYH7 was generated (ICGi022-A + MYH7 p.M659I). Nucleotide sequence of the same region in the ICGi022-A iPSC line used for MYH7 editing is provided for comparison. Positions of the target c.1977G > A substitution and synonymous substitution in PAM are indicated with red rectangles.
Figure 1. Introducing p.M659I (c.1977G > A) variant in MYH7. (a) Design of single-guide RNA and single-stranded donor oligonucleotides for MYH7 editing. Nucleotide sequence of a part of MYH7 Intron 17 and Exon 18 is provided. The localization of protospacer for the single-guide RNA, PAM, and the single-stranded donor oligonucleotides is shown in grey, magenta, and yellow, respectively. Positions of the target c.1977G > A substitution and synonymous substitution in PAM are indicated with red rectangles. (b) One iPSC clone heterozygous at p.M659I (c.1977G > A) mutation in MYH7 was generated (ICGi022-A + MYH7 p.M659I). Nucleotide sequence of the same region in the ICGi022-A iPSC line used for MYH7 editing is provided for comparison. Positions of the target c.1977G > A substitution and synonymous substitution in PAM are indicated with red rectangles.
Ijms 25 08695 g001
Ijms 25 08695 g002
Figure 2. Characteristics of the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7. (a) Positive expression of pluripotent state markers: the OCT4, NANOG, and SOX2 transcription factors and TRA-1-60 surface antigen in the iPSC line. Scale bar—100 µm. (b) The iPSC line can be spontaneously differentiated into derivatives of three germ layers: ectoderm (TUBB3, βIII-tubulin), mesoderm (αSMA, smooth muscle α-actin), and endoderm (CK18, cytokeratin 18). Scale bar—100 µm. (c) Expression level of OCT4, NANOG, and SOX2 in the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 (ICGi022-A + MYH7 p.M659I) is comparable to that in the ICGi022-A iPSC line used for MYH7 editing. (d) The iPSC line retains normal karyotype, 46,XX. (e) The iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 (+ MYH7 p.M659I) is not contaminated with mycoplasma. Control +, positive control for mycoplasma contamination.
Figure 2. Characteristics of the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7. (a) Positive expression of pluripotent state markers: the OCT4, NANOG, and SOX2 transcription factors and TRA-1-60 surface antigen in the iPSC line. Scale bar—100 µm. (b) The iPSC line can be spontaneously differentiated into derivatives of three germ layers: ectoderm (TUBB3, βIII-tubulin), mesoderm (αSMA, smooth muscle α-actin), and endoderm (CK18, cytokeratin 18). Scale bar—100 µm. (c) Expression level of OCT4, NANOG, and SOX2 in the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 (ICGi022-A + MYH7 p.M659I) is comparable to that in the ICGi022-A iPSC line used for MYH7 editing. (d) The iPSC line retains normal karyotype, 46,XX. (e) The iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 (+ MYH7 p.M659I) is not contaminated with mycoplasma. Control +, positive control for mycoplasma contamination.
Ijms 25 08695 g002
Ijms 25 08695 g003
Figure 3. Cardiomyocytes derived from the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 have enlarged size and elevated diastolic calcium level. (a) Examples of immunofluorescence staining of cardiomyocytes derived from two iPSC lines of healthy donors (ICGi021-A and ICGi022-A), the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 (ICGi022-A + MYH7 p.M659I), and iPSC line from the patient with the variant (ICGi019-B) with antibodies to sarcomeric α-actinin. Scale bar—50 µm. (b) Comparison of cardiomyocyte areas for the iPSC lines from healthy donors and with p.M659I (c.1977G > A) mutation in MYH7 (introduced with CRISPR/Cas9 or patient-specific). (c) Comparison of diastolic calcium level in cardiomyocytes derived from the iPSC lines of healthy donors and with p.M659I (c.1977G > A) mutation in MYH7 (introduced with CRISPR/Cas9 or patient-specific).
Figure 3. Cardiomyocytes derived from the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 have enlarged size and elevated diastolic calcium level. (a) Examples of immunofluorescence staining of cardiomyocytes derived from two iPSC lines of healthy donors (ICGi021-A and ICGi022-A), the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 (ICGi022-A + MYH7 p.M659I), and iPSC line from the patient with the variant (ICGi019-B) with antibodies to sarcomeric α-actinin. Scale bar—50 µm. (b) Comparison of cardiomyocyte areas for the iPSC lines from healthy donors and with p.M659I (c.1977G > A) mutation in MYH7 (introduced with CRISPR/Cas9 or patient-specific). (c) Comparison of diastolic calcium level in cardiomyocytes derived from the iPSC lines of healthy donors and with p.M659I (c.1977G > A) mutation in MYH7 (introduced with CRISPR/Cas9 or patient-specific).
Ijms 25 08695 g003
Ijms 25 08695 g004
Figure 4. Cardiomyocytes derived from the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 demonstrate disrupted energy metabolism and changes in expression pattern of HCM-related genes. (a) Comparison of oxygen consumption rate (OCR) in cardiomyocytes derived from the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 (ICGi022-A + MYH7 p.M659I) and the ICGi022-A iPSC line used for MYH7 editing. (b) Comparison of extracellular acidification rate (ECAR) in cardiomyocytes derived from the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 (ICGi022-A + MYH7 p.M659I) and the ICGi022-A iPSC line used for MYH7 editing. (c) Comparison of gene expression level in cardiomyocytes derived from the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 (ICGi022-A + MYH7 p.M659I) and the ICGi022-A iPSC line used for MYH7 editing.
Figure 4. Cardiomyocytes derived from the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 demonstrate disrupted energy metabolism and changes in expression pattern of HCM-related genes. (a) Comparison of oxygen consumption rate (OCR) in cardiomyocytes derived from the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 (ICGi022-A + MYH7 p.M659I) and the ICGi022-A iPSC line used for MYH7 editing. (b) Comparison of extracellular acidification rate (ECAR) in cardiomyocytes derived from the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 (ICGi022-A + MYH7 p.M659I) and the ICGi022-A iPSC line used for MYH7 editing. (c) Comparison of gene expression level in cardiomyocytes derived from the iPSC line with introduced p.M659I (c.1977G > A) mutation in MYH7 (ICGi022-A + MYH7 p.M659I) and the ICGi022-A iPSC line used for MYH7 editing.
Ijms 25 08695 g004
Table 1. Prediction for pathogenicity of p.M659I (c.1977G > A) variant in MYH7 based on the data of in silico analysis [23].
Table 1. Prediction for pathogenicity of p.M659I (c.1977G > A) variant in MYH7 based on the data of in silico analysis [23].
ToolScorePrediction
SIFT0.001Deleterious
PolyPhen2 HDIV0.957Damaging
PolyPhen2 HVAR0.996Damaging
MutationTaster1Deleterious
MutationAssessor2.815Medium deleterious probability
FATHMM−3.74Deleterious
PROVEAN−3.38Deleterious
fathmm-MKL0.992Deleterious
MetaSVM1.069Deleterious
MetaLR0.935Deleterious
Table 2. Oligonucleotides and antibodies used in the study.
Table 2. Oligonucleotides and antibodies used in the study.
Oligonucleotides
Gene/LocusProduct SizeNucleotide Sequence (5′-3′)
Protospacer for introducing p.M659I (c.1977G > A) mutationMYH7, Exon 1820 bGGGATGGGTGGAGCGCAAGT
Donor oligonucleotide with p.M659I (c.1977G > A) mutationMYH7, Exon 1889 bTATTGCATTTTTGGCCACAGGAAAATCTGAACAAGCTGATAACAAACTTGCGCTCCACCCATCCCCACTTTGTACGTTGTATCATCCCT
Donor oligonucleotide without p.M659I (c.1977G > A) mutationMYH7, Exon 1889 bTATTGCATTTTTGGCCACAGGAAAATCTGAACAAGCTGATGACAAACTTGCGCTCCACCCATCCCCACTTTGTACGTTGTATCATCCCT
Mutation analysisMYH7, Exon 18258 bpTCCTTCCTTCTTCTCCTCTCTT/GTGGTGGTAGGTAGGGAGAT
CRISPR/Cas9 off-target activity analysischr4:14217409-14217428559 bpTCTGGTAAGAGCCTGACTTCTG/TCCCACCTGCCATTGGAATA
chr7:57819587-57819606378 bpACGATACTCAAGGCCCAATCT/TGGTGTTTCCTCATCCTGGT
chr8:139343032-139343051535 bpGCCAGGAAAGTTCAGTGGTTAG/CCCTCTCTCTTCCTGCTCTTAT
chr20:9996001-9996020575 bpGACTTGTAATAACTCTCACTCACCTAAA/CCAGGCAATGTTAAGCCTTCAT
chr2:241709069-241709088541 bpTCCCGTGTGGATTTCTTTAGGT/TGTAGGCGTTCTGGATCTTCTG
Mycoplasma detection16S ribosomal RNA gene280 bpGGGAGCAAACAGGATTAGATACCCT/TGCACCATCTGTCACTCTGTTAACCTC
Reference genes (RT-qPCR)B2M90 bpTAGCTGTGCTCGCGCTACT/TCTCTGCTGGATGACGTGAG
GAPDH202 bpTGTTGCCATCAATGACCCCTT/CTCCACGACGTACTCAGCG
Pluripotency markers (RT-qPCR)OCT4144 bpGGGAGATTGATAACTGGTGTGTT/GTGTATATCCCAGGGTGATCCTC
NANOG116 bpTTTGTGGGCCTGAAGAAAACT/AGGGCTGTCCTGAATAAGCAG
SOX2100 bpGCTTAGCCTCGTCGATGAAC/AACCCCAAGATGCACAACTC
HCM-associated genes (RT-qPCR)NPPA95 bpGATAACAGCCAGGGAGGACAAG/CAAGATGACACAAATGCAGCAGAG
GATA499 bpCCTGTGAGTTGGAGACTTCTTT/CCTCGGTGCTAGAAACACAA
MEF2C117 bpCTGGTCTCACCTGGTAACTTGAAC/CTTGCTGCCTGGTGGAATAAGA
Sarcomere genes (RT-qPCR)MYH783 bpTCGTGCCTGATGACAAACAGGAGT/ATACTCGGTCTCGGCAGTGACTTT
MYL293 bpGGACCCTGAGGAAACCATTCT/GTCAGCATTTCCCGAACGTAATC
TNNT289 bpGGCCATTGACCACCTGAATGA/CGAACTTCTCTGCCTCCAAGTTATAG
Calcium homeostasis regulation genes (RT-qPCR)RYR286 bpGTTGCTCCATCGGCAGTATGA/CCTCCACGGACACACCATTTAT
ATP2A289 bpCCACGAGCTGTCAACCAAGATA/GTTGCTACCACCACTCCCATAG
PLN98 bpGCTGCCAAGGCTACCTAAA/CAGGACAGGAAGTCTGAAGTTT
Antioxidant defense genes (RT-qPCR)NFE2L2125 bpTCTGCCAACTACTCCCAGGT/AACGTAGCCGAAGAAACCTCA
SOD1194 bpCTAGCGAGTTATGGCGACGA/CTGCACTGGTACAGCCTGC
Antibodies
AntibodyDilutionCompany, Cat #, and RRID
Pluripotency markersMouse IgG2b anti-OCT3/41:50Santa Cruz Biotechnology, Dallas, TX, USA, Cat # sc-5279, RRID:AB_628051
Rabbit IgG anti-NANOG1:200ReproCELL, Yokohama, Japan, Cat # RCAB003P, RRID: AB_2714012
Rabbit IgG anti-SOX21:200Cell Signaling Technology, Danvers, MA, USA, Cat # 3579, RRID:AB_2195767
Mouse IgM anti-TRA-1-601:200Abcam, Cambridge, UK, Cat # ab16288, RRID:AB_778563
Markers of differentiated derivativesMouse IgG2a anti-TUBB31:500BioLegend, San Diego, CA, USA, Cat # 801201, RRID:AB_2313773
Mouse IgG2a anti-αSMA1:100Dako, Glostrup, Denmark, Cat # M0851, RRID:AB_2223500
Mouse IgG1 anti-CK181:100Abcam, Cambridge, UK, Cat # ab668, RRID:AB_305647
Cardiomyocyte markersMouse IgG1 anti-sarcomeric α-actinin1:200Abcam, Cambridge, UK, Cat # ab9465, RRID:AB_307264
Secondary antibodiesGoat anti-Mouse IgG (H + L) Secondary Antibody, Alexa Fluor 5681:400Thermo Fisher Scientific, Waltham, MA, USA, Cat # A11031, RRID:AB_144696
Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 4881:400Thermo Fisher Scientific, Waltham, MA, USA, Cat # A11008, RRID:AB_143165
Goat anti-Mouse IgM Heavy Chain Cross-Adsorbed Secondary Antibody, Alexa Fluor 5681:400Thermo Fisher Scientific, Waltham, MA, USA, Cat # A21043, RRID:AB_2535712
Goat anti-Mouse IgG2a Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 5681:400Thermo Fisher Scientific, Waltham, MA, USA, Cat # A21134, RRID:AB_2535773
Goat anti-Mouse IgG1 Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 4881:400Thermo Fisher Scientific, Waltham, MA, USA, Cat # A21121, RRID:AB_2535764
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pavlova, S.V.; Shulgina, A.E.; Zakian, S.M.; Dementyeva, E.V. Studying Pathogenetic Contribution of a Variant of Unknown Significance, p.M659I (c.1977G > A) in MYH7, to the Development of Hypertrophic Cardiomyopathy Using CRISPR/Cas9-Engineered Isogenic Induced Pluripotent Stem Cells. Int. J. Mol. Sci. 2024, 25, 8695. https://doi.org/10.3390/ijms25168695

AMA Style

Pavlova SV, Shulgina AE, Zakian SM, Dementyeva EV. Studying Pathogenetic Contribution of a Variant of Unknown Significance, p.M659I (c.1977G > A) in MYH7, to the Development of Hypertrophic Cardiomyopathy Using CRISPR/Cas9-Engineered Isogenic Induced Pluripotent Stem Cells. International Journal of Molecular Sciences. 2024; 25(16):8695. https://doi.org/10.3390/ijms25168695

Chicago/Turabian Style

Pavlova, Sophia V., Angelina E. Shulgina, Suren M. Zakian, and Elena V. Dementyeva. 2024. "Studying Pathogenetic Contribution of a Variant of Unknown Significance, p.M659I (c.1977G > A) in MYH7, to the Development of Hypertrophic Cardiomyopathy Using CRISPR/Cas9-Engineered Isogenic Induced Pluripotent Stem Cells" International Journal of Molecular Sciences 25, no. 16: 8695. https://doi.org/10.3390/ijms25168695

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop