Humanized L184Q Mutated Surfactant Protein C Gene Alters Alveolar Type 2 Epithelial Cell Fate

Abstract

Alveolar type 2 epithelial (AT2) cells synthesize surfactant protein C (SPC) and repair an injured alveolar epithelium. A mutated surfactant protein C gene (Sftpc^L184Q, Gene ID: 6440) in newborns has been associated with respiratory distress syndrome and pulmonary fibrosis. However, the underlying mechanisms causing Sftpc gene mutations to regulate AT2 lineage remain unclear. We utilized three-dimensional (3D) feeder-free AT2 organoids in vitro to simulate the alveolar epithelium and compared AT2 lineage characteristics between WT (C57BL/6) and Sftpc^L184Q mutant mice using colony formation assays, immunofluorescence, flow cytometry, qRT-PCR, and Western blot assays. The AT2 numbers were reduced significantly in Sftpc^L184Q mice. Organoid numbers and colony-forming efficiency were significantly attenuated in the 3D cultures of primary Sftpc^L184Q AT2 cells compared to those of WT mice. Podoplanin (PDPN, Alveolar type 1 cell (AT1) marker) expression and transient cell count was significantly increased in Sftpc^L184Q organoids compared to in the WT mice. The expression levels of CD74, heat shock protein 90 (HSP90), and ribosomal protein S3A1 (RPS3A1) were not significantly different between WT and Sftpc^L184Q AT2 cells. This study demonstrated that humanized Sftpc^L184Q mutation regulates AT2 lineage intrinsically. This regulation is independent of CD74, HSP90, and RPS3A1 pathways.

1. Introduction

Surfactant protein C (SPC), uniquely produced by alveolar type 2 (AT2) cells, is a critical molecule for respiratory health. It reduces alveolar surface tension, prevents alveolar collapse, and facilitates gas exchange [1]. The lung injury caused by bacterial or viral infections like influenza and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) kills AT2 and AT1 cells and impairs gaseous exchanges [2]. AT2 cell death correlates with reduced SPC levels [3]. AT2 cells are distal lung progenitor cells that proliferate and transdifferentiate into mature AT1 cells to regenerate the epithelial barrier and restore gaseous exchange [4,5]. Recent studies have reported that AT2 passes through a transition state to differentiate into mature AT1 cells. These transitional AT2 cells expressed elevated cell cycle arrest markers, downregulated AT2 markers, and modestly upregulated AT1 markers. These findings suggest that the accumulation of dysfunctional transitional AT2 cells with suppressed AT1 differentiation may be the specific regenerative defect underlying the pathogenesis of human IPF [6].

Mutations in the Sftpc gene, such as Sftpc^L188Q, Sftpc^I73T, and Sftpc^C121G, have been associated with neonatal respiratory distress syndrome (NRDS) and idiopathic pulmonary fibrosis (IPF) [7,8]. To date, more than 70 SPC mutations have been identified in IPF patients or children with childhood interstitial lung disease (chILD) [9]. In families carrying an SFTPC mutation, incidental cases of lung cancer have been reported [10]. SFTPC^L188Q (mutation analog to L184Q in mice), a mutation in the BRICHOS domain of precursor SPC protein (proSPC), inhibits its trafficking to the Golgi body for posttranslational modification. Mistrafficking induced degradation of mutant proSPC, resulting in a deficiency of mature functional SPC [11]. Expressions of Sftpc^L184Q mutation (equivalent to SFTPC^L188Q in humans) were associated with decreased lung regeneration in adult mice and disrupted the growth of AT2 cells in the lungs of neonatal mice, leading to a permanent reduction in the number of AT2 cells, which are the source of SPC in the lungs [11]. In our recent study, we found that surfactant proteins were reduced in exosomes derived from AT2 cells in the bronchoalveolar lavage (BAL) fluid of acute respiratory disease syndrome (ARDS) patients [12].

CD74 is expressed on the surface of AT2 cells and alveolar macrophages [13]. It has been approved as a biomarker for lung infections and diseases [14,15]. The expression of CD74 seems to be a double-edged sword in the lungs. On the one hand, CD74 levels increase in response to lung injuries and infections like coronavirus disease 2019 (COVID-19), suggesting a potential role in defense mechanisms [16,17]. On the other hand, some viruses like influenza can decrease CD74 in AT2 cells [18]. This complexity is further highlighted by the observation that AT2 cells in adenocarcinoma expressed high levels of CD74 [19].

HSP90 is a key player in inflammation, and HSP90 inhibition suppresses inflammation [20]. High HSP90 levels are linked to inflammatory lung diseases like systemic sclerosis, pulmonary fibrosis, and lung cancer [21,22,23,24]. HSP90 inhibition protected hamsters from SARS-CoV-2-induced lung injury [25]. HSP90 inhibitors 17-DMAG, 17-AAG, and AUY-922 effectively protected the lung from inflammation, restored pulmonary endothelial barrier function, and reduced lung fibrosis in mice [21,22,26,27].

RPS3A is a component of the eukaryotic 40S small ribosome subunit that serves as a chaperone and regulates protein translation [28,29]. High levels of RPS3A are linked to transformed cells and tumors [30,31]. Studies have shown that RPS3a can influence cell growth, differentiation, death (apoptosis), and response to drugs [32]. RPS3A was associated with the risk of coronary artery diseases in humans [33]. A recent study demonstrated that RPS3A is involved in lipopolysaccharide (LPS)-induced pro-inflammatory cytokine production in RAW264.7 cells, but there is no evidence for this connection in lung repair [29]. Therefore, the roles of CD74, HSP90, and RPS3A1 in lung health appear multifaceted, requiring further investigation to understand their impacts fully. All three of these pathways are known to be involved in inflammation and injury, as well as regulating cell proliferation and differentiation [20,29,34].

We hypothesize that Sftpc^L184Q reduces AT2 to AT1 transdifferentiation by halting AT2 cells in a transitional state and directing AT2 lineage during alveolar repair. Accumulation of transitional cells impairs lung repair and induces fibrosis. To model the deficiency of SPC in ARDS lungs, we utilized humanized mice carrying the Sftpc^L184Q mutation. To study the mechanism by which SPC deficiency alters the regenerative potential of AT2 cells, we compared the characteristics of WT and Sftpc^L184Q AT2 lineage in the lung organoid model.

2. Results

2.1. Sftpc ^L184Q Mutation Altered AT2 Yield and Marker Protein Expression In Vivo

To evaluate the effects of Sftpc^L184Q on the AT2 cell population in vivo, we compared epithelial cell adhesion molecule (EPCAM⁺, Gene ID: 4072) AT2 cells between WT (C57BL/6) and Sftpc^L184Q mice (Figure 1A). Our findings revealed a significantly (p < 0.05) reduced number of EPCAM⁺ AT2 cells in Sftpc^L184Q lungs compared to in WT control lungs (Figure 1B). The purity of AT2 cells was confirmed by immunofluorescence staining (Figure S4, Supplementary Materials). Western blot data showed a significant (p < 0.05) reduction in AT2 cell marker, proSPC expression, and elimination in mature SPC in Sftpc^L184Q lungs compared to WT control lungs (Figure 1C,F). In contrast, the expression level of another AT2 cell marker, surfactant protein B (SPB) was not altered (Figure 1D,G). The PDPN protein, a marker protein for AT1 cells, was significantly (p < 0.05) reduced in Sftpc^L184Q lungs compared to WT controls (Figure 1E,H). Full-sized blots are available as Figure S1 in Supplementary Materials.

2.2. Sftpc^L184Q Mutation Downregulated AT2 Lineage In Vitro

Given the SPC reduction in the harvested AT2 cells from Sftpc^L184Q mice, we reasoned that Sftpc^L184Q mutation regulates AT2 cell stemness. We isolated EPCAM⁺ AT2 cells from WT and Sftpc^L184Q mice and grew them as 3D organoids in matrigel (Figure 2A). Comparative analysis of brightfield images (Figure 2B–D) showed that Sftpc^L184Q AT2 had a significant reduction in proliferative organoids (p < 0.0001) and colony-forming efficiency (p < 0.0001) compared to WT cultures. As colony formation is characteristic of actively dividing cells, we evaluated EdU incorporation into the DNA of actively dividing AT2 cells in proliferative organoids. Sftpc^L184Q organoids contained a significantly lower number of EdU⁺ cells compared to WT controls (p < 0.0001, Figure 2E,F).

2.3. Sftpc^L184Q Disrupted Organoid Size and Structure

To identify the effects of reduced AT2 proliferation and transdifferentiation into AT1 on Sftpc^L184Q organoids’ sizes and structures, we performed confocal imaging of immunolabeled organoids. As observed in confocal images (Figure 3A) of proliferating organoids, Sftpc^L184Q organoids were smaller in size relative to WT organoids. The smaller Sftpc^L184Q organoids also possessed fewer SPB⁺ AT2 cells compared to larger WT organoids. Confocal images of differentiated organoids (Figure 3B) revealed a change in the structures of Sftpc^L184Q organoids. In comparison to WT organoids, Sftpc^L184Q organoids displayed a small lumen covered by a thick surface layer of transitional AT2 cells. In contrast, WT organoids displayed a larger lumen surrounded by a single layer of AT2 and differentiated AT1 cells. Western blot (Figure 3C,D) analysis demonstrated a significant increase in PDPN protein expression in Sftpc^L184Q organoids compared to WT organoids, possibly due to the accumulation of SPB⁺ and PDPN⁺ transitional AT2 cells. Interestingly, SPB protein levels were not significantly different between WT and Sftpc^L184Q organoids. Full-sized blots are available as Figure S2 in Supplementary Materials.

2.4. Sftpc^L184Q Halted Maturation of Transitional AT2 Cells into AT1 Cells

AT1 differentiation is a hallmark of alveolar regeneration. Given the effect of Sftpc^L184Q mutation on AT2 proliferation, we wanted to further confirm the implication of Sftpc^L184Q mutation on AT2 transdifferentiation into AT1 in the 3D organoid model; therefore, we checked the effect of mutated proSPC and deficiency of mature SPC on AT2 proliferation and AT1 differentiation in organoids. We dissociated differentiated organoid colonies into single cells and labeled them with AT2 and AT1 markers, i.e., SPB and RAGE-specific antibodies, and subjected them to flow cytometry to analyze AT2 lineages (Figure 4A). Analysis of flow cytometry results demonstrated that most of the cells in both WT and Sftpc^L184Q groups differentiated into AT1 and transitional cells. Only a few AT2 cells were observed. Sftpc^L184Q organoids had significantly reduced RAGE⁺ AT1 (p < 0.001) cell counts compared to WT organoids (Figure 4B–D). Intriguingly, we observed a significant increase in the SPB⁺ RAGE⁺ transitional AT2 cell (p < 0.001) count in Sftpc^L184Q organoids compared to WT organoids (Figure 4D).

2.5. Sftpc^L184Q Did Not Alter CD74, HSP90, or RPS3A1 Expression in Organoids

The mechanisms of AT2 proliferation and differentiation are closely related to lung inflammation and injury. Given the associations of CD74, HSP90, and RPS3A1 expression and function in inflammation and injury, we assessed the expression levels of these three proteins in AT2 cells. Intriguingly, the Sftpc^L184Q mutation demonstrated no significant differences in the mRNA and protein levels of CD74, HSP90, and RPS3A1 compared to the WT control. CD74 and RPS3A1 protein levels were reduced in Sftpc^L184Q organoids compared to WT organoids, but the differences were not significant (Figure 5A–H). Interestingly, we observed reduced expression levels of CD74 and RPS3A1 mRNA in Sftpc^L184Q organoids compared to those in the WT controls, but the differences were insignificant. Full-sized blots are available as Figure S3 in Supplementary Materials.

3. Discussion

This study suggests that 3D organoids derived from AT2 cells harboring the Sftpc^L184Q mutation can serve as a human disease model to reveal how this mutation can lead to human AT2 dysfunction and provide a platform for testing potential treatments for the disease. Previous studies found that constitutive expression of SftpcL^184Q disrupts the growth of AT2 cells in the lungs of neonatal mice. This leads to a permanent reduction in the number of AT2 cells, which are important for lung repair in adult life [11]. Our findings from adult mice demonstrated that Sftpc^L184Q-mutated lungs possess a significantly reduced number of AT2 cells compared to WT control lungs. Studies in mice with Sftpc ^Δexon4.transgene or the Sftpc^C121G allele showed death of AT2 cells, abnormal lung development, and death shortly after birth [35]. However, in humans, mutated SPC did not involve postnatal death [11]. Our adult Sftpc^L184Q mouse model exhibits suppressed mutated proSPC protein and lacks processed SPC, recapitulating the misprocessing occurring in vivo in humans [11].

The mutation of the Sftpc gene can have significant consequences for lung health [36]. This study examined how the Sftpc^L184Q mutation influences AT2 cell lineage. Organoids originating from Sftpc^L184Q AT2 cells displayed significant reductions in colony numbers and colony-formation efficiency. Sftpc^L184Q mutation disrupts AT2 proliferation and transdifferentiation processes, leading to fewer mature AT1 cells and accumulation of transient AT2 cells compared to in WT control organoids. Furthermore, our in vitro EdU incorporation assay data reinforce this concept, and our observations are consistent with previous research indicating decreases in AT2 cell expansion and AT1 differentiation in postnatal Sftpc^L184Q lungs and organoid models [11]. They reported that treatment with antioxidants restored AT1 differentiation in Sftpc^L184Q-mutated organoids, to levels comparable to WT controls [11]. This suggests that aberrant Sftpc gene expression may cause increased oxidative stress within AT2 cells [11]. These mature SPC-deficient cells might represent an intermediate stage in the alveolar epithelium’s physiological or pathological renewal process.

To understand the underlying mechanism regulating SPC-mediated AT2 proliferation and differentiation, we compared the expression levels of CD74, HSP90, and RPS3A1 proteins between WT and Sftpc^L184Q organoids. CD74, HSP90, and RPS3A1 serve as protein-folding chaperones and are known to be involved in inflammation, injury, and regulating cell proliferation and differentiation [20,29,34]. Influenza infection reduced CD74 and proSPC expression in mice lungs [18]. Hydroxychloroquine (a drug used for ILD therapy) increased the expression level of HSP90 by 81% in Sftpc^I73T mutant MLE-12 cells [37]. IPF patients and a mouse model of pulmonary fibrosis overexpressed RPS3A1 [38]. Therefore, we investigated the expression levels of CD74, HSP90, and RPS3A1 in organoids to reveal their significance in AT2 cell proliferation and differentiation. Intriguingly, our RT-PCR and immunoblotting data revealed no significant differences in the expression levels of CD74, HSP90, and RPS3A1 between Sftpc^L184Q and WT AT2 organoids. Our study suggests that additional cellular chaperones may play roles in protein folding within lung cells. These chaperones would help in ensuring that proSPC folds correctly and undergoes maturation to produce functional SPC. Currently, little is known about how chaperones like HSP70, calreticulin, and calnexin function in this process. Furthermore, the potential involvement of the immune system in re-alveolarization cannot be excluded. Stressed AT2 cells might trigger an immune response that contributes to lung fibrosis associated with SPC deficiency. This study sheds light on the role of the SPC in AT2 lineage regulation in Sftpc^L184Q mutant organoids. However, immunofluorescent tracking in vivo is necessary to assess Sftpc^L184Q AT2 lineage directly. The precise mechanism by which Sftpc^L184Q regulates alveolar regeneration remains an intriguing area for further investigation. This understanding of mechanisms could identify potential therapeutic targets for the treatment of ARDS and other lung diseases.

4. Materials and Methods

4.1. Animals

The wild-type (WT) C57BL/6j mice were obtained from Jackson Laboratory (The Jackson Laboratory, Bar Harbor, ME USA). The Sftpcl^184Q mutant mice, bred on a C57BL/6j background, were sourced from Dr. Timothy E. Weaver and Dr. Jeffrey A. Whitsett’s lab in the Department of Pediatrics at Cincinnati Children’s Hospital Medical Center. All mice were housed in a pathogen-free facility with a 12 h light/dark cycle, and they had ad libitum access to food and water. Paired WT and Sftpc^L184Q mutant mice, age-matched (2–4 months), both male and female, were used for experiments. These procedures were conducted following approval from the Institutional Animal Care and Use Committees of the University of Texas Health Science Center in Tyler and Loyola University Health Sciences Division in Chicago.

4.2. Fluorescence-Activated Cell Sorting (FACS) Mediated AT2 Cell Isolation

AT2 cells from mice were isolated as published previously [39]. Briefly, mice were anesthetized with Ketamine/Xylazine (100/8.5 mg/kg), and the mice were exsanguinated. Subsequently, the lungs were perfused with Dulbecco’s phosphate-buffered saline (DPBS, Gibco, Grand Island, NY, USA #14190250) to eliminate blood. Then, lungs were infused with 1.5 mL of 50 U/mL dispase (Corning Inc., Corning, NY, USA#354235) solution through the trachea, followed by a low-melting-point agarose to prevent dispase solution leakage. The lungs were then further incubated in 3 mL of 50 U/mL dispase solution for 45 min at 25 °C. After enzymatic digestion, cells were released from the lung by delicately teasing it in advanced DMEM/F12 (Gibco, Grand Island, NY, USA #12634010) containing 0.01% DNase I (Sigma-Aldrich, St. Louis, MO, USA #DN25). Digested lungs were passed through 100 μm, 40 μm, and 10 μm strainers, and single cells were collected. Cells were labeled with biotin-conjugated CD16/32 (BD Biosciences #553143), CD45 (BD Biosciences #553078), and TER110 (BD Biosciences #553672) antibodies. Streptavidin-coated magnetic beads (Invitrogen, Carlsbad, CA, USA #65601) were employed to negatively select AT2 cells. To enhance the purity and viability of AT2 cells, the cells were labeled with AF488-conjugated CD326/EpCAM antibody (Biolegend, San Diego, CA, USA #118210) and 7-AAD (Invitrogen, Carlsbad, CA, USA #A1310) viability dye. Subsequently, FACS was employed to sort EpCAM⁺ and 7-AAD⁻ AT2 cells, ensuring a collection with over 98% viability and purity. FlowJo v10.9 software was used to analyze FACS data. Unstained and single-color-stained samples were used as controls for gating.

4.3. Feeder-Free Culture of Alveolar Organoids

Feeder-free alveolar organoids were cultured as published previously [40]. EpCAM⁺ AT2 cells were combined with growth factor-reduced Matrigel (Corning Inc., Corning, NY, USA #354230), diluted 1:1 with organoid growth medium (AMM) [40]. Then, 60 μL of the cell suspension (30–100 cells/μL) was added to the apical chamber of transwell inserts (Corning Inc., Corning, NY, USA #3470), or 150 μL suspension was added into a well of a 6-well plate, to form 10 droplets. After a 30 min incubation at 37 °C for the matrix to solidify, 500 µL or 1500 μL of AMM with 10ng/mL IL-1β (Biolegend, San Diego, CA, USA #575102) and 10µM Y-27632 (Selleckchem, PA, USA #S1049) was introduced into the bottom well of the transwell, or into the well of the 6-well plate. Following four days of incubation, the medium was switched to AMM without IL-1β and Y-27632 and subsequently changed every 3 days. For AT1 differentiation, AMM was substituted with organoid differentiation medium (ADM) on the tenth day [40]. After a 10-day proliferation period and a 7-day differentiation phase, colonies were observed, and brightfield images were captured using an Evos XL core microscope (Life Technologies, Carlsbad, CA, USA) with a 2× microscope objective. The colony number and colony-forming efficiency of organoids were analyzed using ImageJ software [41]. Organoids were counted manually using the multi-point plugin in ImageJ. The CFE was calculated by dividing the number of colonies formed in each well by the number of cells initially seeded in the well (2000) and multiplying by 100. Five wells per group were analyzed for their organoid counts. Each dot in the scatter dot plot represents one well.

4.4. Western Blotting

Western blotting was performed using standard methods. Protein lysates were prepared from lung tissue, and organoids or AT2 cells in ice cold RIPA buffer and protein concentrations were determined using a BCA protein assay (Pierce, ThermoFisher Scientific, Waltham, MA, USA #23225). The protein samples were then separated using SDS-PAGE gel. Proteins were transferred to PVDF membranes and detected with anti-SPB rabbit polyclonal antibody (ThermoFisher Scientific, Waltham, MA, USA #PA5-42000, 1:1000), anti-PDPN Syrian hamster mouse antibody (Invitrogen, Carlsbad, CA, USA #MA516113, 1:1000), anti-proSPC rabbit antibody (Millipore, Bedford, MA, USA #AB3786, 1:500) and anti-β-actin mouse monoclonal antibody (Santa Cruz Biotechnology, Dallas, TX, USA #sc-47778, 1:1000). HRP-conjugated goat anti-mouse IgG (Jackson ImmunoResearch, West Grove, PA, USA #115-035-147, 1:10,000), mouse anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA, USA #211-032-171, 1:10,000), and goat anti-Syrian hamster IgG (Jackson ImmunoResearch, West Grove, PA, USA #107-035-142, 1:10,000) were used as the secondary antibodies. Blots were visualized with chemiluminescence (Millipore, Bedford, MA, USA #WBKLS0500) using a Bio-Rad Chemidoc imaging system (Bio-Rad, CA, USA). Images were analyzed using the Gel plugin under the Analyze tab in ImageJ software. Briefly, protein bands in the images were selected, and lanes were plotted. The Straight Line tool was used to connect the bottoms of the plotted lanes. Finally, the Wand tool was used to quantify the area of the plotted lanes. The band density values of the marker protein were normalized to β-actin. Results were plotted using GraphPad Prism 10 software.

4.5. Immunofluorescence Staining

Immunofluorescence staining and imaging were performed using standard methods. Briefly, organoids were fixed in 4% paraformaldehyde for 1 h, and then blocked and permeabilized with a solution containing 3% BSA (Sigma-Aldrich, St. Louis, MO, USA #A2153), 0.3% Triton x100 (Sigma-Aldrich, St. Louis, MO, USA #T8787), and 5% goat serum (Gibco, Grand Island, NY, USA #PCN5000). Then, organoids were incubated with primary antibodies specific to AT2 and AT1 markers, including anti-SPB rabbit polyclonal antibody (Invitrogen, Carlsbad, CA, USA #PA5-42000, 1:200) and anti-PDPN Syrian hamster mouse antibody (Invitrogen, Carlsbad, CA, USA #MA516113, 1:500). Fluorochrome-conjugated secondary antibodies, AF 488 goat anti-rabbit (Jackson ImmunoResearch, PA, USA #111-545-045, 1:500) and AF647 goat anti-Syrian hamster (Invitrogen, Carlsbad, CA, USA #A-21451, 1:1000) were used to detect primary antibodies. Finally, DAPI (1:1000) was added to detect nuclei. The organoids were mounted on slides with a spacer using a self-setting aqueous mounting medium (Electron Microscopy Sciences, PA, USA Cat #17985-10). Images were captured using a TCS5 Leica multiphoton confocal microscope (Leica Camera AG, Wetzlar, Germany). Subsequently, all images were processed and analyzed using ImageJ software.

4.6. Flow Cytometry

Organoids were dissociated enzymatically with TrypLETM Select (Gibco, Grand Island, NY, USA #12563-029) and passed through a 40 µm cell strainer to prepare a single-cell suspension. Cells were incubated with anti-SPB rabbit polyclonal antibody (Thermo Fisher Scientific, Waltham, MA, USA #PA5-42000, 1 µg/million cells) and AF647-conjugated anti-RAGE antibody (R & D systems, Minneapolis, MN, USA FAB11795R, 1 µg/million cells). AF488-conjugated goat anti-rabbit secondary antibody (Jackson ImmunoResearch, West Grove, PA, USA #111-545-045) was used to detect the SPB signal. Antibody-labeled cells were analyzed on a BD Fortessa flow cytometer (BD Biosciences, San Jose, CA, USA). Unstained and single-color-stained samples were used as controls for gating. Data were analyzed using FlowJo v10.9 software.

4.7. EdU Labeling of Proliferating AT2 Cells

To identify actively proliferating AT2 cells in organoids, we performed an EdU incorporation assay using a Click-iT 5–ethynyl–2–deoxyuridine (EdU) kit (Invitrogen, Carlsbad, CA, USA C10499). EdU (10 mM) was added to the organoid culture for 3 h, and then organoids were fixed with 4% paraformaldehyde. Then, organoids were permeabilized and processed for subsequent staining, following the kit’s instructions. Confocal microscope images were captured and analyzed to determine the percentages of EdU-positive cells. The z-sections of an entire organoid were stacked to count the total (Hoechst-stained nucleus) and EdU⁺ cells (AF488 signal) using the multi-point plugin for ImageJ. The percentage (%) of EDU+ cells was calculated by dividing the number of EDU+ cells by the total number of cells in that organoid and multiplying by 100.

4.8. Quantitative Reverse Transcriptase PCR

We analyzed the expression levels of CD74, HSP90, and RPS3A1 mRNA in 3D organoids using qRT-PCR. Total RNA was isolated using RNeasy Micro Kit (Qiagen, Qiagen, Hilden, Germany #74004) from organoid cultures, and 1 μg RNA was used to prepare cDNA using iScript™ Reverse Transcription Supermix (Bio-Rad, CA, USA #1708840). SYBR chemistry (Bio-Rad, CA, USA #1725270) was used to detect gene amplification. GAPDH expression was used as an internal control. Primer sequences are given in

Table 1. Primer sequences.

	Forward	Reverse
CD74	GCTGGATGAAGCAGTGGCTCTT	GATGTGGCTGACTTCTTCCTGG
RPS3A1	GGTACGATGTGAAAGCTCCAGC	GGCTCACTTCAAACACACGACC
GAPDH	CATCACTGCCACCCAGAAGACTG	ATGCCAGTGAGCTTCCCGTTCAG

, below. Fold changes were analyzed using the delta-delta CT method.

4.9. Statistics Analysis

All results are reported as mean ± SD. Comparisons between WT and Sftpc^L184Q mice were made using non-parametric 2-tailed Mann-Whitney U tests, with p < 0.05 considered significant. Statistical tests were conducted using GraphPad Prism10 software.

5. Conclusions

In conclusion, Sftpc^L184Q mutation appears to halt AT2 cells in a transitional state, affecting both AT2 proliferation and AT1 transdifferentiation. This regulation is independent of the CD74, HSP90, and RPS3A1 pathways. Immunofluorescent tracking in vivo is necessary to assess Sftpc^L184Q AT2 lineage directly. Further research into the molecular mechanisms governed by Sftpc^L184Q in regulating AT2 lineages in lung repair is needed.