Combined Analysis of Metabolomics and Transcriptome Revealed the Effect of Bacillus thuringiensis on the 5th Instar Larvae of Dendrolimus kikuchii Matsumura
Abstract
1. Introduction
2. Results
2.1. Bt Has Toxic Effect on the 5th Instar Larvae of D. kikuchii
2.2. With Prolongation of Bt Infection Time, the Midgut Membrane Tissue of D. kikuchii Langbianensis Festered and Liquefied
2.3. After Bt Infection, MDA Content Decreased, CAT, SOD and GPx Enzyme Activities Increased
2.4. The Analysis of Pathological Characteristics Showed That the Cell Structure of Midgut Tissue of Larvae Was Damaged After Bt Infection
2.5. Screening of Differential Metabolites and KEGG Enrichment Analysis
2.6. Transcriptome Sequencing Results Analysis
2.7. Correlation Analysis of Transcriptome and Metabolomics
2.8. RT-qPCR Verification
3. Discussion
4. Materials and Methods
4.1. Dendrolimus kikuchii Matsumura
4.2. Bacillus thuringiensis
4.3. Mortality Analysis and Anatomical Observation of Midgut Tissue
4.4. Sample Collection
4.5. MDA Content Change and Enzyme Activity Determination
4.6. Identification and Analysis of Midgut Metabolites
4.7. Transcriptome Library Construction and Sequencing Data Analysis
4.8. Real-Time Fluorescence Quantitative PCR Verification
4.9. Transcriptional Metabolic Correlation Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chen, C. Integrated Management of Dendrolimus punctatus; China Forestry Publishing House: Beijing, China, 1990; pp. 5–8. [Google Scholar]
- Hou, T. Dendrolimus punctatus China; China Science Publishing&media Ltd.: Beijing, China, 1987; pp. 32–34. [Google Scholar]
- Cao, X. Population Dynamic and Monitoring Forecasting Techniques of Dendrolimus houi Lajonquière and D. kikuchii Matsumura. Ph.M. Thesis, Shandong Agricultural University, Taian, China, 2017. [Google Scholar]
- Zhou, J.; Wu, P.; Xiong, Z.; Liu, N.; Zhao, N.; Ji, M.; Qiu, Y.; Yang, B. Chromosome-level genome assembly reveals significant gene expansion in the toll and IMD signaling pathways of Dendrolimus kikuchii. Front. Genet. 2021, 12, 728418. [Google Scholar] [CrossRef] [PubMed]
- Sun, C. Geographic Variations of Sex Pheromone Components inPine Caterpillar Moths, Dendrolimus puncatus and Dendrolimus kikuchii (Lepidoptera: Lasiocampidae). Ph.M. Thesis, Chinese Academy of Forestry, Beijing, China, 2018. [Google Scholar]
- Yu, H. Effects of Bacillus thuringiensis on pathogenicity and growing development of Mythimna separata (Walker). J. Northeast Agric. Univ. 2021, 52, 21–28. [Google Scholar]
- Tong, Q.; Liu, H. Research advances of Dendrolimus kikuchii. For. Pest Dis. 2009, 28, 23–26+32. [Google Scholar]
- Nie, Z.; Xiong, Z.; Wang, J.; Chen, X.; Zhang, S.; Xiong, Z. Observation of Morphological Characteristics of Dendrolimu kikuchii. J. Southwest Univ. (Nat. Sci. Ed.) 2019, 41, 15–20. [Google Scholar]
- Gutiérrez-Moreno, R.; Mota-Sanchez, D.; Blanco, C.A.; Whalon, M.E.; Terán-Santofimio, H.; Rodriguez-Maciel, J.C.; DiFonzo, C. Field-evolved resistance of the fall armyworm (Lepidoptera: Noctuidae) to synthetic insecticides in Puerto Rico and Mexico. J. Econ. Entomol. 2019, 112, 792–802. [Google Scholar] [CrossRef]
- Park, M.G.; Choi, J.Y.; Kim, J.H.; Park, D.H.; Wang, M.; Kim, H.J.; Kim, S.H.; Lee, H.Y.; Je, Y.H. Isolation and molecular characterization of Bacillus thuringiensis subsp. kurstaki toxic to lepidopteran pests Spodoptera spp. and Plutella xylostella. Pest Manag. Sci. 2022, 78, 2976–2984. [Google Scholar]
- Gahramanova, G.; Mamay, M.; Mammadov, Z. Biological characteristics and efficacy of Bacillus thuringiensis var. thuringiensis against the cotton leaf roller, Syllepte derogata (Fabricius, 1775) (Lepidoptera: Crambidae). Egypt. J. Biol. Pest Control 2020, 30, 85. Available online: https://link.springer.com/article/10.1186/s41938-020-00289-y. (accessed on 3 November 2024).
- Valtierra-de-Luis, D.; Villanueva, M.; Berry, C.; Caballero, P. Potential for Bacillus thuringiensis and other bacterial toxins as biological control agents to combat dipteran pests of medical and agronomic importance. Toxins 2020, 12, 773. [Google Scholar] [CrossRef]
- Schnepf, E.; Crickmore, N.; Van Rie, J.; Lereclus, D.; Baum, J.; Feitelson, J.; Zeigler, D.; Dean, D. Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 1998, 62, 775–806. [Google Scholar] [CrossRef]
- Crickmore, N.; Zeigler, D.; Feitelson, J.; Schnepf, E.; Van Rie, J.; Lereclus, D.; Baum, J.; Dean, D. Revision of the nomenclature for the Bacillus thuringiensis pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 1998, 62, 807–813. [Google Scholar] [CrossRef]
- Wu, J.; Wei, L.; He, J.; Fu, K.; Li, X.; Jia, L.; Wang, R.; Zhang, W. Characterization of a novel Bacillus thuringiensis toxin active against Aedes aegypti larvae. Acta Tropica 2021, 223, 106088. [Google Scholar]
- Bravo, A.; Gill, S.S.; Soberón, M. Mode of action of Bacillus thuringiensis Cry and Cyt toxins and their potential for insect control. Toxicon 2007, 49, 423–435. [Google Scholar] [PubMed]
- Gill, S.S.; Cowles, E.A.; Pietrantonio, P.V. The mode of action of Bacillus thuringiensis endotoxins. Annu. Rev. Entomol. 1992, 37, 615–636. [Google Scholar]
- Bravo, A.; Likitvivatanavong, S.; Gill, S.S.; Soberón, M. Bacillus thuringiensis: A story of a successful bioinsecticide. Insect Biochem. Mol. Biol. 2011, 41, 423–431. [Google Scholar]
- Tabashnik, B.E.; Carrière, Y. Surge in insect resistance to transgenic crops and prospects for sustainability. Nat. Biotechnol. 2017, 35, 926–935. [Google Scholar] [CrossRef] [PubMed]
- Melo, A.L.d.A.; Soccol, V.T.; Soccol, C.R. Bacillus thuringiensis: Mechanism of action, resistance, and new applications: A review. Crit. Rev. Biotechnol. 2016, 36, 317–326. [Google Scholar]
- Christou, P.; Capell, T.; Kohli, A.; Gatehouse, J.A.; Gatehouse, A.M. Recent developments and future prospects in insect pest control in transgenic crops. Trends Plant Sci. 2006, 11, 302–308. [Google Scholar]
- Shrestha, R.; Jakka, S.; Gassmann, A. Response of Cry3Bb1-resistant western corn rootworm (Coleoptera: Chrysomelidae) to Bt maize and soil insecticide. J. Appl. Entomol. 2018, 142, 937–946. [Google Scholar] [CrossRef]
- Meissle, M.; Kloos, S.; Romeis, J. Fate of multiple Bt proteins from stacked Bt maize in the predatory lady beetle Harmonia axyridis (Pallas) (Coleoptera: Coccinellidae). Environ. Pollut. 2021, 268, 115421. [Google Scholar]
- Han, B.; Cao, B.; Yang, Y.; Wang, X.; Geng, L.; Diao, Q.; Dai, P. Effects of Bt Cry78Ba1 toxin on larvae and adults of Apis mellifera (Hymenoptera: Apidae). J. Econ. Entomol. 2021, 114, 403–408. [Google Scholar] [CrossRef]
- Nascimento, P.T.; Fadini, M.A.; Rocha, M.S.; Souza, C.S.; Barros, B.A.; Melo, J.O.; Von Pinho, R.G.; Valicente, F.H. Response of Trichogramma pretiosum females (Hymenoptera: Trichogrammatidae) to herbivore-induced Bt maize volatiles. Arthropod Plant Interact. 2021, 15, 107–125. Available online: https://link.springer.com/article/10.1007/s11829-020-09801-5 (accessed on 3 November 2024).
- Li, Y.; Wang, C.; Ge, L.; Hu, C.; Wu, G.; Sun, Y.; Song, L.; Wu, X.; Pan, A.; Xu, Q. Environmental behaviors of Bacillus thuringiensis (Bt) insecticidal proteins and their effects on microbial ecology. Plants 2022, 11, 1212. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Reyes, U.J.; Jones, R.W.; Raszick, T.J.; Ruiz-Arce, R.; Sword, G.A. Potential distribution of wild host plants of the boll weevil (Anthonomus grandis) in the United States and Mexico. Insects 2022, 13, 337. [Google Scholar] [CrossRef] [PubMed]
- Sauka, D.H.; Peralta, C.; Pérez, M.P.; Molla, A.; Fernandez-Göbel, T.; Ocampo, F.; Palma, L. Bacillus thuringiensis Bt_UNVM-84, a Novel Strain Showing Insecticidal Activity against Anthonomus grandis Boheman (Coleoptera: Curculionidae). Toxins 2023, 16, 4. [Google Scholar] [CrossRef] [PubMed]
- Xing, Y.; Thanasirungkul, W.; Adeel, M.M.; Yu, J.; Aslam, A.; Chi, D. Identification and analysis of olfactory genes in Dioryctria abietella based on the antennal transcriptome. Comp. Biochem. Physiol. D Genom. Proteom. 2021, 38, 100814. [Google Scholar]
- Wang, Q.; Chi, D. Insecticidal Effects of Bacillus thuringiensis subsp. Aizawai and Pyemotes zhonghuajia on Dioryctria abietella. J. Northeast For. Univ. 2023, 51, 146–154. [Google Scholar]
- Wei, H.; Tan, S.; Cao, Y.; Wu, J.; Li, K.; Shu, C.; Yin, J. Pathological changes in the midgut of Holotrichia parallela larvae after feeding on HD8E and HD8G. Chin. J. Appl. Entomol. 2017, 54, 1015–1022. [Google Scholar]
- Heckel, D.G. How do toxins from Bacillus thuringiensis kill insects? An evolutionary perspective. Arch. Insect Biochem. Physiol. 2020, 104, e21673. [Google Scholar] [CrossRef]
- Zhang, Y.; Liang, G.; Zhang, L.; Wei, J. Pathological changes in midgut tissues of larvae of the cotton bollworm, Helicoverpa armigera (Lepidoptera: Noctuidae), after feeding Vip3Aa protein. Acta Entomol. Sin. 2012, 55, 869–876. [Google Scholar]
- Song, J.; Wang, R.; Du, L.; Cao, W.; Zhang, H.; Wang, J.; Fen, S.; Zhang, J.; Song, F. Symptoms of Anomala corpulenta and A. exolete (Coleoptera: Rutelidae) larvae infected by Bt HBF-1 strain and histopathological changes in their midguts. Acta Entomol. Sin. 2008, 10, 1083–1088. [Google Scholar]
- Han, Q.; Zeng, H. Pathological changes in larval midgut tissues of the cotton bollworm, Helicoverpa armigera, after feeding transgenic tobacco expressing dsRNA of HaHR3. J. Plant Prot. 2014, 42, 473–474. [Google Scholar]
- Wang, X.; Chen, R.; Xing, Y.; Sun, J.; Chen, H.; Xie, D.; Jia, N.; Chi, D. Microbiome and electron microscopy analyses of the mechanisms underlying the effects of Bacillus thuringiensis on Dioryctria abietella. Biol. Control. 2023, 184, 105283. Available online: https://www.sciencedirect.com/science/article/pii/S1049964423001366 (accessed on 3 November 2024). [CrossRef]
- Khanh-Van, H. Toxicometabolomic profiling of resistant and susceptible western corn rootworm larvae feeding on Bt maize seedlings. Sci. Rep. 2022, 12, 11639. [Google Scholar]
- Dhania, N.K.; Chauhan, V.K.; Chaitanya, R.; Dutta-Gupta, A. Midgut de novo transcriptome analysis and gene expression profiling of Achaea janata larvae exposed with Bacillus thuringiensis (Bt)-based biopesticide formulation. Sci. Rep. 2019, 30, 81–90. [Google Scholar] [CrossRef]
- Jin, M.; Shan, Y.; Peng, Y.; Wang, P.; Li, Q.; Yu, S.; Zhang, L.; Xiao, Y. An integrative analysis of transcriptomics and proteomics reveals novel insights into the response in the midgut of Spodoptera frugiperda larvae to Vip3Aa. Toxins 2022, 14, 55. [Google Scholar] [CrossRef]
- Li, Z.; Shen, H.; Jiang, Q.; Ji, B. Study on the activity of protective enzyme system in several insects. Acta Entomol. Sin. 1994, 04, 399–403. [Google Scholar]
- Li, H.; Huang, D.; Gao, J.; Pan, J.; Bei, B. The Change of Activities of Protective Enzymes in Interaction of Apriona germari and Different Resistant Populus. Acta Sericologica Sin. 2006, 04, 578–581. [Google Scholar]
- Hjelle, J.J.; Petersen, D.R. Hepatic aldehyde dehydrogenases and lipid peroxidation. Pharmacol. Biochem. Behav. 1983, 18, 155–160. [Google Scholar]
- Garcia, D.; Lima, D.; da Silva, D.G.H.; de Almeida, E.A. Decreased malondialdehyde levels in fish (Astyanax altiparanae) exposed to diesel: Evidence of metabolism by aldehyde dehydrogenase in the liver and excretion in water. Ecotox. Environ. Saf. 2020, 190, 110107. [Google Scholar]
- Lee, H.S.; Csallany, A.S. The influence of vitamin E and selenium on lipid peroxidation and aldehyde dehydrogenase activity in rat liver and tissue. Lipids 1994, 29, 345–350. [Google Scholar]
- Ronchi, J.A.; Francisco, A.; Passos, L.A.C.; Figueira, T.R.; Castilho, R.F. The contribution of nicotinamide nucleotide transhydrogenase to peroxide detoxification is dependent on the respiratory state and counterbalanced by other sources of NADPH in liver mitochondria. J. Biol. Chem. 2016, 291, 20173–20187. [Google Scholar]
- Mailloux, R.J. Mitochondrial antioxidants and the maintenance of cellular hydrogen peroxide levels. Oxidative Med. Cell. Longev. 2018, 2018, 7857251. [Google Scholar]
- Rao, K.S.; Shen, X.; Pardue, S.; Krzywanski, D.M. Nicotinamide nucleotide transhydrogenase (NNT) regulates mitochondrial ROS and endothelial dysfunction in response to angiotensin II. Redox Biol. 2020, 36, 101650. [Google Scholar]
- Regan, T.; Conway, R.; Bharath, L.P. Regulation of immune cell function by nicotinamide nucleotide transhydrogenase. J. Appl. Physiol. Cell Physiol. 2022, 322, C666–C673. [Google Scholar]
- Jie, L.; Liucheng, W.; Guona, Z.; Junxia, L.; Baojia, G. Midgut Transcriptome Analysis of Clostera anachoreta Treated with Cry1Ac Toxin. Arch. Insect Biochem. Physiol. 2020, 103, e21638. [Google Scholar] [CrossRef]
- Tellier, M. Structure, activity, and function of SETMAR protein lysine methyltransferase. Life 2021, 11, 1342. [Google Scholar] [CrossRef]
- Rius, N.; Demain, A.L. Lysine epsilon-Aminotransferase, the Initial Enzyme of Cephalosporin Biosynthesis in Actinomycetes. J. Microbiol. Biotechnol. 1997, 7, 95–100. [Google Scholar]
- Huang, X.; Zhou, Y.; Song, Z.; Bai, L.Q.; Hu, J.F. Effect of rearing temperature on larval development and reproductive capacity of Dendrolimuspunctata punctata. For. Pest Dis. 2014, 33, 14–17. [Google Scholar]
- Mei, Z.; Li, J. Indoor Toxicity Test of Bacillus thuringiensis to Bradysia odoriphaga Larva. North. Hortic. 2019, 24, 51–55. [Google Scholar]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar]
- Kim, D.; Langmead, B.; Hisat, S.S. A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 1–21. [Google Scholar] [CrossRef] [PubMed]
- Xie, C.; Mao, X.; Huang, J.; Ding, Y.; Wu, J.; Dong, S.; Kong, L.; Gao, G.; Li, C.; Wei, L. KOBAS 2.0: A web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011, 39, W316–W322. [Google Scholar] [CrossRef]
KEGG Pathway ID | Signaling Pathway | DEGs | DEMs |
---|---|---|---|
map00760 | Nicotinate and nicotinamide metabolism | NNT | Niacinamide |
map00310 | Lysine degradation | ALDH SETMAR | L-2-Aminoadipic acid |
map04212 | Longevity regulating pathway—worm | GST RNASEK | Niacinamide |
map04977 | Vitamin digestion and absorption | PNLIP SLC23A1 | Niacinamide |
Gene ID | Primer Symbol | Sequence (5′-3′) |
---|---|---|
D. kikuchii_LG29_G00053 | β-actin | F: GTAGGCACGAACAACAGA R: CAGAAGGTGATGTCAGGAG |
D. kikuchii_LG16_G00317 | ALDH | F: GGCACCGACAGACAGACACAG R: CCAGCAACACGCCTAGTCTATCC |
D. kikuchii_LG12_G00198 | SETMAR | F: TGTCACGGTCGCCAGATGTTAC R: ACGCTCCGAACGCAACCAG |
D. kikuchii_LG05_G00429 | NNT | F: TTCCGACATTAGTAGCCAGGTTCC R: GGAGTACAGCAGACAGGCAGAC |
D. kikuchii_LG15_G00353 | PNLIP | F: AGAGCGGCAGCACATTGGTAG R: ACACGAGTTCAGCAGGCAGAC |
D. kikuchii_LG12_G00593 | SLC23A1 | F: GGAGGCGTTGGCGGCTTAG R: GGATGATGGTTGGTCGGTGGTAG |
D. kikuchii_LG18_G00183 | RNASEK | F: AGCTGTCTTGGTTGCCCTAATCC R: TGATGAGCCACACACTCTCGATC |
D. kikuchii_LG07_G00366 | GST-F | F: TAACGGCAACATCGTATCG R: TATGCCTGCGTACACTACT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, J.; Guo, Q.; Yang, B.; Zhou, J. Combined Analysis of Metabolomics and Transcriptome Revealed the Effect of Bacillus thuringiensis on the 5th Instar Larvae of Dendrolimus kikuchii Matsumura. Int. J. Mol. Sci. 2024, 25, 11823. https://doi.org/10.3390/ijms252111823
Li J, Guo Q, Yang B, Zhou J. Combined Analysis of Metabolomics and Transcriptome Revealed the Effect of Bacillus thuringiensis on the 5th Instar Larvae of Dendrolimus kikuchii Matsumura. International Journal of Molecular Sciences. 2024; 25(21):11823. https://doi.org/10.3390/ijms252111823
Chicago/Turabian StyleLi, Jinyan, Qiang Guo, Bin Yang, and Jielong Zhou. 2024. "Combined Analysis of Metabolomics and Transcriptome Revealed the Effect of Bacillus thuringiensis on the 5th Instar Larvae of Dendrolimus kikuchii Matsumura" International Journal of Molecular Sciences 25, no. 21: 11823. https://doi.org/10.3390/ijms252111823
APA StyleLi, J., Guo, Q., Yang, B., & Zhou, J. (2024). Combined Analysis of Metabolomics and Transcriptome Revealed the Effect of Bacillus thuringiensis on the 5th Instar Larvae of Dendrolimus kikuchii Matsumura. International Journal of Molecular Sciences, 25(21), 11823. https://doi.org/10.3390/ijms252111823