Characterization of Dendritic Cells and Myeloid-Derived Suppressor Cells Expressing Major Histocompatibility Complex Class II in Secondary Lymphoid Organs in Systemic Lupus Erythematosus-Prone Mice
Abstract
1. Introduction
2. Results
2.1. The MRL/MpJ-Faslpr/J Model Shows an Increase in Clinical Score, Proteinuria, and Anti-dsDNA Antibodies Throughout the SLE
2.2. The Spleen of MRL/MpJ-Faslpr/J Mice Shows an Increase in DCs and M-MDSCs Compared to the Axillary Lymph Node at Week 16
2.3. cDCs CD103−CD11b+ Expressing MHC-II Represent the Majority Cell Population Within the DCs and MDSCs Analyzed in the Spleen of the MRL/MpJ-Faslpr/J Model
2.4. ICOSL Expression Increases in the Spleen of the MRL/MpJ-Faslpr/J Model During Week 16
2.5. M-MDSC Expressing MHC-II Correlate Positively with IFN-γ-Producing CD4+ T Cells in the Spleen of the MRL/MpJ-Faslpr/J Model During Week 16
3. Discussion
4. Materials and Methods
4.1. Mice
4.2. Sample Collection
4.3. Measure of Anti-dsDNA and ANA
4.4. Flow Cytometry
4.5. RNA Extraction
4.6. RT-qPCR
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fortuna, G.; Brennan, M.T. Systemic Lupus Erythematosus. Dent. Clin. N. Am. 2013, 57, 631–655. [Google Scholar] [CrossRef] [PubMed]
- Barber, M.R.W.; Falasinnu, T.; Ramsey-Goldman, R.; Clarke, A.E. The Global Epidemiology of SLE: Narrowing the Knowledge Gaps. Rheumatology 2023, 62, i4–i9. [Google Scholar] [CrossRef] [PubMed]
- Ameer, M.A.; Chaudhry, H.; Mushtaq, J.; Khan, O.S.; Babar, M.; Hashim, T.; Zeb, S.; Tariq, M.A.; Patlolla, S.R.; Ali, J.; et al. An Overview of Systemic Lupus Erythematosus (SLE) Pathogenesis, Classification, and Management. Cureus 2022, 14, e30330. [Google Scholar] [CrossRef] [PubMed]
- Crow, M.K. Pathogenesis of Systemic Lupus Erythematosus: Risks, Mechanisms and Therapeutic Targets. Ann. Rheum. Dis. 2023, 82, 999–1014. [Google Scholar] [CrossRef] [PubMed]
- Waithman, J.; Moffat, J.M.; Patterson, N.L.; van Beek, A.E.; Mintern, J.D. Antigen Presentation. In Reference Module in Biomedical Sciences; Elsevier: Amsterdam, The Netherlands, 2014. [Google Scholar]
- Marshall, J.S.; Warrington, R.; Watson, W.; Kim, H.L. An Introduction to Immunology and Immunopathology. Allergy Asthma Clin. Immunol. 2018, 14, 49. [Google Scholar] [CrossRef]
- Eiz-Vesper, B.; Schmetzer, H.M. Antigen-Presenting Cells: Potential of Proven Und New Players in Immune Therapies. Transfus. Med. Hemotherapy 2020, 47, 429–431. [Google Scholar] [CrossRef]
- Liu, J.; Zhang, X.; Cao, X. Dendritic Cells in Systemic Lupus Erythematosus: From Pathogenesis to Therapeutic Applications. J. Autoimmun. 2022, 132, 102856. [Google Scholar] [CrossRef]
- Zhang, Q.; Vignali, D.A.A. Co-Stimulatory and Co-Inhibitory Pathways in Autoimmunity. Immunity 2016, 44, 1034–1051. [Google Scholar] [CrossRef]
- Sozzani, S.; Del Prete, A.; Bosisio, D. Dendritic Cell Recruitment and Activation in Autoimmunity. J. Autoimmun. 2017, 85, 126–140. [Google Scholar] [CrossRef]
- Turley, S.J.; Fletcher, A.L.; Elpek, K.G. The Stromal and Haematopoietic Antigen-Presenting Cells That Reside in Secondary Lymphoid Organs. Nat. Rev. Immunol. 2010, 10, 813–825. [Google Scholar] [CrossRef]
- Liu, J.; Zhang, X.; Cheng, Y.; Cao, X. Dendritic Cell Migration in Inflammation and Immunity. Cell. Mol. Immunol. 2021, 18, 2461–2471. [Google Scholar] [CrossRef] [PubMed]
- Klarquist, J.; Zhou, Z.; Shen, N.; Janssen, E.M. Dendritic Cells in Systemic Lupus Erythematosus: From Pathogenic Players to Therapeutic Tools. Mediat. Inflamm. 2016, 2016, 5045248. [Google Scholar] [CrossRef] [PubMed]
- Jin, O.; Kavikondala, S.; Sun, L.; Fu, R.; Mok, M.-Y.; Chan, A.; Yeung, J.; Lau, C.-S. Systemic Lupus Erythematosus Patients Have Increased Number of Circulating Plasmacytoid Dendritic Cells, but Decreased Myeloid Dendritic Cells with Deficient CD83 Expression. Lupus 2008, 17, 654–662. [Google Scholar] [CrossRef] [PubMed]
- Tsokos, G.C.; Lo, M.S.; Reis, P.C.; Sullivan, K.E. New Insights into the Immunopathogenesis of Systemic Lupus Erythematosus. Nat. Rev. Rheumatol. 2016, 12, 716–730. [Google Scholar] [CrossRef]
- Huang, X.; Dorta-Estremera, S.; Yao, Y.; Shen, N.; Cao, W. Predominant Role of Plasmacytoid Dendritic Cells in Stimulating Systemic Autoimmunity. Front. Immunol. 2015, 6, 526. [Google Scholar] [CrossRef]
- Sica, A.; Massarotti, M. Myeloid Suppressor Cells in Cancer and Autoimmunity. J. Autoimmun. 2017, 85, 117–125. [Google Scholar] [CrossRef]
- Asgarzade, A.; Ziyabakhsh, A.; Asghariazar, V.; Safarzadeh, E. Myeloid-Derived Suppressor Cells: Important Communicators in Systemic Lupus Erythematosus Pathogenesis and Its Potential Therapeutic Significance. Hum. Immunol. 2021, 82, 782–790. [Google Scholar] [CrossRef]
- Ji, J.; Xu, J.; Zhao, S.; Liu, F.; Qi, J.; Song, Y.; Ren, J.; Wang, T.; Dou, H.; Hou, Y. Myeloid-Derived Suppressor Cells Contribute to Systemic Lupus Erythaematosus by Regulating Differentiation of Th17 Cells and Tregs. Clin. Sci. 2016, 130, 1453–1467. [Google Scholar] [CrossRef]
- Ma, H.; Wan, S.; Xia, C.-Q. Immunosuppressive CD11b+Ly6Chi Monocytes in Pristane-Induced Lupus Mouse Model. J. Leukoc. Biol. 2016, 99, 1121–1129. [Google Scholar] [CrossRef]
- Nourbakhsh, E.; Mohammadi, A.; Salemizadeh Parizi, M.; Mansouri, A.; Ebrahimzadeh, F. Role of Myeloid-Derived Suppressor Cell (MDSC) in Autoimmunity and Its Potential as a Therapeutic Target. Inflammopharmacology 2021, 29, 1307–1315. [Google Scholar] [CrossRef]
- Kim, Y.-S.; Kim, Y.-J.; Lee, J.-M.; Kim, E.-K.; Park, Y.-J.; Choe, S.-K.; Ko, H.-J.; Kang, C.-Y. Functional Changes in Myeloid-Derived Suppressor Cells (MDSCs) during Tumor Growth: FKBP51 Contributes to the Regulation of the Immunosuppressive Function of MDSCs. J. Immunol. 2012, 188, 4226–4234. [Google Scholar] [CrossRef] [PubMed]
- Nagaraj, S.; Nelson, A.; Youn, J.; Cheng, P.; Quiceno, D.; Gabrilovich, D.I. Antigen-Specific CD4+ T Cells Regulate Function of Myeloid-Derived Suppressor Cells in Cancer via Retrograde MHC Class II Signaling. Cancer Res. 2012, 72, 928–938. [Google Scholar] [CrossRef] [PubMed]
- Youn, J.-I.; Nagaraj, S.; Collazo, M.; Gabrilovich, D.I. Subsets of Myeloid-Derived Suppressor Cells in Tumor-Bearing Mice. J. Immunol. 2008, 181, 5791–5802. [Google Scholar] [CrossRef] [PubMed]
- Pan, P.-Y.; Ma, G.; Weber, K.J.; Ozao-Choy, J.; Wang, G.; Yin, B.; Divino, C.M.; Chen, S.-H. Immune Stimulatory Receptor CD40 Is Required for T-Cell Suppression and T Regulatory Cell Activation Mediated by Myeloid-Derived Suppressor Cells in Cancer. Cancer Res. 2010, 70, 99–108. [Google Scholar] [CrossRef]
- Casacuberta-Serra, S.; Costa, C.; Eixarch, H.; Mansilla, M.J.; López-Estévez, S.; Martorell, L.; Parés, M.; Montalban, X.; Espejo, C.; Barquinero, J. Myeloid-Derived Suppressor Cells Expressing a Self-Antigen Ameliorate Experimental Autoimmune Encephalomyelitis. Exp. Neurol. 2016, 286, 50–60. [Google Scholar] [CrossRef]
- Cravedi, P.; Remuzzi, G. Pathophysiology of Proteinuria and Its Value as an Outcome Measure in Chronic Kidney Disease. Br. J. Clin. Pharmacol. 2013, 76, 516–523. [Google Scholar] [CrossRef]
- Katikaneni, D.; Morel, L.; Scindia, Y. Animal Models of Lupus Nephritis: The Past, Present and a Future Outlook. Autoimmunity 2024, 57, 2319203. [Google Scholar] [CrossRef]
- Triantafyllopoulou, A.; Franzke, C.-W.; Seshan, S.V.; Perino, G.; Kalliolias, G.D.; Ramanujam, M.; van Rooijen, N.; Davidson, A.; Ivashkiv, L.B. Proliferative Lesions and Metalloproteinase Activity in Murine Lupus Nephritis Mediated by Type I Interferons and Macrophages. Proc. Natl. Acad. Sci. USA 2010, 107, 3012–3017. [Google Scholar] [CrossRef]
- Reilly, C.M.; Gilkeson, G.S. Use of Genetic Knockouts to Modulate Disease Expression in a Murine Model of Lupus, MRL/Lpr Mice. Immunol. Res. 2002, 25, 143–154. [Google Scholar] [CrossRef]
- Itto, R.; Oe, Y.; Imaruoka, K.; Sato, E.; Sekimoto, A.; Yamakage, S.; Kumakura, S.; Sato, H.; Ito, S.; Takahashi, N. Glomerular Injury Is Exacerbated in Lupus-Prone MRL/Lpr Mice Treated with a Protease-Activated Receptor 2 Antagonist. Tohoku J. Exp. Med. 2019, 249, 127–133. [Google Scholar] [CrossRef]
- Ge, Q.; Gu, X.; Yu, W.; Zhang, G.; Liang, W.; Li, M.; Zhai, G.; Yan, M. Antinuclear Antibodies in Healthy Population: Positive Association with Abnormal Tissue Metabolism, Inflammation and Immune Dysfunction. Int. Immunopharmacol. 2022, 113, 109292. [Google Scholar] [CrossRef] [PubMed]
- Grygiel-Górniak, B.; Rogacka, N.; Puszczewicz, M. Antinuclear Antibodies in Healthy People and Non-Rheumatic Diseases—Diagnostic and Clinical Implications. Rheumatology 2018, 56, 243–248. [Google Scholar] [CrossRef] [PubMed]
- Littlejohn, E.A.; Kong, L.; Wang, L.; Somers, E.C. Longitudinal Antinuclear Antibody Titers in Systemic Lupus Erythematosus and Other Rheumatic Diseases. Front. Med. 2024, 11, 1441221. [Google Scholar] [CrossRef] [PubMed]
- Rekvig, O.P. Anti-DsDNA Antibodies as a Classification Criterion and a Diagnostic Marker for Systemic Lupus Erythematosus: Critical Remarks. Clin. Exp. Immunol. 2014, 179, 5–10. [Google Scholar] [CrossRef]
- Infantino, M.; Nagy, E.; Bizzaro, N.; Fischer, K.; Bossuyt, X.; Damoiseaux, J. Anti-DsDNA Antibodies in the Classification Criteria of Systemic Lupus Erythematosus. J. Transl. Autoimmun. 2022, 5, 100139. [Google Scholar] [CrossRef]
- Backer, R.A.; Probst, H.C.; Clausen, B.E. Classical DC2 Subsets and Monocyte-derived DC: Delineating the Developmental and Functional Relationship. Eur. J. Immunol. 2023, 53, 2149548. [Google Scholar] [CrossRef]
- Decker, P.; Kötter, I.; Klein, R.; Berner, B.; Rammensee, H.-G. Monocyte-Derived Dendritic Cells over-Express CD86 in Patients with Systemic Lupus Erythematosus. Rheumatology 2006, 45, 1087–1095. [Google Scholar] [CrossRef]
- Chan, V.S.-F.; Nie, Y.-J.; Shen, N.; Yan, S.; Mok, M.-Y.; Lau, C.-S. Distinct Roles of Myeloid and Plasmacytoid Dendritic Cells in Systemic Lupus Erythematosus. Autoimmun. Rev. 2012, 11, 890–897. [Google Scholar] [CrossRef]
- Khan, S.A.; Nowatzky, J.; Jiménez-Branda, S.; Greenberg, J.D.; Clancy, R.; Buyon, J.; Bhardwaj, N. Active Systemic Lupus Erythematosus Is Associated with Decreased Blood Conventional Dendritic Cells. Exp. Mol. Pathol. 2013, 95, 121–123. [Google Scholar] [CrossRef]
- Gleisner, M.A.; Reyes, P.; Alfaro, J.; Solanes, P.; Simon, V.; Crisostomo, N.; Sauma, D.; Rosemblatt, M.; Bono, M.R. Dendritic and Stromal Cells from the Spleen of Lupic Mice Present Phenotypic and Functional Abnormalities. Mol. Immunol. 2013, 54, 423–434. [Google Scholar] [CrossRef]
- Wang, Z.; Zhu, F.; Wang, J.; Tao, Q.; Xu, X.; Wang, H.; Xiong, S.; Wang, Y.; Zhai, Z. Increased CD14+HLA-DR−/Low Myeloid-Derived Suppressor Cells Correlate with Disease Severity in Systemic Lupus Erythematosus Patients in an INOS-Dependent Manner. Front. Immunol. 2019, 10, 01202. [Google Scholar] [CrossRef] [PubMed]
- Kaewraemruaen, C.; Ritprajak, P.; Hirankarn, N. Dendritic Cells as Key Players in Systemic Lupus Erythematosus. Asian Pac. J. Allergy Immunol. 2020, 38, 225–232. [Google Scholar] [CrossRef] [PubMed]
- Seitz, H.M.; Matsushima, G.K. Dendritic Cells in Systemic Lupus Erythematosus. Int. Rev. Immunol. 2010, 29, 184–209. [Google Scholar] [CrossRef] [PubMed]
- Cabeza-Cabrerizo, M.; Cardoso, A.; Minutti, C.M.; Pereira da Costa, M.; Reis e Sousa, C. Dendritic Cells Revisited. Annu. Rev. Immunol. 2021, 39, 131–166. [Google Scholar] [CrossRef]
- Lopes, A.P.; Hillen, M.R.; Hinrichs, A.C.; Blokland, S.L.; Bekker, C.P.; Pandit, A.; Kruize, A.A.; Radstake, T.R.; van Roon, J.A. Deciphering the Role of CDC2s in Sjögren’s Syndrome: Transcriptomic Profile Links Altered Antigen Processes with IFN Signature and Autoimmunity. Ann. Rheum. Dis. 2023, 82, 374–383. [Google Scholar] [CrossRef]
- del Rio, M.-L.; Rodriguez-Barbosa, J.-I.; Kremmer, E.; Förster, R. CD103− and CD103+ Bronchial Lymph Node Dendritic Cells Are Specialized in Presenting and Cross-Presenting Innocuous Antigen to CD4+ and CD8+ T Cells. J. Immunol. 2007, 178, 6861–6866. [Google Scholar] [CrossRef]
- Murdaca, G.; Greco, M.; Tonacci, A.; Negrini, S.; Borro, M.; Puppo, F.; Gangemi, S. IL-33/IL-31 Axis in Immune-Mediated and Allergic Diseases. Int. J. Mol. Sci. 2019, 20, 5856. [Google Scholar] [CrossRef]
- Di Salvo, E.; Ventura-Spagnolo, E.; Casciaro, M.; Navarra, M.; Gangemi, S. IL-33/IL-31 Axis: A Potential Inflammatory Pathway. Mediat. Inflamm. 2018, 2018, 3858032. [Google Scholar] [CrossRef]
- Irla, M.; Küpfer, N.; Suter, T.; Lissilaa, R.; Benkhoucha, M.; Skupsky, J.; Lalive, P.H.; Fontana, A.; Reith, W.; Hugues, S. MHC Class II–Restricted Antigen Presentation by Plasmacytoid Dendritic Cells Inhibits T Cell–Mediated Autoimmunity. J. Exp. Med. 2010, 207, 1891–1905. [Google Scholar] [CrossRef]
- Biswas, S.; Bieber, K.; Manz, R.A. IL-10 Revisited in Systemic Lupus Erythematosus. Front. Immunol. 2022, 13, 970906. [Google Scholar] [CrossRef]
- Coutant, F. Shaping of Monocyte-Derived Dendritic Cell Development and Function by Environmental Factors in Rheumatoid Arthritis. Int. J. Mol. Sci. 2021, 22, 13670. [Google Scholar] [CrossRef]
- Her, M.; Kim, D.; Oh, M.; Jeong, H.; Choi, I. Increased Expression of Soluble Inducible Costimulator Ligand (ICOSL) in Patients with Systemic Lupus Erythematosus. Lupus 2009, 18, 501–507. [Google Scholar] [CrossRef] [PubMed]
- Carvalheiro, T.; Rodrigues, A.; Lopes, A.; Inês, L.; Velada, I.; Ribeiro, A.; Martinho, A.; Silva, J.A.P.; Pais, M.L.; Paiva, A. Tolerogenic versus Inflammatory Activity of Peripheral Blood Monocytes and Dendritic Cells Subpopulations in Systemic Lupus Erythematosus. Clin. Dev. Immunol. 2012, 2012, 934161. [Google Scholar] [CrossRef] [PubMed]
- Wikenheiser, D.J.; Stumhofer, J.S. ICOS Co-Stimulation: Friend or Foe? Front. Immunol. 2016, 7, 304. [Google Scholar] [CrossRef] [PubMed]
- Ding, D.; Mehta, H.; McCune, W.J.; Kaplan, M.J. Aberrant Phenotype and Function of Myeloid Dendritic Cells in Systemic Lupus Erythematosus. J. Immunol. 2006, 177, 5878–5889. [Google Scholar] [CrossRef]
- Colonna, L.; Dinnall, J.-A.; Shivers, D.K.; Frisoni, L.; Caricchio, R.; Gallucci, S. Abnormal Costimulatory Phenotype and Function of Dendritic Cells before and after the Onset of Severe Murine Lupus. Arthritis Res. Ther. 2006, 8, R49. [Google Scholar] [CrossRef]
- Parietti, V.; Monneaux, F.; Décossas, M.; Muller, S. Function of CD4+,CD25+ Treg Cells in MRL/Lpr Mice Is Compromised by Intrinsic Defects in Antigen-presenting Cells and Effector T Cells. Arthritis Rheum. 2008, 58, 1751–1761. [Google Scholar] [CrossRef]
- Said, E.A.; Al-Reesi, I.; Al-Riyami, M.; Al-Naamani, K.; Al-Sinawi, S.; Al-Balushi, M.S.; Koh, C.Y.; Al-Busaidi, J.Z.; Idris, M.A.; Al-Jabri, A.A. Increased CD86 but Not CD80 and PD-L1 Expression on Liver CD68+ Cells during Chronic HBV Infection. PLoS ONE 2016, 11, e0158265. [Google Scholar] [CrossRef]
- Iyer, S.S.; Cheng, G. Role of Interleukin 10 Transcriptional Regulation in Inflammation and Autoimmune Disease. Crit. Rev. Immunol. 2012, 32, 23–63. [Google Scholar] [CrossRef]
- Hu, X.; Ivashkiv, L.B. Cross-Regulation of Signaling Pathways by Interferon-γ: Implications for Immune Responses and Autoimmune Diseases. Immunity 2009, 31, 539–550. [Google Scholar] [CrossRef]
- Wang, X.-R.; Xiao, J.-P.; Zhang, J.-J.; Wu, Y.-G. Decreased Serum/Plasma Vitamin D Levels in SLE Patients: A Meta-Analysis. Curr. Pharm. Des. 2019, 24, 4466–4473. [Google Scholar] [CrossRef] [PubMed]
- Koizumi, T.; Nakao, Y.; Matsui, T.; Nakagawa, T.; Matsuda, S.; Komoriya, K.; Kanai, Y.; Fujita, T. Effects of Corticosteroid and 1,24R-Dihydroxy-Vitamin D3 Administration on Lymphoproliferation and Autoimmune Disease in MRL/MP-Lpr/Lpr Mice. Int. Arch. Allergy Immunol. 1985, 77, 396–404. [Google Scholar] [CrossRef] [PubMed]
- Kraemer, A.N.; Schäfer, A.-L.; Sprenger, D.T.L.; Sehnert, B.; Williams, J.P.; Luo, A.; Riechert, L.; Al-Kayyal, Q.; Dumortier, H.; Fauny, J.-D.; et al. Impact of Dietary Vitamin D on Immunoregulation and Disease Pathology in Lupus-Prone NZB/W F1 Mice. Front. Immunol. 2022, 13, 933191. [Google Scholar] [CrossRef] [PubMed]
- Prietl, B.; Treiber, G.; Pieber, T.; Amrein, K. Vitamin D and Immune Function. Nutrients 2013, 5, 2502–2521. [Google Scholar] [CrossRef]
- Fleet, J.C.; Burcham, G.N.; Calvert, R.D.; Elzey, B.D.; Ratliff, T.L. 1α,25 Dihydroxyvitamin D (1,25(OH)2D) Inhibits the T Cell Suppressive Function of Myeloid Derived Suppressor Cells (MDSC). J. Steroid Biochem. Mol. Biol. 2020, 198, 105557. [Google Scholar] [CrossRef]
- Calvert, R.D.; Burcham, G.N.; Ratliff, T.L.; Fleet, J.C. Myeloid Derived Suppressor Cells (MDSC) Are Vitamin D Targets and 1α,25 Dihydroxyvitamin D (1,25(OH)2D) Inhibits Their Ability to Suppress T Cell Function. FASEB J. 2017, 31, 434–438. [Google Scholar] [CrossRef]
- Zhang, J. Yin and Yang Interplay of IFN-γ in Inflammation and Autoimmune Disease. J. Clin. Investig. 2007, 117, 871–873. [Google Scholar] [CrossRef]
- Liu, W.; Zhang, S.; Wang, J. IFN-γ, Should Not Be Ignored in SLE. Front. Immunol. 2022, 13, 954706. [Google Scholar] [CrossRef]
- Kryczek, I.; Wei, S.; Gong, W.; Shu, X.; Szeliga, W.; Vatan, L.; Chen, L.; Wang, G.; Zou, W. Cutting Edge: IFN-γ Enables APC to Promote Memory Th17 and Abate Th1 Cell Development. J. Immunol. 2008, 181, 5842–5846. [Google Scholar] [CrossRef]
- Lu, L.; Jin, Y.; Tong, Y.; Xiao, L.; Hou, Y.; Liu, Z.; Dou, H. Myeloid-Derived Suppressor Cells Promote the Formation of Abdominal Aortic Aneurysms through the IL-3-ICOSL-ICOS Axis. BBA Adv. 2023, 4, 100103. [Google Scholar] [CrossRef]
- Matsuzaki, Y.; Umemoto, T.; Tanaka, Y.; Okano, T.; Yamato, M. Β2-Microglobulin Is an Appropriate Reference Gene for RT-PCR-Based Gene Expression Analysis of Hematopoietic Stem Cells. Regen. Ther. 2015, 1, 91–97. [Google Scholar] [CrossRef]





| Antibody | Fluorochrome | Clone | Source | |
|---|---|---|---|---|
| week 10 | CD45 | BV510 | 30-F11 | BD Biosciences San Jose, CA, USA |
| CD11b | APC-Cy7 | M1/70 | BD Biosciences | |
| CD11c | PE-Cy7 | HL3 | BD Biosciences | |
| CD64 | APC | S18017D | BioLegend San Diego, CA, USA | |
| CD103 | BV421 | M290 | BD Biosciences | |
| Ly6C | PE | AL-21 | BD Biosciences | |
| Ly6G | PerCP-Cy5.5 | 1A8 | BD Biosciences | |
| MHC-II | BV605 | 2G9 | BD Biosciences | |
| week 12 and 16 | CD45 | BV510 | 30-F11 | BD Biosciences |
| CD11b | APC-Cy7 | M1/70 | BD Biosciences | |
| CD11c | PE-Cy7 | HL3 | BD Biosciences | |
| CD64 | APC | S18017D | BioLegend | |
| CD103 | BV421 | M290 | BD Biosciences | |
| Ly6C | BV605 | AL-21 | BD Biosciences | |
| Ly6G | BV786 | 1A8 | BD Biosciences | |
| MHC-II | PerCP-Cy5.5 | M5/144.15.2 | BD Biosciences |
| Antibody | Fluorochrome | Clone | Source | |
|---|---|---|---|---|
| 10, 12 and 16 weeks | CD45 | BV510 | 30-F11 | BD Biosciences |
| CD11b | FITC | M1/70 | BD Biosciences | |
| Ly6C | BV605 | AL-21 | BD Biosciences | |
| Ly6G | BV786 | 1A8 | BD Biosciences | |
| Arg-1 | PE-Cy7 | A1exF5 | Invitrogen | |
| iNOS | APC | CXNFT | Invitrogen | |
| MHC-II | PerCP-Cy5.5 | M5/144.15.2 | BD Biosciences |
| Antibody | Fluorochrome | Clone | Source | |
|---|---|---|---|---|
| 10, 12 and 16 weeks | CD45 | BV510 | 30-F11 | BD Biosciences |
| CD3 | BV711 | 145-2C11 | BD Biosciences | |
| CD4 | BV650 | RM4-5 | BD Biosciences | |
| IFN-γ | PE-CF594 | XMG1.2 | BD Biosciences | |
| IL-10 | PE | JES5-16E3 | BioLegend |
| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| ICOSL | TCTTGGAAGAGGTGGTCAGGCT | GCCATTCTTGGAGGACATGCAGGT |
| CD80 | TGCTGCTTCGTCTTTCAC | GAGGAGAGTTGTAACGGCAAG |
| CD86 | AAAGTTGGTTCTGTACGAGCA | GGCCCAGGTACTTGGCATT |
| β-2 microglobulin | CATGGCTCGCTCGGTGAC | CAGTTCAGTATGTTCGGCTTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Uribe, F.R.; González-Martínez, F.; Echeverría-Araya, S.A.; Sepúlveda-Pontigo, A.; Chávez-Villacreses, K.; Díaz-Bozo, A.; Méndez-Pérez, I.; González, V.P.I.; Bohmwald, K.; Kalergis, A.M.; et al. Characterization of Dendritic Cells and Myeloid-Derived Suppressor Cells Expressing Major Histocompatibility Complex Class II in Secondary Lymphoid Organs in Systemic Lupus Erythematosus-Prone Mice. Int. J. Mol. Sci. 2024, 25, 13604. https://doi.org/10.3390/ijms252413604
Uribe FR, González-Martínez F, Echeverría-Araya SA, Sepúlveda-Pontigo A, Chávez-Villacreses K, Díaz-Bozo A, Méndez-Pérez I, González VPI, Bohmwald K, Kalergis AM, et al. Characterization of Dendritic Cells and Myeloid-Derived Suppressor Cells Expressing Major Histocompatibility Complex Class II in Secondary Lymphoid Organs in Systemic Lupus Erythematosus-Prone Mice. International Journal of Molecular Sciences. 2024; 25(24):13604. https://doi.org/10.3390/ijms252413604
Chicago/Turabian StyleUribe, Felipe R., Fabián González-Martínez, Sebastián A. Echeverría-Araya, Alison Sepúlveda-Pontigo, Karissa Chávez-Villacreses, Andrés Díaz-Bozo, Isabel Méndez-Pérez, Valentina P. I. González, Karen Bohmwald, Alexis M. Kalergis, and et al. 2024. "Characterization of Dendritic Cells and Myeloid-Derived Suppressor Cells Expressing Major Histocompatibility Complex Class II in Secondary Lymphoid Organs in Systemic Lupus Erythematosus-Prone Mice" International Journal of Molecular Sciences 25, no. 24: 13604. https://doi.org/10.3390/ijms252413604
APA StyleUribe, F. R., González-Martínez, F., Echeverría-Araya, S. A., Sepúlveda-Pontigo, A., Chávez-Villacreses, K., Díaz-Bozo, A., Méndez-Pérez, I., González, V. P. I., Bohmwald, K., Kalergis, A. M., & Soto, J. A. (2024). Characterization of Dendritic Cells and Myeloid-Derived Suppressor Cells Expressing Major Histocompatibility Complex Class II in Secondary Lymphoid Organs in Systemic Lupus Erythematosus-Prone Mice. International Journal of Molecular Sciences, 25(24), 13604. https://doi.org/10.3390/ijms252413604

