Differential Mitochondrial, Oxidative Stress and Inflammatory Responses to SARS-CoV-2 Spike Protein Receptor Binding Domain in Human Lung Microvascular, Coronary Artery Endothelial and Bronchial Epithelial Cells
Abstract
:1. Introduction
2. Results
2.1. The Effect of SCoV2-RBD on Mitochondrial Morphology
2.2. The Effect of SCoV2-RBD on Mitochondrial and Glycolytic Activity and mitoROS
2.3. The Impact of mitoROS on SCoV2-RBD-Induced Effect on Mitochondrial Morphology
2.4. The Impact of mitoROS on SCoV2-RBD-Induced Inflammatory Cytokines
3. Discussion
3.1. HLMVECs Respond to SCoV2-RBD by Rapid Mitochondrial Changes
3.2. Mitochondrial Signaling in SARS-CoV-2 Infection Is Cell and Pathway-Specific
3.3. SARS-CoV-2-RBD Suppresses Energetic Metabolism in HLMVECs
3.4. mitoROS Mediates SARS-CoV-2-RBD-Induced Mitochondrial Fragmentation in HLMVECs
3.5. mitoROS Mediates Cytokine Production in Response to SARS-CoV-2-RBD
4. Materials and Methods
4.1. Cell Culture and Treatments
4.2. Mitochondrial Morphology
4.3. Mitochondrial and Glycolytic Activity
4.4. Mitochondrial Superoxide
4.5. Gene Expression
4.6. Cytokine Secretion Analysis
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Appendix A
Appendix B
Target | Sequence |
---|---|
GAPDH | F: TCAAGATCATCAGCAATGCCT R: CATGAGTCCTTCCACGATACC |
IL-6 | F: AGACAGCCACTCACCTCTTCAG R: TTCTGCCAGTGCCTCTTTGCTG |
IL-8 | F: GAGAGTGATTGAGAGTGGACCAC R: CACAACCCTCTGCACCCAGTTT |
IL-1β | F: CCACAGACCTTCCAGGAGAATG R: GTGCAGTTCAGTGATCGTACAGG |
NF-kβ | F: GCAGCACTACTTCTTGACCACC R: TCTGCTCCTGAGCATTGACGTC |
GM-CSF | F: GGAGCATGTGAATGCCATCCAG R: CTGGAGGTCAAACATTTCTGAGAT |
CCL2 | F: AGAATCACCAGCAGCAAGTGTCC R: TCCTGAACCCACTTCTGCTTGG |
References
- Budinger, G.R.S.; Misharin, A.V.; Ridge, K.M.; Singer, B.D.; Wunderink, R.G. Distinctive features of severe SARS-CoV-2 pneumonia. J. Clin. Investig. 2021, 131, 14. [Google Scholar] [CrossRef]
- Magadum, A.; Kishore, R. Cardiovascular Manifestations of COVID-19 Infection. Cells 2020, 9, 2508. [Google Scholar] [CrossRef] [PubMed]
- Perico, L.; Benigni, A.; Remuzzi, G. SARS-CoV-2 and the spike protein in endotheliopathy. Trends Microbiol. 2023, 32, 53–67. [Google Scholar] [CrossRef] [PubMed]
- Jackson, C.B.; Farzan, M.; Chen, B.; Choe, H. Mechanisms of SARS-CoV-2 entry into cells. Nat. Rev. Mol. Cell Biol. 2022, 23, 3–20. [Google Scholar] [CrossRef]
- Zou, X.; Chen, K.; Zou, J.; Han, P.; Hao, J.; Han, Z. Single-cell RNA-seq data analysis on the receptor ACE2 expression reveals the potential risk of different human organs vulnerable to 2019-nCoV infection. Front. Med. 2020, 14, 185–192. [Google Scholar] [CrossRef] [PubMed]
- Bhowal, C.; Ghosh, S.; Ghatak, D.; De, R. Pathophysiological involvement of host mitochondria in SARS-CoV-2 infection that causes COVID-19: A comprehensive evidential insight. Mol. Cell. Biochem. 2023, 478, 1325–1343. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Luo, R.; Zhang, M.; Wang, Y.; Song, T.; Tao, T.; Li, Z.; Jin, L.; Zheng, H.; Chen, W.; et al. A cross-talk between epithelium and endothelium mediates human alveolar–capillary injury during SARS-CoV-2 infection. Cell Death Dis. 2020, 11, 1–17. [Google Scholar] [CrossRef]
- Lei, Y.; Zhang, J.; Schiavon, C.R.; He, M.; Chen, L.; Shen, H.; Zhang, Y.; Yin, Q.; Cho, Y.; Andrade, L.; et al. SARS-CoV-2 Spike Protein Impairs Endothelial Function via Downregulation of ACE 2. Circ. Res. 2021, 128, 1323–1326. [Google Scholar] [CrossRef] [PubMed]
- Liang, S.; Bao, C.; Yang, Z.; Liu, S.; Sun, Y.; Cao, W.; Wang, T.; Schwantes-An, T.H.; Choy, J.S.; Naidu, S.; et al. SARS-CoV-2 spike protein induces IL-18-mediated cardiopulmonary inflammation via reduced mitophagy. Signal Transduct. Target. Ther. 2023, 8, 1–15. [Google Scholar] [CrossRef]
- Ahmed, S.A.; Alahmadi, Y.M.; Abdou, Y.A. The Impact of Serum Levels of Reactive Oxygen and Nitrogen Species on the Disease Severity of COVID-19. Int. J. Mol. Sci. 2023, 24, 8973. [Google Scholar] [CrossRef]
- Chang, R.; Mamun, A.; Dominic, A.; Le, N.T. SARS-CoV-2 Mediated Endothelial Dysfunction: The Potential Role of Chronic Oxidative Stress. Front. Physiol. 2021, 11, 1752. [Google Scholar] [CrossRef]
- Van Huynh, T.; Rethi, L.; Lee, T.W.; Higa, S.; Kao, Y.H.; Chen, Y.J. Spike Protein Impairs Mitochondrial Function in Human Cardiomyocytes: Mechanisms Underlying Cardiac Injury in COVID-19. Cells 2023, 12, 877. [Google Scholar] [CrossRef]
- Archer, S.L.; Dasgupta, A.; Chen, K.H.; Wu, D.; Baid, K.; Mamatis, J.E.; Gonzalez, V.; Read, A.; Bentley, R.E.; Martin, A.Y.; et al. SARS-CoV-2 mitochondriopathy in COVID-19 pneumonia exacerbates hypoxemia. Redox Biol. 2022, 58, 102508. [Google Scholar] [CrossRef] [PubMed]
- Burtscher, J.; Cappellano, G.; Omori, A.; Koshiba, T.; Millet, G.P. Mitochondria: In the Cross Fire of SARS-CoV-2 and Immunity. iScience 2020, 23, 101631. [Google Scholar] [CrossRef]
- Zekri-Nechar, K.; Zamorano-León, J.J.; Reche, C.; Giner, M.; López-De-Andrés, A.; Jiménez-García, R.; López-Farré, A.J.; Martínez-Martínez, C.H. Spike Protein Subunits of SARS-CoV-2 Alter Mitochondrial Metabolism in Human Pulmonary Microvascular Endothelial Cells: Involvement of Factor Xa. Dis. Markers 2022, 2022, 1118195. [Google Scholar] [CrossRef] [PubMed]
- Icard, P.; Lincet, H.; Wu, Z.; Coquerel, A.; Forgez, P.; Alifano, M.; Fournel, L. The key role of Warburg effect in SARS-CoV-2 replication and associated inflammatory response. Biochimie 2021, 180, 169. [Google Scholar] [CrossRef] [PubMed]
- Dong, F.; Li, H.; Liu, L.; Yao, L.L.; Wang, J.; Xiang, D.; Ma, J.; Zhang, G.; Zhang, S.; Li, J.; et al. ACE2 negatively regulates the Warburg effect and suppresses hepatocellular carcinoma progression via reducing ROS-HIF1α activity. Int. J. Biol. Sci. 2023, 19, 2613. [Google Scholar] [CrossRef]
- Glancy, B.; Kim, Y.; Katti, P.; Willingham, T.B. The Functional Impact of Mitochondrial Structure Across Subcellular Scales. Front. Physiol. 2020, 11, 541040. [Google Scholar] [CrossRef]
- Kim, S.M.; Kim, Y.G.; Jeong, K.H.; Lee, S.H.; Lee, T.W.; Ihm, C.G.; Moon, J.Y. Angiotensin II-induced mitochondrial Nox4 is a major endogenous source of oxidative stress in kidney tubular cells. PLoS ONE 2012, 7, e39739. [Google Scholar] [CrossRef]
- Ahmetaj-Shala, B.; Vaja, R.; Atanur, S.S.; George, P.M.; Kirkby, N.S.; Mitchell, J.A. Cardiorenal Tissues Express SARS-CoV-2 Entry Genes and Basigin (BSG/CD147) Increases With Age in Endothelial Cells. JACC. Basic Transl. Sci. 2020, 5, 1111–1123. [Google Scholar] [CrossRef]
- Chen, L.; Li, X.; Chen, M.; Feng, Y.; Xiong, C. The ACE2 expression in human heart indicates new potential mechanism of heart injury among patients infected with SARS-CoV-2. Cardiovasc. Res. 2020, 116, 1097–1100. [Google Scholar] [CrossRef]
- Hamilton, J.A. Cytokines Focus GM-CSF in inflammation. J. Exp. Med. 2019, 217, e20190945. [Google Scholar] [CrossRef]
- Shi, Y.; Liu, C.H.; Roberts, A.I.; Das, J.; Xu, G.; Ren, G.; Zhang, Y.; Zhang, L.; Zeng, R.Y.; Tan, H.S.W.; et al. Granulocyte-macrophage colony-stimulating factor (GM-CSF) and T-cell responses: What we do and don’t know. Cell Res. 2006, 16, 126–133. [Google Scholar] [CrossRef]
- Zhou, Y.; Fu, B.; Zheng, X.; Wang, D.; Zhao, C.; Qi, Y.; Sun, R.; Tian, Z.; Xu, X.; Wei, H. Pathogenic T-cells and inflammatory monocytes incite inflammatory storms in severe COVID-19 patients. Natl. Sci. Rev. 2020, 7, 998–1002. [Google Scholar] [CrossRef]
- Ruhl, L.; Pink, I.; Kühne, J.F.; Beushausen, K.; Keil, J.; Christoph, S.; Sauer, A.; Boblitz, L.; Schmidt, J.; David, S.; et al. Endothelial dysfunction contributes to severe COVID-19 in combination with dysregulated lymphocyte responses and cytokine networks. Signal Transduct. Target. Ther. 2021, 6, 1–15. [Google Scholar] [CrossRef]
- Valente, A.J.; Maddalena, L.A.; Robb, E.L.; Moradi, F.; Stuart, J.A. A simple ImageJ macro tool for analysing mitochondrial network morphology in mammalian cell culture. Acta Histochem. 2017, 119, 315–326. [Google Scholar] [CrossRef] [PubMed]
- Segawa, M.; Wolf, D.M.; Hultgren, N.W.; Williams, D.S.; van der Bliek, A.M.; Shackelford, D.B.; Liesa, M.; Shirihai, O.S. Quantification of cristae architecture reveals time-dependent characteristics of individual mitochondria. Life Sci. Alliance 2020, 3, e201900620. [Google Scholar] [CrossRef] [PubMed]
- Kalyanaraman, B.; Dranka, B.P.; Hardy, M.; Michalski, R.; Zielonka, J. HPLC-based monitoring of products formed from hydroethidine-based fluorogenic probes—The ultimate approach for intra- and extracellular superoxide detection. Biochim. Biophys. Acta-Gen. Subj. 2014, 1840, 739–744. [Google Scholar] [CrossRef]
- Murphy, M.P.; Bayir, H.; Belousov, V.; Chang, C.J.; Davies, K.J.A.; Davies, M.J.; Dick, T.P.; Finkel, T.; Forman, H.J.; Janssen-Heininger, Y.; et al. Guidelines for measuring reactive oxygen species and oxidative damage in cells and in vivo. Nat. Metab. 2022, 4, 651–662. [Google Scholar] [CrossRef] [PubMed]
- Dikalova, A.E.; Bikineyeva, A.T.; Budzyn, K.; Nazarewicz, R.R.; McCann, L.; Lewis, W.; Harrison, D.G.; Dikalov, S.I. Therapeutic targeting of mitochondrial superoxide in hypertension. Circ. Res. 2010, 107, 106–116. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kulkovienė, G.; Narauskaitė, D.; Tunaitytė, A.; Volkevičiūtė, A.; Balion, Z.; Kutakh, O.; Gečys, D.; Kairytė, M.; Uldukytė, M.; Stankevičius, E.; et al. Differential Mitochondrial, Oxidative Stress and Inflammatory Responses to SARS-CoV-2 Spike Protein Receptor Binding Domain in Human Lung Microvascular, Coronary Artery Endothelial and Bronchial Epithelial Cells. Int. J. Mol. Sci. 2024, 25, 3188. https://doi.org/10.3390/ijms25063188
Kulkovienė G, Narauskaitė D, Tunaitytė A, Volkevičiūtė A, Balion Z, Kutakh O, Gečys D, Kairytė M, Uldukytė M, Stankevičius E, et al. Differential Mitochondrial, Oxidative Stress and Inflammatory Responses to SARS-CoV-2 Spike Protein Receptor Binding Domain in Human Lung Microvascular, Coronary Artery Endothelial and Bronchial Epithelial Cells. International Journal of Molecular Sciences. 2024; 25(6):3188. https://doi.org/10.3390/ijms25063188
Chicago/Turabian StyleKulkovienė, Gabrielė, Deimantė Narauskaitė, Agilė Tunaitytė, Augusta Volkevičiūtė, Zbigniev Balion, Olena Kutakh, Dovydas Gečys, Milda Kairytė, Martyna Uldukytė, Edgaras Stankevičius, and et al. 2024. "Differential Mitochondrial, Oxidative Stress and Inflammatory Responses to SARS-CoV-2 Spike Protein Receptor Binding Domain in Human Lung Microvascular, Coronary Artery Endothelial and Bronchial Epithelial Cells" International Journal of Molecular Sciences 25, no. 6: 3188. https://doi.org/10.3390/ijms25063188