Development and Evaluation of an In-House Real-Time RT-PCR Targeting nsp10 Gene for SARS-CoV-2 Detection
Abstract
1. Introduction
2. Results
2.1. Design of a Novel COVID-19 Real-Time RT-PCR Assay Targeting the nsp10 Gene of SARS-CoV-2
2.2. Analytical Sensitivity and Specificity of the COVID-19-nsp10 Real-Time RT-PCR Assay
2.3. Diagnostic Performance of the COVID-19-nsp10 Assay for SARS-CoV-2 Detection
3. Discussion
4. Materials and Methods
4.1. Viruses and Samples Used for Evaluation
4.2. Whole-Genome Sequencing of SARS-CoV-2
4.3. In Silico Analysis
4.4. Nucleic Acid Extraction
4.5. Real-Time RT-PCR Assays for SARS-CoV-2 RNA Detection
4.6. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhu, N.; Zhang, D.; Wang, W.; Li, X.; Yang, B.; Song, J.; Zhao, X.; Huang, B.; Shi, W.; Lu, R.; et al. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N. Engl. J. Med. 2020, 382, 727–733. [Google Scholar] [CrossRef]
- Huang, C.; Wang, Y.; Li, X.; Ren, L.; Zhao, J.; Hu, Y.; Zhang, L.; Fan, G.; Xu, J.; Gu, X.; et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 2020, 395, 497–506. [Google Scholar] [CrossRef]
- Chen, N.; Zhou, M.; Dong, X.; Qu, J.; Gong, F.; Han, Y.; Qiu, Y.; Wang, J.; Liu, Y.; Wei, Y.; et al. Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: A descriptive study. Lancet 2020, 395, 507–513. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Hu, B.; Hu, C.; Zhu, F.; Liu, X.; Zhang, J.; Wang, B.; Xiang, H.; Cheng, Z.; Xiong, Y.; et al. Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus-Infected Pneumonia in Wuhan, China. JAMA 2020, 323, 1061–1069. [Google Scholar] [CrossRef] [PubMed]
- Al-Sadeq, D.W.; Nasrallah, G.K. The incidence of the novel coronavirus SARS-CoV-2 among asymptomatic patients: A systematic review. Int. J. Infect. Dis. 2020, 98, 372–380. [Google Scholar] [CrossRef] [PubMed]
- Miyamae, Y.; Hayashi, T.; Yonezawa, H.; Fujihara, J.; Matsumoto, Y.; Ito, T.; Tsubota, T.; Ishii, K. Duration of viral shedding in asymptomatic or mild cases of novel coronavirus disease 2019 (COVID-19) from a cruise ship: A single-hospital experience in Tokyo, Japan. Int. J. Infect. Dis. 2020, 97, 293–295. [Google Scholar] [CrossRef] [PubMed]
- Wei, M.; Yuan, J.; Liu, Y.; Fu, T.; Yu, X.; Zhang, Z.J. Novel Coronavirus Infection in Hospitalized Infants Under 1 Year of Age in China. JAMA 2020, 323, 1313–1314. [Google Scholar] [CrossRef]
- Tshokey, T.; Choden, J.; Dorjee, K.; Pempa, P.; Yangzom, P.; Gyeltshen, W.; Wangchuk, S.; Dorji, T.; Wangmo, D. Limited Secondary Transmission of the Novel Coronavirus (SARS-CoV-2) by Asymptomatic and Mild COVID-19 Patients in Bhutan. Am. J. Trop. Med. Hyg. 2020, 104, 490–495. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Wang, B.; Mao, S.; Ye, Q. Assessment of global asymptomatic SARS-CoV-2 infection and management practices from China. Int. J. Biol. Sci. 2021, 17, 1119–1124. [Google Scholar] [CrossRef] [PubMed]
- Jefferson, T.; Spencer, E.A.; Brassey, J.; Onakpoya, I.J.; Rosca, E.C.; Plüddemann, A.; Evans, D.H.; Conly, J.M.; Heneghan, C.J. Transmission of Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2) from pre and asymptomatic infected individuals: A systematic review. Clin. Microbiol. Infect. 2022, 28, 178–189. [Google Scholar] [CrossRef]
- Coronaviridae Study Group of the International Committee on Taxonomy of Viruses. The species Severe acute respiratory syndrome-related coronavirus: Classifying 2019-nCoV and naming it SARS-CoV-2. Nat. Microbiol. 2020, 5, 536–544. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Guan, X.; Wu, P.; Wang, X.; Zhou, L.; Tong, Y.; Ren, R.; Leung, K.S.M.; Lau, E.H.Y.; Wong, J.Y.; et al. Early transmission dynamics in Wuhan, China, of novel coronavirus-infected pneumonia. N. Engl. J. Med. 2020, 382, 1199–1207. [Google Scholar] [CrossRef] [PubMed]
- Phan, L.T.; Nguyen, T.V.; Luong, Q.C.; Nguyen, T.V.; Nguyen, H.T.; Le, H.Q.; Nguyen, T.T.; Cao, T.M.; Pham, Q.D. Importation and Human-to-Human Transmission of a Novel Coronavirus in Vietnam. N. Engl. J. Med. 2020, 382, 872–874. [Google Scholar] [CrossRef] [PubMed]
- Riou, J.; Althaus, C.L. Pattern of early human-to-human transmission of Wuhan 2019 novel coronavirus (2019-nCoV), December 2019 to January 2020. Euro. Surveill. 2020, 25, 2000058. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Pei, S.; Chen, B.; Song, Y.; Zhang, T.; Yang, W.; Shaman, J. Substantial undocumented infection facilitates the rapid dissemination of novel coronavirus (SARS-CoV-2). Science 2020, 368, 489–493. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Lai, S.; Gao, G.F.; Shi, W. The emergence, genomic diversity and global spread of SARS-CoV-2. Nature 2021, 600, 408–418. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. Coronavirus Diseases (COVID-19) Pandemic. Available online: https://www.who.int/emergencies/diseases/novel-coronavirus-2019 (accessed on 13 March 2024).
- Elena, S.F.; Sanjuán, R. Adaptive value of high mutation rates of RNA viruses: Separating causes from consequences. J. Virol. 2005, 79, 11555–11558. [Google Scholar] [CrossRef] [PubMed]
- Ziegler, K.; Steininger, P.; Ziegler, R.; Steinmann, J.; Korn, K.; Ensser, A. SARS-CoV-2 samples may escape detection because of a single point mutation in the N gene. Euro. Surveill. 2020, 25, 2001650. [Google Scholar] [CrossRef]
- Ko, K.K.K.; Abdul Rahman, N.B.; Tan, S.Y.L.; Chan, K.X.L.; Goh, S.S.; Sim, J.H.C.; Lim, K.L.; Tan, W.L.; Chan, K.S.; Oon, L.L.E.; et al. SARS-CoV-2 N Gene G29195T Point Mutation May Affect Diagnostic Reverse Transcription-PCR Detection. Microbiol. Spectr. 2022, 10, e0222321. [Google Scholar] [CrossRef]
- Wang, H.; Jean, S.; Wilson, S.A.; Lucyshyn, J.M.; McGrath, S.; Wilson, R.K.; Magrini, V.; Leber, A.L. A deletion in the N gene of SARS-CoV-2 may reduce test sensitivity for detection of SARS-CoV-2. Diagn. Microbiol. Infect. Dis. 2022, 102, 115631. [Google Scholar] [CrossRef]
- Mentes, A.; Papp, K.; Visontai, D.; Stéger, J.; VEO Technical Working Group; Csabai, I.; Medgyes-Horváth, A.; Pipek, O.A. Identification of mutations in SARS-CoV-2 PCR primer regions. Sci. Rep. 2022, 12, 18651. [Google Scholar] [CrossRef] [PubMed]
- Yip, C.C.; Chan, W.M.; Ip, J.D.; Seng, C.W.; Leung, K.H.; Poon, R.W.; Ng, A.C.; Wu, W.L.; Zhao, H.; Chan, K.H.; et al. Nanopore Sequencing Reveals Novel Targets for Detection and Surveillance of Human and Avian Influenza A Viruses. J. Clin. Microbiol. 2020, 58, e02127-19. [Google Scholar] [CrossRef] [PubMed]
- Chan, W.M.; Ip, J.D.; Chu, A.W.; Yip, C.C.; Lo, L.S.; Chan, K.H.; Ng, A.C.; Poon, R.W.; To, W.K.; Tsang, O.T.; et al. Identification of nsp1 gene as the target of SARS-CoV-2 real-time RT-PCR using nanopore whole-genome sequencing. J. Med. Virol. 2020, 92, 2725–2734. [Google Scholar] [CrossRef] [PubMed]
- Yip, C.C.; Sridhar, S.; Chan, W.M.; Ip, J.D.; Chu, A.W.; Leung, K.H.; Cheng, V.C.; Yuen, K.Y.; To, K.K. Development and Validation of a Novel COVID-19 nsp8 One-Tube RT-LAMP-CRISPR Assay for SARS-CoV-2 Diagnosis. Microbiol. Spectr. 2022, 10, e0196222. [Google Scholar] [CrossRef] [PubMed]
- Abbasian, M.H.; Mahmanzar, M.; Rahimian, K.; Mahdavi, B.; Tokhanbigli, S.; Moradi, B.; Sisakht, M.M.; Deng, Y. Global landscape of SARS-CoV-2 mutations and conserved regions. J. Transl. Med. 2023, 21, 152. [Google Scholar] [CrossRef] [PubMed]
- Bui, N.N.; Lin, Y.T.; Huang, S.H.; Lin, C.W. The extent of molecular variation in novel SARS-CoV-2 after the six-month global spread. Infect. Genet. Evol. 2021, 91, 104800. [Google Scholar] [CrossRef]
- Flores-Vega, V.R.; Monroy-Molina, J.V.; Jiménez-Hernández, L.E.; Torres, A.G.; Santos-Preciado, J.I.; Rosales-Reyes, R. SARS-CoV-2: Evolution and Emergence of New Viral Variants. Viruses 2022, 14, 653. [Google Scholar] [CrossRef]
- Obermeyer, F.; Jankowiak, M.; Barkas, N.; Schaffner, S.F.; Pyle, J.D.; Yurkovetskiy, L.; Bosso, M.; Park, D.J.; Babadi, M.; MacInnis, B.L. Analysis of 6.4 million SARS-CoV-2 genomes identifies mutations associated with fitness. Science 2022, 376, 1327–1332. [Google Scholar] [CrossRef]
- Markov, P.V.; Ghafari, M.; Beer, M.; Lythgoe, K.; Simmonds, P.; Stilianakis, N.I.; Katzourakis, A. The evolution of SARS-CoV-2. Nat. Rev. Microbiol. 2023, 21, 361–379. [Google Scholar] [CrossRef]
- Jeworowski, L.M.; Mühlemann, B.; Walper, F.; Schmidt, M.L.; Jansen, J.; Krumbholz, A.; Simon-Lorière, E.; Jones, T.C.; Corman, V.M.; Drosten, C. Humoral immune escape by current SARS-CoV-2 variants BA.2.86 and JN.1, December 2023. Euro. Surveill. 2024, 29, 2300740. [Google Scholar] [CrossRef]
- World Health Organization. Initial Risk Evaluation of JN.1. 19 December 2023. Available online: https://www.who.int/docs/default-source/coronaviruse/18122023_jn.1_ire_clean.pdf?sfvrsn=6103754a_3 (accessed on 31 January 2024).
- Miller, S.; Lee, T.; Merritt, A.; Pryce, T.; Levy, A.; Speers, D. Single-Point Mutations in the N Gene of SARS-CoV-2 Adversely Impact Detection by a Commercial Dual Target Diagnostic Assay. Microbiol. Spectr. 2021, 9, e0149421. [Google Scholar] [CrossRef]
- Wollschläger, P.; Todt, D.; Gerlitz, N.; Pfaender, S.; Bollinger, T.; Sing, A.; Dangel, A.; Ackermann, N.; Korn, K.; Ensser, A.; et al. SARS-CoV-2 N gene dropout and N gene Ct value shift as indicator for the presence of B.1.1.7 lineage in a commercial multiplex PCR assay. Clin. Microbiol. Infect. 2021, 27, 1353.e1–1353.e5. [Google Scholar] [CrossRef]
- Malone, B.; Urakova, N.; Snijder, E.J.; Campbell, E.A. Structures and functions of coronavirus replication-transcription complexes and their relevance for SARS-CoV-2 drug design. Nat. Rev. Mol. Cell. Biol. 2022, 23, 21–39. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Rizvi, S.R.A.; Dong, D.; Lou, J.; Wang, Q.; Sopipong, W.; Su, Y.; Najar, F.; Agarwal, P.K.; Kozielski, F.; et al. Emerging variants of SARS-CoV-2 NSP10 highlight strong functional conservation of its binding to two non-structural proteins, NSP14 and NSP16. Elife 2023, 12, RP87884. [Google Scholar] [CrossRef]
- Yip, C.C.; Sridhar, S.; Cheng, A.K.; Leung, K.H.; Choi, G.K.; Chen, J.H.; Poon, R.W.; Chan, K.H.; Wu, A.K.; Chan, H.S.; et al. Evaluation of the commercially available LightMix Modular E-gene kit using clinical and proficiency testing specimens for SARS-CoV-2 detection. J. Clin. Virol. 2020, 129, 104476. [Google Scholar] [CrossRef]
- Lowe, C.F.; Matic, N.; Ritchie, G.; Lawson, T.; Stefanovic, A.; Champagne, S.; Leung, V.; Romney, M.G. Detection of low levels of SARS-CoV-2 RNA from nasopharyngeal swabs using three commercial molecular assays. J. Clin. Virol. 2020, 128, 104387. [Google Scholar] [CrossRef]
- Okamaoto, K.; Shirato, K.; Nao, N.; Saito, S.; Kageyama, T.; Hasegawa, H.; Suzuki, T.; Matsuyama, S.; Takeda, M. Assessment of Real-Time RT-PCR Kits for SARS-CoV-2 Detection. Jpn. J. Infect. Dis. 2020, 73, 366–368. [Google Scholar] [CrossRef] [PubMed]
- Poljak, M.; Korva, M.; Knap Gašper, N.; Fujs Komloš, K.; Sagadin, M.; Uršič, T.; Avšič Županc, T.; Petrovec, M. Clinical Evaluation of the cobas SARS-CoV-2 Test and a Diagnostic Platform Switch during 48 Hours in the Midst of the COVID-19 Pandemic. J. Clin. Microbiol. 2020, 58, e00599-20. [Google Scholar] [CrossRef]
- Ho, Y.I.I.; Wong, A.H.; Leung, E.C.M.; Wong, R.C.W.; Lai, R.W.M. Rapid adaptation and continuous performance evaluation of SARS-CoV-2 envelope gene (E-gene) real-time RT-PCR assays to support the hospital surge in test demand. J. Med. Virol. 2021, 93, 1824–1827. [Google Scholar] [CrossRef] [PubMed]
- Onwuamah, C.K.; Okwuraiwe, A.P.; Salu, O.B.; Shaibu, J.O.; Ndodo, N.; Amoo, S.O.; Okoli, L.C.; Ige, F.A.; Ahmed, R.A.; Bankole, M.A.; et al. Comparative performance of SARS-CoV-2 real-time PCR diagnostic assays on samples from Lagos, Nigeria. PLoS ONE 2021, 16, e0246637. [Google Scholar] [CrossRef]
- Procop, G.W.; Brock, J.E.; Reineks, E.Z.; Shrestha, N.K.; Demkowicz, R.; Cook, E.; Ababneh, E.; Harrington, S.M. A Comparison of Five SARS-CoV-2 Molecular Assays with Clinical Correlations. Am. J. Clin. Pathol. 2021, 155, 69–78. [Google Scholar] [CrossRef]
- Hamar, Á.; Filipánits, K.; Váradi, A.; Váradi-Rácz, R.; Gellén, H.O.; Futács, K.; Urbán, P.; Kovacs, G.L.; Gombos, K. Diagnostic accuracy of SARS-CoV-2 Panbio rapid antigen diagnostic tests in a 4440-case clinical follow-up. Front. Med. 2022, 9, 908127. [Google Scholar] [CrossRef] [PubMed]
- Chan, J.F.; Yip, C.C.; To, K.K.; Tang, T.H.; Wong, S.C.; Leung, K.H.; Fung, A.Y.; Ng, A.C.; Zou, Z.; Tsoi, H.W.; et al. Improved Molecular Diagnosis of COVID-19 by the Novel, Highly Sensitive and Specific COVID-19-RdRp/Hel Real-Time Reverse Transcription-PCR Assay Validated In Vitro and with Clinical Specimens. J. Clin. Microbiol. 2020, 58, e00310-20. [Google Scholar] [CrossRef]
- Yip, C.C.; Sridhar, S.; Leung, K.H.; Ng, A.C.; Chan, K.H.; Chan, J.F.; Tsang, O.T.; Hung, I.F.; Cheng, V.C.; Yuen, K.Y.; et al. Development and Evaluation of Novel and Highly Sensitive Single-Tube Nested Real-Time RT-PCR Assays for SARS-CoV-2 Detection. Int. J. Mol. Sci. 2020, 21, 5674. [Google Scholar] [CrossRef]
- To, K.K.; Chan, W.M.; Ip, J.D.; Chu, A.W.; Tam, A.R.; Liu, R.; Wu, A.K.; Lung, K.C.; Tsang, O.T.; Lau, D.P.; et al. Unique Clusters of Severe Acute Respiratory Syndrome Coronavirus 2 Causing a Large Coronavirus Disease 2019 Outbreak in Hong Kong. Clin. Infect. Dis. 2021, 73, 137–142. [Google Scholar] [CrossRef] [PubMed]
- Nanoporetech/Medaka. Available online: https://github.com/nanoporetech/medaka (accessed on 31 January 2024).
- Alimanfoo/Pysamstats. Available online: https://github.com/alimanfoo/pysamstats (accessed on 31 January 2024).
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed]
Primer/Probe 1 | Sequence (5′-3′) | Position 2 |
---|---|---|
nCoV_nsp10-F | TGGTGCATCGTGTTGTCTGT | 13,231–13,250 |
nCoV_nsp10-R | CCACAGGGTCATTAGCACAA | 13,330–13,349 |
nCoV_nsp10-probe | FAM-CTGCCGTTGCCACATAGATCAT-IABkFQ | 13,252–13,273 |
Concentration (Copies/mL) | Cp (Intra-Run) | Cp (Inter-Run) | ||||||
---|---|---|---|---|---|---|---|---|
Test 1 | Test 2 | Test 3 | Test 4 | Test 1 | Test 2 | Test 3 | Test 4 | |
500 | 36.31 | 35.62 | 36.49 | 36.25 | 35.92 | 35.35 | 35.86 | 35.25 |
250 | 37.09 | 36.65 | 37.02 | 37.01 | 36.85 | 35.68 | 36.07 | 36.59 |
125 | 38.07 | 38.73 | 37.78 | 36.94 | 37.17 | 37.14 | 36.76 | 37.17 |
62.5 | 37.23 | 38.66 | 38.13 | - | 37.92 | 37.2 | 36.71 | 39.12 |
31.3 | - | 40 | - | 40 | 38.48 | 38.39 | - | 37.68 |
15.6 | - | - | - | - | 38.56 | - | - | - |
NTC | - | - | - | - | - | - | - | - |
Molecular Assay | LightMix E-Gene RT-PCR | ||||
---|---|---|---|---|---|
Positive | Negative | Kappa Value (95% CI) 1 | McNemar’s Test | ||
COVID-19-nsp10 real-time RT-PCR | Positive | 147 | 0 | 1.00 (1.00–1.00) | p = 1.000 |
Negative | 0 | 114 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yip, C.C.-Y.; Poon, J.H.-C.; Leung, K.-H.; Chan, W.-M.; Ip, J.D.; Chu, A.W.-H.; Cheng, V.C.-C.; Yuen, K.-Y.; To, K.K.-W. Development and Evaluation of an In-House Real-Time RT-PCR Targeting nsp10 Gene for SARS-CoV-2 Detection. Int. J. Mol. Sci. 2024, 25, 3552. https://doi.org/10.3390/ijms25063552
Yip CC-Y, Poon JH-C, Leung K-H, Chan W-M, Ip JD, Chu AW-H, Cheng VC-C, Yuen K-Y, To KK-W. Development and Evaluation of an In-House Real-Time RT-PCR Targeting nsp10 Gene for SARS-CoV-2 Detection. International Journal of Molecular Sciences. 2024; 25(6):3552. https://doi.org/10.3390/ijms25063552
Chicago/Turabian StyleYip, Cyril Chik-Yan, Jane Hau-Ching Poon, Kit-Hang Leung, Wan-Mui Chan, Jonathan Daniel Ip, Allen Wing-Ho Chu, Vincent Chi-Chung Cheng, Kwok-Yung Yuen, and Kelvin Kai-Wang To. 2024. "Development and Evaluation of an In-House Real-Time RT-PCR Targeting nsp10 Gene for SARS-CoV-2 Detection" International Journal of Molecular Sciences 25, no. 6: 3552. https://doi.org/10.3390/ijms25063552
APA StyleYip, C. C.-Y., Poon, J. H.-C., Leung, K.-H., Chan, W.-M., Ip, J. D., Chu, A. W.-H., Cheng, V. C.-C., Yuen, K.-Y., & To, K. K.-W. (2024). Development and Evaluation of an In-House Real-Time RT-PCR Targeting nsp10 Gene for SARS-CoV-2 Detection. International Journal of Molecular Sciences, 25(6), 3552. https://doi.org/10.3390/ijms25063552