DNA G-Quadruplex in NRP1 Promoter Facilitates SARS-CoV-2 Infection
Abstract
1. Introduction
2. Results
2.1. Identification of Two G-Quadruplex Structures in the NRP1 Promoter
2.2. The Expression Level of NRP1 Is Upregulated in Cells Infected with SARS-CoV-2
2.3. The G-Quadruplex Structures in the Promoter Increase the Expression Levels of NRP1
2.4. Sequestration or Disruption of G4 Structures in the Promoter Inhibits the Expression Levels of NRP1
2.5. G4s Affect the Invasion of SARS-CoV-2 by Regulating the Expression of NRP1
2.6. G4 Recruit E2F1 in the Promoter Region, Regulating NRP1 Expression
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. CD Spectroscopy
4.3. Western Blot
4.4. RT–qPCR
4.5. ChIP–qPCR
4.6. Non-Denaturing Gel Electrophoresis
4.7. Plasmid Construction and Viral Packaging
4.8. ChIP-Seq Data and scRNA-Seq Data Processing
4.9. DNA Pull-Down
4.10. Dual-Luciferase Reporter Assay
4.11. Statistical Analyses
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mokhtari, T.; Hassani, F.; Ghaffari, N.; Ebrahimi, B.; Yarahmadi, A.; Hassanzadeh, G. COVID-19 and multiorgan failure: A narrative review on potential mechanisms. J. Mol. Histol. 2020, 51, 613–628. [Google Scholar] [CrossRef] [PubMed]
- Mlcochova, P.; Kemp, S.A.; Dhar, M.S.; Papa, G.; Meng, B.; Ferreira, I.; Datir, R.; Collier, D.A.; Albecka, A.; Singh, S.; et al. SARS-CoV-2 B.1.617.2 Delta variant replication and immune evasion. Nature 2021, 599, 114–119. [Google Scholar] [CrossRef] [PubMed]
- Faria, N.R.; Mellan, T.A.; Whittaker, C.; Claro, I.M.; Candido, D.D.S.; Mishra, S.; Crispim, M.A.E.; Sales, F.C.S.; Hawryluk, I.; McCrone, J.T.; et al. Genomics and epidemiology of the P.1 SARS-CoV-2 lineage in Manaus, Brazil. Science 2021, 372, 815–821. [Google Scholar] [CrossRef] [PubMed]
- Vescarelli, E.; Gerini, G.; Megiorni, F.; Anastasiadou, E.; Pontecorvi, P.; Solito, L.; De Vitis, C.; Camero, S.; Marchetti, C.; Mancini, R.; et al. MiR-200c sensitizes Olaparib-resistant ovarian cancer cells by targeting Neuropilin 1. J. Exp. Clin. Cancer Res. 2020, 39, 3. [Google Scholar] [CrossRef] [PubMed]
- Fantin, A.; Vieira, J.M.; Plein, A.; Denti, L.; Fruttiger, M.; Pollard, J.W.; Ruhrberg, C. NRP1 acts cell autonomously in endothelium to promote tip cell function during sprouting angiogenesis. Blood 2013, 121, 2352–2362. [Google Scholar] [CrossRef] [PubMed]
- Pan, Q.; Chathery, Y.; Wu, Y.; Rathore, N.; Tong, R.K.; Peale, F.; Bagri, A.; Tessier-Lavigne, M.; Koch, A.W.; Watts, R.J. Neuropilin-1 binds to VEGF121 and regulates endothelial cell migration and sprouting. J. Biol. Chem. 2007, 282, 24049–24056. [Google Scholar] [CrossRef] [PubMed]
- Cantuti-Castelvetri, L.; Ojha, R.; Pedro, L.D.; Djannatian, M.; Franz, J.; Kuivanen, S.; van der Meer, F.; Kallio, K.; Kaya, T.; Anastasina, M.; et al. Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity. Science 2020, 370, 856–860. [Google Scholar] [CrossRef] [PubMed]
- Daly, J.L.; Simonetti, B.; Klein, K.; Chen, K.E.; Williamson, M.K.; Anton-Plagaro, C.; Shoemark, D.K.; Simon-Gracia, L.; Bauer, M.; Hollandi, R.; et al. Neuropilin-1 is a host factor for SARS-CoV-2 infection. Science 2020, 370, 861–865. [Google Scholar] [CrossRef] [PubMed]
- Bochman, M.L.; Paeschke, K.; Zakian, V.A. DNA secondary structures: Stability and function of G-quadruplex structures. Nat. Rev. Genet. 2012, 13, 770–780. [Google Scholar] [CrossRef]
- Ruggiero, E.; Richter, S.N. G-quadruplexes and G-quadruplex ligands: Targets and tools in antiviral therapy. Nucleic Acids Res. 2018, 46, 3270–3283. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.; Du, W.; Sang, X.; Tong, Q.; Wang, Y.; Chen, G.; Yuan, Y.; Jiang, L.; Cheng, W.; Liu, D.; et al. RNA G-quadruplex in TMPRSS2 reduces SARS-CoV-2 infection. Nat. Commun. 2022, 13, 1444. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Wang, H.; Yin, Z.; Fang, P.; Xiao, R.; Xiang, Y.; Wang, W.; Li, Q.; Huang, B.; Huang, J.; et al. Ligand-induced native G-quadruplex stabilization impairs transcription initiation. Genome Res. 2021, 31, 1546–1560. [Google Scholar] [CrossRef] [PubMed]
- Gu, Y.; Cao, J.; Zhang, X.; Gao, H.; Wang, Y.; Wang, J.; He, J.; Jiang, X.; Zhang, J.; Shen, G.; et al. Receptome profiling identifies KREMEN1 and ASGR1 as alternative functional receptors of SARS-CoV-2. Cell Res. 2022, 32, 24–37. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhang, Z.; Yang, L.; Lian, X.; Xie, Y.; Li, S.; Xin, S.; Cao, P.; Lu, J. The MERS-CoV Receptor DPP4 as a Candidate Binding Target of the SARS-CoV-2 Spike. iScience 2020, 23, 101160. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Chen, L.; Qin, C.; Huo, F.; Liang, X.; Yang, X.; Zhang, K.; Lin, P.; Liu, J.; Feng, Z.; et al. CD147 contributes to SARS-CoV-2-induced pulmonary fibrosis. Signal Transduct. Target. Ther. 2022, 7, 382. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Qiu, Z.; Hou, Y.; Deng, X.; Xu, W.; Zheng, T.; Wu, P.; Xie, S.; Bian, W.; Zhang, C.; et al. AXL is a candidate receptor for SARS-CoV-2 that promotes infection of pulmonary and bronchial epithelial cells. Cell Res. 2021, 31, 126–140. [Google Scholar] [CrossRef] [PubMed]
- Zheng, K.W.; Zhang, J.Y.; He, Y.D.; Gong, J.Y.; Wen, C.J.; Chen, J.N.; Hao, Y.H.; Zhao, Y.; Tan, Z. Detection of genomic G-quadruplexes in living cells using a small artificial protein. Nucleic Acids Res. 2020, 48, 11706–11720. [Google Scholar] [CrossRef] [PubMed]
- Kikin, O.; D’Antonio, L.; Bagga, P.S. QGRS Mapper: A web-based server for predicting G-quadruplexes in nucleotide sequences. Nucleic Acids Res. 2006, 34, W676–W682. [Google Scholar] [CrossRef] [PubMed]
- Ravindra, N.G.; Alfajaro, M.M.; Gasque, V.; Habet, V.; Wei, J.; Filler, R.B.; Huston, N.C.; Wan, H.; Szigeti-Buck, K.; Wang, B.; et al. Single-cell longitudinal analysis of SARS-CoV-2 infection in human airway epithelium. bioRxiv 2020. [Google Scholar] [CrossRef]
- Chen, H.; Sun, H.; Chai, Y.; Zhang, S.; Guan, A.; Li, Q.; Yao, L.; Tang, Y. Insulin-like growth factor type I selectively binds to G-quadruplex structures. Biochim. Biophys. Acta Gen. Subj. 2019, 1863, 31–38. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Tanasa, B.; Tyurina, O.V.; Zhou, T.Y.; Gassmann, R.; Liu, W.T.; Ohgi, K.A.; Benner, C.; Garcia-Bassets, I.; Aggarwal, A.K.; et al. PHF8 mediates histone H4 lysine 20 demethylation events involved in cell cycle progression. Nature 2010, 466, 508–512. [Google Scholar] [CrossRef] [PubMed]
- Cao, A.R.; Rabinovich, R.; Xu, M.; Xu, X.; Jin, V.X.; Farnham, P.J. Genome-wide analysis of transcription factor E2F1 mutant proteins reveals that N- and C-terminal protein interaction domains do not participate in targeting E2F1 to the human genome. J. Biol. Chem. 2011, 286, 11985–11996. [Google Scholar] [CrossRef] [PubMed]
- Ramos-Montoya, A.; Lamb, A.D.; Russell, R.; Carroll, T.; Jurmeister, S.; Galeano-Dalmau, N.; Massie, C.E.; Boren, J.; Bon, H.; Theodorou, V.; et al. HES6 drives a critical AR transcriptional programme to induce castration-resistant prostate cancer through activation of an E2F1-mediated cell cycle network. EMBO Mol. Med. 2014, 6, 651–661. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Qiu, J.; Zhou, W.; Cao, J.; Hu, X.; Mi, W.; Su, B.; He, B.; Qiu, J.; Shen, L. Neuropilin-1 mediates lung tissue-specific control of ILC2 function in type 2 immunity. Nat. Immunol. 2022, 23, 237–250. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Somasundaram, A.; Manne, S.; Gocher, A.M.; Szymczak-Workman, A.L.; Vignali, K.M.; Scott, E.N.; Normolle, D.P.; John Wherry, E.; Lipson, E.J.; et al. Neuropilin-1 is a T cell memory checkpoint limiting long-term antitumor immunity. Nat. Immunol. 2020, 21, 1010–1021. [Google Scholar] [CrossRef] [PubMed]
- Acharya, N.; Anderson, A.C. NRP1 cripples immunological memory. Nat. Immunol. 2020, 21, 972–973. [Google Scholar] [CrossRef] [PubMed]
- Yin, W.; Mao, C.; Luan, X.; Shen, D.D.; Shen, Q.; Su, H.; Wang, X.; Zhou, F.; Zhao, W.; Gao, M.; et al. Structural basis for inhibition of the RNA-dependent RNA polymerase from SARS-CoV-2 by remdesivir. Science 2020, 368, 1499–1504. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Lin, D.; Sun, X.; Curth, U.; Drosten, C.; Sauerhering, L.; Becker, S.; Rox, K.; Hilgenfeld, R. Crystal structure of SARS-CoV-2 main protease provides a basis for design of improved alpha-ketoamide inhibitors. Science 2020, 368, 409–412. [Google Scholar] [CrossRef] [PubMed]
- Parmar, M.S. TMPRSS2: An Equally Important Protease as ACE2 in the Pathogenicity of SARS-CoV-2 Infection. Mayo Clin. Proc. 2021, 96, 2748–2752. [Google Scholar] [CrossRef] [PubMed]
- Yeung, M.L.; Teng, J.L.L.; Jia, L.; Zhang, C.; Huang, C.; Cai, J.P.; Zhou, R.; Chan, K.H.; Zhao, H.; Zhu, L.; et al. Soluble ACE2-mediated cell entry of SARS-CoV-2 via interaction with proteins related to the renin-angiotensin system. Cell 2021, 184, 2212–2228.e12. [Google Scholar] [CrossRef]
- Lavigne, M.; Helynck, O.; Rigolet, P.; Boudria-Souilah, R.; Nowakowski, M.; Baron, B.; Brule, S.; Hoos, S.; Raynal, B.; Guittat, L.; et al. SARS-CoV-2 Nsp3 unique domain SUD interacts with guanine quadruplexes and G4-ligands inhibit this interaction. Nucleic Acids Res. 2021, 49, 7695–7712. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Xiao, K.; Gu, Y.; Liu, H.; Sun, X. Whole Genome Identification of Potential G-Quadruplexes and Analysis of the G-Quadruplex Binding Domain for SARS-CoV-2. Front. Genet. 2020, 11, 587829. [Google Scholar] [CrossRef] [PubMed]
- Qin, G.; Zhao, C.; Liu, Y.; Zhang, C.; Yang, G.; Yang, J.; Wang, Z.; Wang, C.; Tu, C.; Guo, Z.; et al. RNA G-quadruplex formed in SARS-CoV-2 used for COVID-19 treatment in animal models. Cell Discov. 2022, 8, 86. [Google Scholar] [CrossRef] [PubMed]
- Varshney, D.; Spiegel, J.; Zyner, K.; Tannahill, D.; Balasubramanian, S. The regulation and functions of DNA and RNA G-quadruplexes. Nat. Rev. Mol. Cell Biol. 2020, 21, 459–474. [Google Scholar] [CrossRef] [PubMed]
- Spiegel, J.; Cuesta, S.M.; Adhikari, S.; Hansel-Hertsch, R.; Tannahill, D.; Balasubramanian, S. G-quadruplexes are transcription factor binding hubs in human chromatin. Genome Biol. 2021, 22, 117. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Liu, T.; Meyer, C.A.; Eeckhoute, J.; Johnson, D.S.; Bernstein, B.E.; Nusbaum, C.; Myers, R.M.; Brown, M.; Li, W.; et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol. 2008, 9, R137. [Google Scholar] [CrossRef] [PubMed]
- Butler, A.; Hoffman, P.; Smibert, P.; Papalexi, E.; Satija, R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat. Biotechnol. 2018, 36, 411–420. [Google Scholar] [CrossRef] [PubMed]
- Stuart, T.; Butler, A.; Hoffman, P.; Hafemeister, C.; Papalexi, E.; Mauck, W.M., 3rd; Hao, Y.; Stoeckius, M.; Smibert, P.; Satija, R. Comprehensive Integration of Single-Cell Data. Cell 2019, 177, 1888–1902.e21. [Google Scholar] [CrossRef]
- Becht, E.; McInnes, L.; Healy, J.; Dutertre, C.A.; Kwok, I.W.H.; Ng, L.G.; Ginhoux, F.; Newell, E.W. Dimensionality reduction for visualizing single-cell data using UMAP. Nat. Biotechnol. 2018, 37, 38–44. [Google Scholar] [CrossRef] [PubMed]
- Cox, J.; Matic, I.; Hilger, M.; Nagaraj, N.; Selbach, M.; Olsen, J.V.; Mann, M. A practical guide to the MaxQuant computational platform for SILAC-based quantitative proteomics. Nat. Protoc. 2009, 4, 698–705. [Google Scholar] [CrossRef]
G4 Name | Sequence (5′-3′) |
---|---|
G1-Wt | GGGGAGAGGGGCGGGAGGAAGCGAGGGAAGGGC |
G1-Mut | GAAGAGAGAAGCAAGAGGAAGCGAAAGAAGAAC |
G2-Wt | TGGGGGGAGGCCGCAGGAGGGGAGGCGGGGGT |
G2-Mut | TGAAGAGAGACCGCAAGAGAAGAGGCGAAAGT |
KIT-Wt | AGGGAGGGCGCTGGGAGGAGGGG |
KIT-Mut | AAAGAGAACGCTAAGAGGAGGAA |
Gene | Sequence (5′-3′) |
---|---|
E2F1 | F: GGACCTGGAAACTGACCATCAG R: CAGTGAGGTCTCATAGCGTGAC |
NRP1 | F: AACAACGGCTCGGACTGGAAGA R: GGTAGATCCTGATGAATCGCGTG |
β-actin | F: GTCATTCCAAATATGAGATGCGT R: GCTATCACCTCCCCTGTGTG |
Gene | Sequence (5′-3′) |
---|---|
NRP1 | F: ACAGAGGAGTTTCACCAACTGC R: CCCAGTCTCCTGTCAGGCAATTA |
E2F1 | F: GCGGGAGACAGAGGAGTTTC R: TGTCAGGCAATTACAGGCGA |
Gene | Sequence (5′-3′) |
---|---|
E2F1-siRNA | sense: GGACCTGGAAACTGACCATCAG |
antisense: CAGTGAGGTCTCATAGCGTGAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gong, P.; Zhang, R.; Xiao, K.; Shu, H.; Li, X.; Fan, H.; Sun, X. DNA G-Quadruplex in NRP1 Promoter Facilitates SARS-CoV-2 Infection. Int. J. Mol. Sci. 2024, 25, 4422. https://doi.org/10.3390/ijms25084422
Gong P, Zhang R, Xiao K, Shu H, Li X, Fan H, Sun X. DNA G-Quadruplex in NRP1 Promoter Facilitates SARS-CoV-2 Infection. International Journal of Molecular Sciences. 2024; 25(8):4422. https://doi.org/10.3390/ijms25084422
Chicago/Turabian StyleGong, Pihai, Rongxin Zhang, Ke Xiao, Huiling Shu, Xinxiu Li, Hong Fan, and Xiao Sun. 2024. "DNA G-Quadruplex in NRP1 Promoter Facilitates SARS-CoV-2 Infection" International Journal of Molecular Sciences 25, no. 8: 4422. https://doi.org/10.3390/ijms25084422
APA StyleGong, P., Zhang, R., Xiao, K., Shu, H., Li, X., Fan, H., & Sun, X. (2024). DNA G-Quadruplex in NRP1 Promoter Facilitates SARS-CoV-2 Infection. International Journal of Molecular Sciences, 25(8), 4422. https://doi.org/10.3390/ijms25084422