Nosocomial Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus: Sensitivity to Chlorhexidine-Based Biocides and Prevalence of Efflux Pump Genes
Abstract
:1. Introduction
2. Results
2.1. Assessment of Sensitivity to Biocidal Compositions and Detection of Efflux Pump Genes in Nosocomial E. coli
2.1.1. Sensitivity of E. coli Strains to Chlorhexidine-Based Biocidal Compositions
2.1.2. Efflux Pump Genes in E. coli Strains
2.2. Assessment of Sensitivity to Biocidal Compositions and Detection of Efflux Pump Genes in Nosocomial K. pneumoniae
2.2.1. Sensitivity of K. pneumoniae Strains to Chlorhexidine-Based Biocidal Compositions
2.2.2. Efflux Pump Genes in K. pneumoniae Strains
2.3. Assessment of Sensitivity to Biocidal Compositions and Detection of Efflux Pump Genes in Nosocomial P. aeruginosa
2.3.1. Sensitivity of P. aeruginosa Strains to Chlorhexidine-Based Biocidal Compositions
2.3.2. Efflux Pump Genes in P. aeruginosa Strains
2.4. Assessment of Sensitivity to Biocidal Compositions and Detection of Efflux Pump Genes in Nosocomial S. aureus
2.4.1. Sensitivity of S. aureus Strains to Chlorhexidine-Based Biocidal Compositions
2.4.2. Efflux Pump Genes in S. aureus Strains
2.5. Comparison of the Sensitivity of Nosocomial E. coli, K. pneumoniae, P. aeruginosa, and S. aureus to Chlorhexidine-Based Biocidal Compositions in Plankton and Biofilm
2.6. Sensitivity of Nosocomial E. coli, K. pneumoniae, P. aeruginosa, and S. aureus to Chlorhexidine-Based Biocidal Compositions on the Surface
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains
4.2. Antimicrobial Susceptibility Testing
4.3. Biocidal Compositions
4.4. Assessment of the Effect of Biocides on Planktonic Cells (MIC, MBC)
4.5. Biofilm Biomass
4.6. Evaluation of the Effect of Biocidal Compositions on the Cells in a Biofilm
4.7. Evaluation of Antimicrobial Activity of Biocidal Compositions on Surfaces
4.8. PCR Detection of Efflux Pump Genes
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nowakiewicz, A.; Zięba, P.; Gnat, S.; Matuszewski, Ł. Last Call for Replacement of Antimicrobials in Animal Production: Modern Challenges, Opportunities, and Potential Solutions. Antibiotics 2020, 9, 883. [Google Scholar] [CrossRef] [PubMed]
- Urban-Chmiel, R.; Marek, A.; Stępień-Pyśniak, D.; Wieczorek, K.; Dec, M.; Nowaczek, A.; Osek, J. Antibiotic Resistance in Bacteria-A Review. Antibiotics 2022, 11, 1079. [Google Scholar] [CrossRef] [PubMed]
- Salam, M.A.; Al-Amin, M.Y.; Salam, M.T.; Pawar, J.S.; Akhter, N.; Rabaan, A.A.; Alqumber, M.A.A. Antimicrobial Resistance: A Growing Serious Threat for Global Public Health. Healthcare 2023, 11, 1946. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization (WHO). Prevention of Hospital-Acquired Infections. A Practical Guide, 2nd ed.; World Health Organization: Geneva, Switzerland, 2002. [Google Scholar]
- Khan, H.A.; Baig, F.K.; Mehboob, R. Nosocomial infections. Epidemiology, prevention, control and surveillance. Asian Pac. J. Trop. Biomed. 2017, 7, 478–482. [Google Scholar] [CrossRef]
- Lemiech-Mirowska, E.; Kiersnowska, Z.M.; Michałkiewicz, M.; Depta, A.; Marczak, M. Nosocomial infections as one of the most important problems of healthcare system. Ann. Agric. Environ. Med. 2021, 28, 361–366. [Google Scholar] [CrossRef] [PubMed]
- WHO Bacterial Priority Pathogens List, 2024: Bacterial Pathogens of Public Health Importance to Guide Research, Development and Strategies to Prevent and Control Antimicrobial Resistance; World Health Organization: Geneva, Switzerland, 2024.
- Otter, J.A.; Yezli, S.; Salkeld, J.A.; French, G.L. Evidence that contaminated surfaces contribute to the transmission of hospital pathogens and an overview of strategies to address contaminated surfaces in hospital settings. Am. J. Infect. Control. 2013, 41, 6–11. [Google Scholar] [CrossRef]
- Robakowska, M.; Bronk, M.; Tyrańska-Fobke, A.; Ślęzak, D.; Kraszewski, J.; Balwicki, Ł. Patient Safety Related to Microbiological Contamination of the Environment of a Multi-Profile Clinical Hospital. Int. J. Environ. Res. Public. Health. 2021, 18, 3844. [Google Scholar] [CrossRef]
- Shineh, G.; Mobaraki, M.; Perves Bappy, M.J.; Mills, D.K. Biofilm Formation, and Related Impacts on Healthcare, Food Processing and Packaging, Industrial Manufacturing, Marine Industries, and Sanitation–A Review. Appl. Microbiol. 2023, 3, 629–665. [Google Scholar] [CrossRef]
- World Health Organization (WHO). WHO Model List of Essential Medicine. Available online: https://www.who.int/publications/i/item/WHO-MHP-HPS-EML-2021.02 (accessed on 1 June 2022).
- McDonnell, G.; Russell, A.D. Antiseptics and disinfectants: Activity, action, and resistance. Clin. Microbiol. Rev. 1999, 12, 147–179. [Google Scholar] [CrossRef]
- Chen, B.; Han, J.; Dai, H.; Jia, P. Biocide-tolerance and antibiotic-resistance in community environments and risk of direct transfers to humans: Unintended consequences of community-wide surface disinfecting during COVID-19? Environ. Pollut. 2021, 283, 117074. [Google Scholar] [CrossRef]
- Huang, L.; Wu, C.; Gao, H.; Xu, C.; Dai, M.; Huang, L.; Hao, H.; Wang, X.; Cheng, G. Bacterial Multidrug Efflux Pumps at the Frontline of Antimicrobial Resistance: An Overview. Antibiotics 2022, 11, 520. [Google Scholar] [CrossRef] [PubMed]
- Alibert, S.; N’gompaza Diarra, J.; Hernandez, J.; Stutzmann, A.; Fouad, M.; Boyer, G.; Pages, J.-M. Multidrug efflux pumps and their role in antibiotic and antiseptic resistance: A pharmacodynamic perspective. Expert Opin. Drug Metab. Toxicol. 2017, 13, 301–309. [Google Scholar] [CrossRef] [PubMed]
- Slipski, C.; Jamieson-Datzkiw, T.; Zhanel, G.; Bay, D. Characterization of proteobacterial plasmid integron-encoded qac efflux pump sequence diversity and quaternary ammonium compound antiseptic selection in E. coli grown planktonically and as biofilms. Antimicrob. Agents Chemother. 2021, 65, AAC0106921. [Google Scholar] [CrossRef]
- Abbood, H.M.; Hijazi, K.; Gould, I.M. Chlorhexidine Resistance or Cross-Resistance, That Is the Question. Antibiotics 2023, 12, 798. [Google Scholar] [CrossRef]
- Hrovat, K.; Zupančič, J.Č.; Seme, K.; Avguštin, J.A. QAC Resistance Genes in ESBL-Producing E. coli Isolated from Patients with Lower Respiratory Tract Infections in the Central Slovenia Region—A 21-Year Survey. Trop. Med. Infect. Dis. 2023, 8, 273. [Google Scholar] [CrossRef]
- Rakshit, P.; Singh, A.; Singh, R.; Banerjee, T. An in-depth study on survival mechanism of bacterial isolates in disinfectants within the hospital environment. Front. Cell. Infect. Microbiol. 2024, 14, 1442914. [Google Scholar] [CrossRef]
- Lompo, P.; Heroes, A.-S.; Agbobli, E.; Kühne, V.; Tinto, H.; Affolabi, D.; Jacobs, J. Bacterial Contamination of Antiseptics, Disinfectants and Hand Hygiene Products in Healthcare Facilities in High-Income Countries: A Scoping Review. Hygiene 2023, 3, 136–175. [Google Scholar] [CrossRef]
- Hernando-Amado, S.; Blanco, P.; Alcalde-Rico, M.; Corona, F.; Reales-Calderon, J.A.; Sanchez, M.B.; Martinez, J.L. Multidrug efflux pumps as main players in intrinsic and acquired resistance to antimicrobials. Drug Resist. Updates 2016, 28, 13–27. [Google Scholar] [CrossRef]
- Laborda, P.; Molin, S.; Johansen, H.K.; Martínez, J.L.; Hernando-Amado, S. Role of bacterial multidrug efflux pumps during infection. World J. Microbiol. Biotechnol. 2024, 40, 226. [Google Scholar] [CrossRef]
- Cheung, H.-Y.; Wong, M.M.-K.; Cheung, S.-H.; Liang, L.Y.; Lam, Y.-W.; Chiu, S.-K. Differential Actions of Chlorhexidine on the Cell Wall of Bacillus subtilis and Escherichia coli. PLoS ONE 2012, 7, e36659. [Google Scholar] [CrossRef]
- Maillard, J. Resistance of Bacteria to Biocides. Microbiol. Spectr. 2018, 6, 2. [Google Scholar] [CrossRef] [PubMed]
- Morrissey, I.; Oggioni, M.R.; Knight, D.; Curiao, T.; Coque, T.; Kalkanci, A.; Martinez, J.L.; the BIOHYPO Consortium. Evaluation of Epidemiological Cut-Off Values Indicates that Biocide Resistant Subpopulations Are Uncommon in Natural Isolates of Clinically-Relevant Microorganisms. PLoS ONE 2014, 9, e86669. [Google Scholar] [CrossRef] [PubMed]
- Allaion, J.R.; Barrionuevo, K.G.; Grande Burgos, M.J.; Gálvez, A.; Franco, B. Staphylococcus aureus from Minas Artisanal Cheeses: Biocide Tolerance, Antibiotic Resistance and Enterotoxin Genes. Appl. Sci. 2022, 12, 1019. [Google Scholar] [CrossRef]
- Coles, V.E.; Puri, L.; Bhandari, M.; Wood, T.J.; Burrows, L.L. The effects of chlorhexidine, povidone-iodine and vancomycin on growth and biofilms of pathogens that cause prosthetic joint infections: An in-vitro model. J. Hosp. Infect. 2024, 151, 99e108. [Google Scholar] [CrossRef]
- Cichos, K.H.; Andrews, R.M.; Wolschendorf, F.; Narmore, W.; Mabry, S.E.; Ghanem, E.S. Efficacy of Intraoperative Antiseptic Techniques in the Prevention of Periprosthetic Joint Infection: Superiority of Betadine. J. Arthroplast. 2019, 34, S312–S318. [Google Scholar] [CrossRef]
- Mikláš, R.; Miklášová, N.; Bukovský, M.; Horváth, B.; Kubincová, J.; Devínsky, F. Synthesis, surface and antimicrobial properties of some quaternary ammonium homochiral camphor sulfonamides. Eur. J. Pharm. Sci. 2014, 65, 29–37. [Google Scholar] [CrossRef]
- Bonez, P.C.; dos Santos Alves, C.F.; Dalmolin, T.V.; Agertt, V.A.; Mizdal, C.R.; Costa Flores, V.; Marques, J.B.; Santos, R.V.; de Campos, M.M. Chlorhexidine activity against bacterial biofilms. Am. J. Infect. Control. 2013, 41, e119–e122. [Google Scholar] [CrossRef]
- Ebrahimi, A.; Hemati, M.; Habibian Dehkordi, S.; Bahadoran, S.; Khoshnood, S. Chlorhexidine Digluconate Effects on Planktonic Growth and Biofilm Formation in Some Field Isolates of Animal Bacterial Pathogens. Jundishapur J. Nat. Pharm. Prod. 2014, 9, e14298. [Google Scholar] [CrossRef]
- Hassan, K.A.; Jackson, S.M.; Penesyan, A.; Patching, S.G.; Tetu, S.G.; Eijkelkamp, B.A. Transcriptomic and biochemical analyses identify a family of chlorhexidine efflux proteins. Proc. Natl. Acad. Sci. USA 2013, 110, 20254–20259. [Google Scholar] [CrossRef]
- Lordelo, R.; Branco, R.; Gama, F.; Moraiset, P.V. Assessment of antimicrobial resistance, biofilm formation, and surface modification potential in hospital strains of Pseudomonas aeruginosa and Klebsiella pneumoniae. Heliyon 2024, 10, e30464. [Google Scholar] [CrossRef]
- Mohapatra, S. Sterilization and Disinfection. Essent. Neuroanesthesia 2017, 929–944. [Google Scholar]
- Fink, R. Terpenoids as Natural Agents against Food-Borne Bacteria—Evaluation of Biofilm Biomass versus Viability Reduction. Processes 2023, 11, 148. [Google Scholar] [CrossRef]
- Szekeres, E.; Chiriac, C.M.; Baricz, A.; Szoke-Nagy, T.; Lung, I.; Soran, M.L.; Rudi, K.; Dragos, N.; Coman, C. Investigating antibiotics, antibiotic resistance genes, and microbial contaminants in groundwater in relation to the proximity of urban areas. Environ. Pollut. 2018, 236, 734–744. [Google Scholar] [CrossRef] [PubMed]
- Stokes, H.W.; Hall, R.M. A novel family of potentially mobile DNA elements encoding site-specific gene-integration functions: Integrons. Mol. Microbiol. 1989, 3, 1669–1683. [Google Scholar] [CrossRef] [PubMed]
- Fang, C.T.; Chen, H.C.; Chuang, Y.P.; Chang, S.C.; Wang, J.T. Cloning of a cation efflux pump gene associated with chlorhexidine resistance in Klebsiella pneumoniae. Antimicrob. Agents Chemother. 2002, 46, 2024–2028. [Google Scholar] [CrossRef]
- Abuzaid, A.; Hamouda, A.; Amyes, S. Klebsiella pneumoniae susceptibility to biocides and its association with cepA, qacΔE and qacE efflux pump genes and antibiotic resistance. J. Hospital infection. 2012, 81, 87–91. [Google Scholar] [CrossRef]
- Pastrana-Carrasco, J.; Garza-Ramos, J.U.; Barrios, H.; Morfin-Otero, R.; Rodríguez-Noriega, E.; Barajas, J.M.; Suárez, S.; Díaz, R.; Miranda, G.; Solórzano, F.; et al. qacEΔ1 gene frequency and biocide resistance in extended-spectrum β-lactamase producing Enterobacteriaceae clinical isolates. Rev. Investig. Clínica 2013, 64, 535–540. [Google Scholar]
- Kosyakova, K.G.; Esaulenko, N.B.; Kameneva, O.A.; Kazakov, S.P.; Dubinina, A.Y.; Mezina, E.Y.; Zaitsev, A.A. Prevalence of Carbapenemase Genes, qacE, qacEΔ1 and cepA in Multidrug-Resistant Gram-Negative Bacteria with Different Susceptibility to Chlorhexidine. Epidemiol. Vaccinal Prev. 2020, 19, 49–60. (In Russian) [Google Scholar] [CrossRef]
- Kucken, D.; Feucht, H.; Kaulfers, P. Association of qacE and qacEΔ1 with multiple resistance to antibiotics and antiseptics in clinical isolates of Gram-negative bacteria. FEMS Microbiol. Lett. 2000, 183, 95–98. [Google Scholar] [CrossRef]
- Goodarzi, R.; Yousefimashouf, R.; Taheri, M.; Nouri, F.; Asghari, B. Susceptibility to biocides and the prevalence of biocides resistance genes in clinical multidrug-resistant P. aeruginosa isolates from Hamadan. Iran. Mol. Biol. Rep. 2021, 48, 5275–5281. [Google Scholar] [CrossRef]
- Wang, C.; Cai, P.; Guo, Y.; Mi, Z. Distribution of the antiseptic-resistance genes qacEDelta1 in 331 clinical isolates of P. aeruginosa in China. J. Hospital Infect. 2007, 66, 93–95. [Google Scholar]
- Radmehr, M.; Majid, M.; Ghasemzadeh-Moghaddam, H.; Azimian, A.; van Belkum, A. High Prevalence of Antiseptic Resistance Encoding Genes and Reduced Phenotypic Antiseptic Susceptibility Among Antibiotic-Resistant Pseudomonas aeruginosa Isolates. Jundishapur J. Microbiol. 2023, 16, e135911. [Google Scholar] [CrossRef]
- Kazama, H.; Hamashima, H.; Sasatsu, M.; Arai, T. Distribution of the antiseptic-resistance genes qacE and qacEΔ1 in Gram-negative bacteria. FEMS Microbiol. Lett. 1998, 159, 173–178. [Google Scholar] [CrossRef] [PubMed]
- Yuan, J.; Xu, X.; Guo, Q.; Zhao, X.; Ye, X.; Guo, Y.; Wang, M. Prevalence of the oqxAB gene complex in Klebsiella pneumoniae and Escherichia coli clinical isolates. J. Antimicrob. Chemother. 2012, 67, 1655–1659. [Google Scholar] [CrossRef]
- Dehnamaki, M.; Ghane, M.; Babaeekhou, L. Detection of OqxAB and QepA efflux pumps and their association with antibiotic resistance in Klebsiella pneumoniae isolated from urinary tract infection. Int. J. Infect. 2020, 7, e107397. [Google Scholar] [CrossRef]
- Ni, L.; Zhang, Z.; Shen, R.; Liu, X.; Li, X.; Chen, B.; Wu, X.; Li, H.; Xie, X.; Huang, S. Disinfection Strategies for Carbapenem-Resistant Klebsiella pneumoniae in a Healthcare Facility. Antibiotics 2022, 11, 736. [Google Scholar] [CrossRef]
- Levy, S.B. Active efflux, a common mechanism for biocide and antibiotic resistance. Appl. Microbiol. 2002, 92, 65S–71S. [Google Scholar] [CrossRef]
- Pakzad, I.; Zayyen Karin, M.; Taherikalani, M.; Boustanshenas, M.; Lari, A.R. Contribution of AcrAB efflux pump to ciprofloxacin resistance in Klebsiella pneumoniae isolated from burn patients. GMS Hyg. Infect. Control. 2013, 8, Doc15. [Google Scholar]
- Maurya, N.; Jangra, M.; Tambat, R.; Nandanwar, H. Alliance of efflux pumps with β-lactamases in multidrug-resistant Klebsiella pneumoniae isolates. Microb. Drug Resist. 2019, 25, 1155–1163. [Google Scholar] [CrossRef]
- Smith, B.L.; Fernando, S.; King, M.D. Escherichia coli resistance mechanism AcrAB-TolC efflux pump interactions with commonly used antibiotics: A molecular dynamics study. Sci. Rep. 2024, 14, 2742. [Google Scholar] [CrossRef]
- Cohen, S.P.; McMurry, L.M.; Levy, S.B. The marA locus causes decreased expression of OmpF porin in multiple antibiotic resistant (Mar) mutants of Escherichia coli. J. Bacteriol. 1988, 170, 5416–5422. [Google Scholar] [CrossRef]
- Guo, W.; Shan, K.; Xu, B.; Li, J. Determining the resistance of carbapenem-resistant Klebsiella pneumoniae to common disinfectants and elucidating the underlying resistance mechanisms. Pathog. Glob. Health 2015, 109, 184–192. [Google Scholar] [CrossRef] [PubMed]
- Padilla, E.; Llobet-Brossa, E.; Doménech-Sánchez, A.; Martínez-Martiínez, L.; Bengoechea, J.; Alberti, S. Klebsiella pneumoniae AcrAB Efflux Pump Contributes to Antimicrobial Resistance and Virulence. Antimicrob. Agents Chemother. 2010, 54, 177–183. [Google Scholar] [CrossRef] [PubMed]
- Bina, X.R.; Weng, Y.; Budnick, J.; Van Allen, M.E.; Bina, J.E. Klebsiella pneumoniae TolC contributes to antimicrobial resistance, exopolysaccharide production, and virulence. Infect. Immun. 2023, 91, e0030323. [Google Scholar] [CrossRef] [PubMed]
- Aparna, V.; Dineshkumar, K.; Mohanalakshmi, N.; Velmurugan, D.; Hopper, W. Identification of natural compound inhibitors for multidrug efflux pumps of Escherichia coli and Pseudomonas aeruginosa using in silico high-throughput virtual screening and in vitro validation. PLoS ONE 2014, 9, e101840. [Google Scholar] [CrossRef]
- Srikumar, R.; Kon, T.; Gotoh, N.; Poole, K. Expression of Pseudomonas aeruginosa multidrug efflux pumps MexA-MexB-OprM and MexC-MexD-OprJ in a multidrug-sensitive Escherichia coli strain. Antimicrob. Agents Chemother. 1998, 42, 65–71. [Google Scholar] [CrossRef]
- Horner, C.; Mawer, D.; Wilcox, M. Reduced susceptibility to chlorhexidine in staphylococci: Is it increasing and does it matter? J. Antimicrob. Chemother. 2012, 67, 2547–2559. [Google Scholar] [CrossRef]
- LaBreck, P.T.; Rice, G.K.; Paskey, A.C.; Elassal, E.M.; Cer, R.Z.; Law, N.N.; Schlett, C.D.; Bennett, J.W.; Millar, E.V.; Ellis, M.W.; et al. Conjugative Transfer of a Novel Staphylococcal Plasmid Encoding the Biocide Resistance Gene, qacA. Front. Microbiol. 2018, 19, 2664. [Google Scholar] [CrossRef]
- Damavandi, M.S.; Maryam, S.D.; Alireza, D.; Fatemeh, H.; Roohollah, T.; Abolfazl, G. Detection of Antiseptic Resistance Genes among Staphylococcus aureus Colonising Nurses and Coagulase-Negative Staphylococci Isolated from Clinical Specimens at Teaching Hospitals in Southwest of Iran. Jundishapur J. Microbiol. 2016, 10, e39285. [Google Scholar] [CrossRef]
- Schlett, C.D.; Millar, E.V.; Crawford, K.B.; Cui, T.Y.; Lanier, J.B.; Tribble, D.R. Prevalence of Chlorhexidine-Resistant Methicillin-Resistant Staphylococcus aureus following Prolonged Exposure. Antimicrob. Agents Chemother. 2014, 58, 4404–4410. [Google Scholar] [CrossRef]
- McClure, J.A.; Zaal DeLongchamp, J.; Conly, J.M.; Zhang, K. Novel Multiplex PCR Assay for Detection of Chlorhexidine-Quaternary Ammonium, Mupirocin, and Methicillin Resistance Genes, with Simultaneous Discrimination of Staphylococcus aureus from Coagulase-Negative Staphylococci. J. Clin. Microbiol. 2017, 55, 1857–1864. [Google Scholar] [CrossRef] [PubMed]
- Ghasemzadeh-Moghaddam, H.; Azimian, A.; Bayan, G.; Dashti, V.; Nojoomi, S.; Shirazi, N.; Solati, A.; Belkum, A.V. High prevalence and expression of antiseptic resistance genes among infectious t037/ST239 methicillin-resistant Staphylococcus aureus (MRSA) strains in North Khorasan Province, Iran. Iran. J. Basic Med. Sci. 2022, 25, 775–780. [Google Scholar] [PubMed]
- Ammar, A.M.; Attia, A.M.; Abd El-Hamid, M.I.; El-Shorbagy, I.M.; Abd El-Kader, S.A. Genetic basis of resistance waves among methicillin resistant Staphylococcus aureus isolates recovered from milk and meat products in Egypt. Cell. Mol. Biol. 2016, 62, 7–15. [Google Scholar] [PubMed]
- Costa, S.S.; Viveiros, M.; Amaral, L.; Couto, I. Multidrug Efflux Pumps in Staphylococcus aureus: An Update. Open Microbiol. J. 2013, 7, 59–71. [Google Scholar] [CrossRef]
- Hassanzadeh, S.; Ganjloo, S.; Pourmand, M.R.; Mashhadi, R.; Ghazvini, K. Epidemiology of efflux pumps genes mediating resistance among Staphylococcus aureus; A systematic review. Microb. Pathog. 2020, 139, 103850. [Google Scholar] [CrossRef]
- Kaatz, G.W.; Thyagarajan, R.V.; Seo, S.M. Effect of promoter region mutations and mgrA overexpression on transcription of norA, which encodes a Staphylococcus aureus multidrug efflux transporter. Antimicrob. Agents Chemother. 2005, 49, 161–169. [Google Scholar] [CrossRef]
- Truong-Bolduc, Q.C.; Hooper, D.C. Phosphorylation of MgrA and its effect on expression of the NorA and NorB efflux pumps of Staphylococcus aureus. J Bacteriol. 2010, 192, 2525–2534. [Google Scholar] [CrossRef]
- Deng, X.; Sun, F.; Ji, Q.; Liang, H.; Missiakas, D.; Lan, L.; He, C. Expression of multidrug resistance efflux pump gene norA is iron responsive in Staphylococcus aureus. J. Bacteriol. 2012, 194, 1753–1762. [Google Scholar] [CrossRef]
- Ghufran, S.; Shurook, S.; Kifah, J. Detection the Prevalence of Some Chromosomal Efflux Pump Genes in Methicillin Resistant Staphylococcus aureus Isolated from Iraqi Patients. Iraqi J. Biotechnol. 2019, 18, 33–42. [Google Scholar]
- Narui, K.; Noguchi, N.; Wakasugi, K.; Sasatsu, M. Cloning and characterization of a novel chromosomal drug efflux gene in Staphylococcus aureus. Biol. Pharm. Bull. 2002, 25, 1533–1536. [Google Scholar] [CrossRef]
- Antiabong, J.F.; Kock, M.M.; Bellea, N.M.; Ehlers, M.M. Diversity of Multidrug Efflux Genes and Phenotypic Evaluation of the In vitro Resistance Dynamics of Clinical Staphylococcus Aureus Isolates Using Methicillin; a Model β-lactam. Open Microbiol. J. 2017, 11, 132–141. [Google Scholar] [CrossRef] [PubMed]
- Kanamori, H.; Rutala, W.A.; Weber, D.J. The Role of Patient Care Items as a Fomite in Healthcare-Associated Outbreaks and Infection Prevention. Clin. Infect. Dis. 2017, 65, 1412–1419. [Google Scholar] [CrossRef] [PubMed]
- Rutala, W.A.; Weber, D.J. Best practices for disinfection of noncritical environmental surfaces and equipment in health care facilities: A bundle approach. Am. J. Infect. Control. 2019, 47, A96–A105. [Google Scholar] [CrossRef] [PubMed]
- Amsalu, A.; Sapula, S.A.; De Barros Lopes, M.; Hart, B.J.; Nguyen, A.H.; Drigo, B.; Turnidge, J.; Leong, L.E.; Venter, H. Efflux pump-driven antibiotic and biocide cross-resistance in Pseudomonas aeruginosa isolated from different ecological niches: A case study in the development of multidrug resistance in environmental hotspots. Microorganisms 2020, 8, 1647. [Google Scholar] [CrossRef]
- Bridier, A.; Briandet, R.; Thomas, V.; Dubois-Brissonnet, F. Resistance of bacterial biofilms to disinfectants: A review. Biofouling 2011, 27, 1017–1032. [Google Scholar] [CrossRef]
- Zhang, Y.; Gu, A.Z.; He, M.; Li, D.; Chen, J. Subinhibitory concentrations of disinfectants promote the horizontal transfer of multidrug resistance genes within and across genera. Environ. Sci. Technol. 2017, 51, 570–580. [Google Scholar] [CrossRef]
- Ghaly, T.M.; Chow, L.; Asher, A.J.; Waldron, L.S.; Gillings, M.R. Evolution of class 1 integrons: Mobilization and dispersal via food-borne bacteria. PLoS ONE 2017, 12, e0179169. [Google Scholar] [CrossRef]
- Samir, P.; El-Baz, A.M.; Kenawy, H.I. The linkage between prevalence of integron I and reduced susceptibility to biocides in MDR Klebsiella pneumoniae isolated from neonates. Iran. J. Microbiol. 2023, 15, 27–37. [Google Scholar] [CrossRef]
- Islam, T.; Saha, O.; Sultana, S.; Hridoy, M.; Hasan, M.; Marzan, S.; Rahman, M.M. Comparison Between Reduced Susceptibility to Disinfectants and Multidrug Resistance Among Hospital Isolates of Pseudomonas aeruginosa and Staphylococcus aureus in Bangladesh. Bagcilar Med. Bull. 2017, 2, 88–97. [Google Scholar] [CrossRef]
- ATCC. The Global Bioresource Center. Available online: https://www.lgcstandards-atcc.org (accessed on 5 May 2023).
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
- Merritt, J.H.; Kadouri, D.E.; O’Toole, G.A. Growing and analyzing static biofilm. Curr. Protoc. Microbiol. 2005, 1, Unit-1B.1. [Google Scholar]
- Holá, V.; Ruzicka, F.; Horka, M. Microbial diversity in biofilm infections of the urinary tract with the use of sonication techniques. FEMS Immunol. Med. Microbiol. 2010, 59, 525–528. [Google Scholar] [CrossRef] [PubMed]
- GOST R 58151.4-2018; Disinfectants. Methods for Determining Efficiency Factor. Federal Agency for Technical Regulation and Metrology: Moscow, Russia, 2018.
- Shkarin, V.V.; Kovalishena, O.V.; Blagonravova, A.S.; Vorob’yeva, O.N.; Alekseyeva, I.G. Method for Determining the Sensitivity of Microorganisms to Disinfectants: Methodological Recommendations [Sposob Opredeleniya Chuvstvitel’nosti Mikroorganizmov k Dezinfitsiruyushchim Sredstvam: Metodicheskiye Rekomendatsii]; NGMA: Nizhny Novgorod, Russia, 2010; p. 24. (In Russian) [Google Scholar]
- Chen, Y.; Liao, K.; Huang, Y.; Guo, P.; Huang, H.; Wu, Z.; Liu, M. Determining the susceptibility of carbapenem resistant Klebsiella pneumoniae and Escherichia coli strains against common disinfectants at a tertiary hospital in China. BMC Infect. Dis. 2020, 20, 88. [Google Scholar] [CrossRef] [PubMed]
- AL-Yozbakee, Z.; Mohammad, K. CRISPR-Cas system in multi drugs resistant Klebsiella pneumoniae from different clinical samples and its correlation with antibiotic-resistant genes in Mosul city. Iraqi J. Appl. Nat. Sci. 2024, 16, 820–829. [Google Scholar] [CrossRef]
- Al-Grawi, I.G.A.; Al-Absali, A.K.; Kareem, N.H.; Belal, S.A. Occurrence of MexAB-OprM efflux pump operon on septicemic Pseudomonas aeruginosa chromosome. Iraqi Postgrad. Med. J. 2012, 2, 97–102. [Google Scholar]
- Noguchi, N.; Nakaminami, H.; Nishijima, S.; Kurokawa, I.; So, H.; Sasatsu, M. Antimicrobial agent of susceptibilities and antiseptic resistance gene distribution among methicillin-resistant Staphylococcus aureus isolates from patients with impetigo and staphylococcal scalded skin syndrome. J. Clin. Microbiol. 2006, 44, 2119–2125. [Google Scholar] [CrossRef]
- Patel, D.; Kosmidis, C.; Seo, S.; Kaatz, G. Ethidium Bromide MIC Screening for Enhanced Efflux Pump Gene Expression or Efflux Activity in Staphylococcus aureus. Antimicrob. Agents Chemother. 2010, 54, 5070–5073. [Google Scholar] [CrossRef]
- Huang, J.; O’Toole, P.W.; Shen, W.; Amrine-Madsen, H.; Jiang, X.; Lobo, N.; Palmer, L.M.; Voelker, L.; Fan, F.; Gwynn, M.N.; et al. Novel chromosomally encoded multidrug efflux transporter MdeA in Staphylococcus aureus. Antimicrob. Agents Chemother. 2004, 48, 909–917. [Google Scholar] [CrossRef]
- Suma, T.A.; Alam, N.; Raihan, S.Z.; Zahid, M.A.; Mandal, S.C.; Suchana, F.J.; Kundu, R.; Hossain, A.; Muhit, M.A. Association of Antibacterial Susceptibility Profile with the Prevalence of Genes Encoding Efflux Proteins in the Bangladeshi Clinical Isolates of Staphylococcus aureus. Antibiotics 2023, 12, 305. [Google Scholar] [CrossRef]
Parameter | Microorganism | |||
---|---|---|---|---|
E. coli (n = 26) | K. pneumoniae (n = 57) | P. aeruginosa (n = 23) | S. aureus (n = 29) | |
Median MIC and MBC in plankton culture, final concentration of CHX or S7 (CHX/BAC) in % | ||||
MICCHX | 0.00038 | 0.00078 | 0.00078 | 0.000006 |
MBCCHX | 0.00078 | 0.00078 | 0.00156 | 0.000025 |
MICS7 | 0.00000013/ 0.00000011 | 0.0000084/ 0.0000066 | 0.000017/ 0.000013 | 0.00000013/ 0.0000001 |
MBCS7 | 0.00000027/ 0.00000021 | 0.0000084/ 0.0000066 | 0.000017/ 0.000013 | 0.00000026/ 0.00000021 |
Bacterial survival in % (median CFU/mL) in one-day old biofilm after application of the biocidal solution | ||||
After CHX | 80.8 (7.98 × 103) | 5.3 (3.3 × 102) | 32.1 (1.0 × 101) | 34.5 (0.7 × 101) |
After S7 | 0 | 0 | 0 | 0 |
Biofilm biomass, median OD570 | 0.123 | 0.391 | 0.703 | 0.158 |
Exposure Time, min | Solution | E. coli Strain EC8 | K. pneumoniae Strain KP20 | P. aeruginosa Strain PA5 | S. aureus Strain SA12 | ||||
---|---|---|---|---|---|---|---|---|---|
CFU/100 cm2 | Effect | CFU/100 cm2 | Effect | CFU/100 cm2 | Effect | CFU/100 cm2 | Effect | ||
Ceramic tiles | |||||||||
10 | NaCl | >300 | NBE | >300 | NBE | >300 | NBE | >300 | NBE |
CHX | 0 | Bactericidal | 0 | Bactericidal | 50–99 | IBA | <5 | IBA | |
S7 | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
30 | NaCl | >300 | NBE | >300 | NBE | >300 | NBE | >300 | NBE |
CHX | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
S7 | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
60 | NaCl | >300 | NBE | >300 | NBE | >300 | NBE | >300 | NBE |
CHX | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
S7 | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
Plastic | |||||||||
10 | NaCl | >300 | NBE | >300 | NBE | >300 | NBE | >300 | NBE |
CHX | 0 | Bactericidal | 0 | Bactericidal | 5-99 | IBA | 0 | Bactericidal | |
S7 | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
30 | NaCl | >300 | NBE | >300 | NBE | >300 | NBE | >300 | NBE |
CHX | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
S7 | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
60 | NaCl | >300 | NBE | >300 | NBE | >300 | NBE | >300 | NBE |
CHX | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
S7 | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal |
Exposure Time, h | Solution | E. coli Strain EC8 | K. pneumoniae Strain KP20 | P. aeruginosa Strain PA5 | S. aureus Strain SA12 | ||||
---|---|---|---|---|---|---|---|---|---|
CFU/ 100 cm2 | Effect | CFU/ 100 cm2 | Effect | CFU/ 100 cm2 | Effect | CFU/ 100 cm2 | Effect | ||
Ceramic tiles | |||||||||
1 | NaCl | >100 | NBE | >300 | NBE | 10–50 | NBE | >100 | NBE |
CHX | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
S7 | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
2 | NaCl | >100 | NBE | >300 | NBE | 10–50 | NBE | >100 | NBE |
CHX | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
S7 | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
Plastic | |||||||||
1 | NaCl | 10–50 | NBE | >300 | NBE | 10–50 | NBE | >100 | NBE |
CHX | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
S7 | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
2 | NaCl | 10–50 | NBE | >300 | NBE | 10–50 | NBE | >100 | NBE |
CHX | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | |
S7 | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal | 0 | Bactericidal |
Gene | Nucleotide Sequence (5′–3′) | PCR Program | Amplicon Size (bp) | Reference |
---|---|---|---|---|
qacEΔ1 | TAGCGAGGGCTTTACTAAGC ATTCAGAATGCCGAACACCG | 93 °C, 2 m; 35 [93 °C, 30 s; 55 °C, 30 s; 72 °C,1 m]; 72 °C, 10 m | 300 | [89] |
qacE | CCCGAATTCATGAAAGGCTGGCTT AAGCTTTCACCATGGCGTCGG | |||
cepA | CAACTCCTTCGCCTATCCCG TCAGGTCAGACCAAACGGCG | 94 °C, 5 m; 30 [94 °C, 30 s; 53 °C, 1 m; 72 °C, 2 m]; 72 °C, 7 m | 1051 | |
oqxA | CTCGGCGCGATGATGCT CCACTCTTCACGGGAGACGA | 95 °C, 1 m; 35 [95 °C, 45 s; 60 °C, 45 s; 72 °C, 1 m]; 72 °C, 5 m | 392 | [48] |
oqxB | TTCTCCCCCGGCGGGAAGTAC CTCGGCCATTTTGGCGCGTA | 512 | ||
acrAB | ATCAGCGGCCGGATTGGTAAA CGGGTTCGGGAAAATAGCGCG | 94 °C, 5 m; 30 [94 °C, 1 m; 56 °C, 30 s; 72 °C, 1 m]; 72 °C, 10 m | 312 | [90] |
mexA/B | TGTCGAAGTTTTTCATTGATAG AAGGTCACGGTGATGGT | 94 °C, 3 m; 32 [94 °C, 30 s; 57 °C, 45 s; 72 °C, 1 m]; 72 °C, 5 m | 280 | [91] |
smr (qacC/D) | GCCATAAGTACTGAAGTTATTGGA GACTACGGTTGTTAAGACTAAACCT | 95 °C, 5 m; 35 [94 °C, 40 s; 54 °C, 50 s; 72 °C, 50 s]; 72 °C, 5 m | 195 | [92] |
qacA/B | CTATGGCAATAGGAGATATGGTGT CCACTACAGATTCTTCAGCTACATG | 94 °C, 5 m; 30 [94 °C, 30 s; 53 °C, 30 s; 72 °C, 1 m]; 72 °C, 5 m | 416 | [89] |
norA | ATGAATAAACAGATTTTTGT CTACATATTTTGTTCTTTCA | 94 °C, 3 m; 35 [94 °C, 1 m; 50 °C, 45 s; 72 °C, 1,5 m]; 72 °C, 3,5 m | 1167 | [71] |
norB | TCGCCTTCAACACCATCAAC GGCGTAGGAGATGATGGTCA | 94 °C, 3 m; 35 [94 °C, 1 m; 52 °C, 1 m; 72 °C, 1 m]; 72 °C, 3,5 m | 236 | [72] |
norC | GCGGGAGTGTGTTCTTCATC CTGGAGGAAGGTGTTGAAGC | 94 °C, 3 m; 35 [94 °C, 1 m; 62 °C, 45 s; 72 °C, 1,5 m]; 72 °C, 3,5 m | 441 | |
mepA | GCAGTTATCATGTCTATCGGCG TGCACCTTGTAAAATGGCCA | 240 | [93] | |
mdeA | TATGGCGATTGTTGTTTTTACTAC AACCGTGTGCATTCATTTCTGG | 94 °C, 3 m; 35 [94 °C, 1 m; 62 °C, 45 s; 72 °C, 1 m]; 72 °C, 3,5 m | 1072 | [94] |
sepA | GCAGTCGAGCATTTAATGGA ACGTTGTTGCAACTGTGTAAGA | 94 °C, 4 m; 35 [94 °C, 30 s; 57 °C, 55 s; 72 °C, 1 m]; 72 °C, 5 m | 103 | [95] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kuznetsova, M.V.; Nesterova, L.Y.; Mihailovskaya, V.S.; Selivanova, P.A.; Kochergina, D.A.; Karipova, M.O.; Valtsifer, I.V.; Averkina, A.S.; Starčič Erjavec, M. Nosocomial Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus: Sensitivity to Chlorhexidine-Based Biocides and Prevalence of Efflux Pump Genes. Int. J. Mol. Sci. 2025, 26, 355. https://doi.org/10.3390/ijms26010355
Kuznetsova MV, Nesterova LY, Mihailovskaya VS, Selivanova PA, Kochergina DA, Karipova MO, Valtsifer IV, Averkina AS, Starčič Erjavec M. Nosocomial Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus: Sensitivity to Chlorhexidine-Based Biocides and Prevalence of Efflux Pump Genes. International Journal of Molecular Sciences. 2025; 26(1):355. https://doi.org/10.3390/ijms26010355
Chicago/Turabian StyleKuznetsova, Marina V., Larisa Y. Nesterova, Veronika S. Mihailovskaya, Polina A. Selivanova, Darja A. Kochergina, Marina O. Karipova, Igor V. Valtsifer, Anastasia S. Averkina, and Marjanca Starčič Erjavec. 2025. "Nosocomial Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus: Sensitivity to Chlorhexidine-Based Biocides and Prevalence of Efflux Pump Genes" International Journal of Molecular Sciences 26, no. 1: 355. https://doi.org/10.3390/ijms26010355
APA StyleKuznetsova, M. V., Nesterova, L. Y., Mihailovskaya, V. S., Selivanova, P. A., Kochergina, D. A., Karipova, M. O., Valtsifer, I. V., Averkina, A. S., & Starčič Erjavec, M. (2025). Nosocomial Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus: Sensitivity to Chlorhexidine-Based Biocides and Prevalence of Efflux Pump Genes. International Journal of Molecular Sciences, 26(1), 355. https://doi.org/10.3390/ijms26010355