Assessment of Sessile Benthic Communities in Jeju Island, Republic of Korea, Using Autonomous Reef Monitoring Structures (ARMS)

Round 1

Reviewer 1 Report

Comments and Suggestions for Authors

The work by Lee et al. entitled “Assessment of sessile benthic communities in Jeju Island, Korea, using Autonomous Reef Monitoring Structures (ARMS)” brings new insights in the biomonitoring of sessile benthic organisms. Specifically, the authors combined visual (ARMS) and molecular approaches to characterize the biodiversity at two different sites. Overall, the manuscript is well-written, and the text has flow. The reviewer has made some suggestions and changes along the manuscript that the authors should address prior to resubmission. In addition, the reviewer has the following major comments:

 

1-    The authors should provide more information regarding their testable hypotheses. Why these factors including plate, layer, site, orientation, length of experiment, etc. are explored? What is the rationale to consider these factors in such a study? These ideas should be clear for the reader in the introduction and methods sections, so the results don’t come as a surprise.

 

2-    The authors have little information regarding the molecular/bioinformatic procedures. At this point, it is not clear what method they used (OTUs vs. ASVs), how was taxonomy assigned, what database(s) was used, etc. How many samples were used to represent each site? Why DNA sequences do not represent the same “interesting factors. Moreover, the authors are talking about eukaryotes, but they insist in mention the 16S rRNA gene (i.e., the small subunit of archaea/bacteria)

 

3-    The statistical analysis section (only for ARMS) should be expanded with greater detail on what comparisons/tests were made. The authors talk about Bray-Curtis, but they use a PCA for the ordination (which is usually based on Euclidean distance).

 

Finally the reviewer’s recommendation is to accept the manuscript after “major revisions”

Comments for author File: Comments.pdf

Comments on the Quality of English Language

Author Response

Responses to Reviewer Comments

 

We are thankful for the reviewers’ constructive comments, which have helped us to considerably improve the overall presentation of our manuscript. We have responded to each of the reviewer’s comments in a point-by-point manner. In addition, we have provided a revised version of the manuscript with revisions indicated in red font. We hope that the changes incorporated into the revised manuscript satisfactorily address the reviewers’ concerns and that our manuscript is now considered suitable for publication in your journal.

 

Responses to Reviewer 1

 

The work by Lee et al. entitled “Assessment of sessile benthic communities in Jeju Island, Korea, using Autonomous Reef Monitoring Structures (ARMS)” brings new insights in the biomonitoring of sessile benthic organisms. Specifically, the authors combined visual (ARMS) and molecular approaches to characterize the biodiversity at two different sites. Overall, the manuscript is well-written, and the text has flow. The reviewer has made some suggestions and changes along the manuscript that the authors should address prior to resubmission. In addition, the reviewer has the following major comments:

 

Q1: The authors should provide more information regarding their testable hypotheses. Why these factors including plate, layer, site, orientation, length of experiment, etc. are explored? What is the rationale to consider these factors in such a study? These ideas should be clear for the reader in the introduction and methods sections, so the results don’t come as a surprise.

 

A1: We thank you for your valuable feedback and totally agree with your comments. Benthic settlement and benthic community structures are greatly affected by various environmental conditions. Therefore, a standardized monitoring method is needed to evaluate benthic communities. To our knowledge, this is the first ARMS study conducted in the southern part of Jeju, where rapid changes in benthic ecosystems are occurring owing to climate change. The results of this study reveal differences in species diversity according to the installation period and habitat through analysis of benthic community structure and DNA metabarcoding via image analysis of each plate of ARMS. Although previous studies using other artificial structures have reported similar results (especially in terms of plate surfaces), the results on installation period and habitat in this study are different from those obtained in previous ARMS studies.

 

Q2: The authors have little information regarding the molecular/bioinformatic procedures. At this point, it is not clear what method they used (OTUs vs. ASVs), how was taxonomy assigned, what database(s) was used, etc. How many samples were used to represent each site? Why DNA sequences do not represent the same “interesting factors. Moreover, the authors are talking about eukaryotes, but they insist in mention the 16S rRNA gene (i.e., the small subunit of archaea/bacteria)

 

A2: As mentioned, 16S rRNA is a marker commonly used in bacterial community studies. However, recently, 16S rRNA was also utilized in the phylogenetic classification of red algae and especially in the study of crustose coralline algae metabarcoding (Fredericq et al. 2019). This study used 16S rRNA to evaluate cohesive benthic communities.

 

Fredericq, S.; Krayesky-Self, S.; Sauvage, T.; Richards, J.; Kittle, R.; Arakaki, N.; Hickerson, E.; Schmidt, W.E. The Critical Importance of Rhodoliths in the Life Cycle Completion of Both Macro- and Microalgae, and as Holobionts for the Establishment and Maintenance of Marine Biodiversity. Front. Mar. Sci. 2019, 5.

 

Q3: The statistical analysis section (only for ARMS) should be expanded with greater detail on what comparisons/tests were made. The authors talk about Bray-Curtis, but they use a PCA for the ordination (which is usually based on Euclidean distance).

A3: Based on these comments, MDS analysis was performed again based on the Bray-Curtis index. Statistical analysis through metabarcoding could not be performed owing to the lack of samples. Instead, we compared the number of adherent benthic species according to the installation period and habitat.

 

Author Response File: Author Response.docx

Reviewer 2 Report

Comments and Suggestions for Authors

I was very pleased to receive your invitation to referee this research under the title (Assessment of sessile benthic communities in Jeju Island, Korea, using Autonomous Reef Monitoring Structures (ARMS)). With the utmost honesty, I found in this work a great effort in carrying out this research, as it is written in understandable language, has simple methods, and uses excellent statistical processes. My only question is why the researchers mixed the contents of the plates, as I would have preferred that they examine each panel separately and measure the speed of the current at each panel and the deposition rate.

Author Response

Responses to Reviewer Comments

 

We are thankful for the reviewers’ constructive comments, which have helped us to considerably improve the overall presentation of our manuscript. We have responded to each of the reviewer’s comments in a point-by-point manner. In addition, we have provided a revised version of the manuscript with revisions indicated in red font. We hope that the changes incorporated into the revised manuscript satisfactorily address the reviewers’ concerns and that our manuscript is now considered suitable for publication in your journal.

 

Responses to Reviewer 2

 

I was very pleased to receive your invitation to referee this research under the title (Assessment of sessile benthic communities in Jeju Island, Korea, using Autonomous Reef Monitoring Structures (ARMS)). With the utmost honesty, I found in this work a great effort in carrying out this research, as it is written in understandable language, has simple methods, and uses excellent statistical processes. My only question is why the researchers mixed the contents of the plates, as I would have preferred that they examine each panel separately and measure the speed of the current at each panel and the deposition rate.

 

A: We thank you for your valuable feedback and totally agree with your comments; the results for biodiversity can be clearly different if each plate is separately analyzed in ARMS. Unfortunately, in this study, we did not analyze each DNA metabarcoding plate. Instead, we have described benthic diversity according to the installation period and habitat in the Discussion.

Author Response File: Author Response.docx

Reviewer 3 Report

Comments and Suggestions for Authors

The present study is one of many describing marine communities on Autonomous Reef Monitoring Structures (ARMS). These ARMS have been employed all over the world. Although the introduction tells how important it is to monitor changes in marine biota, the focus of the present results is at phylum level. It is unclear what is new in the present results. Where any changes detected? How do the present results compare with those of ARMS studies elsewhere?  

 Lines 33-34. Keywords should not overlap with title words.

Introduction. Some sentences are not well written and their logic is unlcear. They are long and contain topics that are not related to each other. See for example the first sentence (lines 37-39). It is unclear what “and for preventing sudden shifts to less desirable states in ecosystems [1, 2],” refers to. Please rephrase.

Line 39. Ecosystems with intact biodiversity are also vulnerable.

Line 67. Delete “(Pearman et al. 2016)”

Line 74. are tentatively presented -> are presented tentatively

Line 369. Why were corals not identified in the image analysis? There are not many species.

Line 420. Delete “Please add:”

Comments on the Quality of English Language

Introduction. Some sentences are not well written and their logic is unlcear. They are long and contain topics that are not related to each other.

Author Response

Responses to Reviewer Comments

 

We are thankful for the reviewers’ constructive comments, which have helped us to considerably improve the overall presentation of our manuscript. We have responded to each of the reviewer’s comments in a point-by-point manner. In addition, we have provided a revised version of the manuscript with revisions indicated in red font. We hope that the changes incorporated into the revised manuscript satisfactorily address the reviewers’ concerns and that our manuscript is now considered suitable for publication in your journal.

 

Responses to Reviewer 3

 

The present study is one of many describing marine communities on Autonomous Reef Monitoring Structures (ARMS). These ARMS have been employed all over the world. Although the introduction tells how important it is to monitor changes in marine biota, the focus of the present results is at phylum level. It is unclear what is new in the present results. Where any changes detected? How do the present results compare with those of ARMS studies elsewhere?

 

A: We thank you for your valuable feedback. To the best of our knowledge, this is the first ARMS study conducted in the southern part of Jeju, where rapid changes in benthic ecosystems are occurring owing to climate change. Our results reveal differences in species diversity according to the installation period and habitat through analyzing benthic community structure and DNA metabarcoding according to the plate surface, installation period, and habitat of ARMS using image analysis. Although previous studies using other artificial structures have reported similar results (especially in terms of plate surfaces), the results on installation period and habitat in this study are different from those obtained in previous ARMS studies.

 

Lines 33-34. Keywords should not overlap with title words.

A: The indicated section has been revised.

 

Introduction. Some sentences are not well written and their logic is unlcear. They are long and contain topics that are not related to each other. See for example the first sentence (lines 37-39). It is unclear what “and for preventing sudden shifts to less desirable states in ecosystems [1, 2],” refers to. Please rephrase.

A: The indicated sentence has been deleted, and the text has been rechecked for language, logic, and readability.

Line 67. Delete “(Pearman et al. 2016)”

A: The sentence has been revised as suggested.

 

Line 74. are tentatively presented -> are presented tentatively

A: The sentence has been revised as suggested.

 

Line 369. Why were corals not identified in the image analysis? There are not many species.

A: Corals were not identified in the images taken for ARMS image analysis. It was determined that the ARMS plate was unsuitable for the attachment and growth of corals. Related content is mentioned in the Discussion.

 

Line 420. Delete “Please add:”

A: The sentence has been revised as suggested.

Author Response File: Author Response.docx

Round 2

Reviewer 1 Report

Comments and Suggestions for Authors

Unfortunately the authors failed to address important comments regarding the molecular work done in this study. In fact, nothing was really done to clarify the methods/analysis performed with the molecular dataset, except the citation of Fredericq et al. 2019.

The comments below were provided in the previous revision:

The authors need to provide additional information about the molecular methods, from DNA extraction, PCR, and sequencing.

1- What kit was used for DNA

2- What kit was used for PCR

3- What primer set was used for PCR

4- Did the authors include blank samples during DNA extrations?

5- Did the authors include negative/positive controls during PCR?

6- What Illumina platform was used to sequence the samples? Was it single or paird-end sequencing?

7- What was fragment size?

8- Did the authors also sequence the blank samples and negative/positive, so that potential contamination could be account for it?

9- How was taxonomy performed? what method was used? what database?

Furthermore, one of the major comments was: what method did the authors use to analyze their sequences: OTUs vs. ASVs.

There is also a BIG confusion about 16S rRNA (bacteria/archaea) and 18S rRNA (eukaryotes) genes. The authors claimed they used 16S rRNA metabarcoding (not sure what primers though), but they cited a study (Fredericq et al 2019) that talks bacteria and red algal but not animal phyla such as those reported here (e.g., Annelida, Porifera, Cnidaria, etc.). The primers used here may also amplified the 18S rRNA and that is why the authors have a lot of reads/DNA sequences matching eukaryotes. Conversely, they may have used the 18S rRNA gene which would make more sense based on their results (nothing matching bacteria/archaea).

None of these issues were addressed by the authors. If the authors are not able to address these, then they should remove the molecular dataset from the manuscript.

 

Comments on the Quality of English Language

Minor editing.

Author Response

Responses to Reviewer Comments

 

We are again thankful for the reviewers’ constructive comments, which have helped us to considerably improve the overall presentation of our manuscript. First of all, I apologize for the serious error I made while writing this manuscript. The Metabarcoding analysis mentioned by the reviewer was an analysis utilizing the CO1 gene rather than the 16S rRNA gene. Thus, part 2.4 DNA extraction and metabarcoding of the Materials and Methods section was rewritten using the CO1 gene analysis method. We attached the metabarcoding analysis result excel file used in this manuscript, so please refer to it. And, we have responded to each of the reviewer’s comments in a point-by-point manner. In addition, we have provided a revised version of the manuscript with revisions indicated in red font. We hope that the changes incorporated into the revised manuscript satisfactorily address the reviewers’ concerns and that our manuscript is now considered suitable for publication in your journal.

 

Unfortunately, the authors failed to address important comments regarding the molecular work done in this study. In fact, nothing was really done to clarify the methods/analysis performed with the molecular dataset, except the citation of Fredericq et al. 2019.

Metabarcoding analysis of the sessile fraction samples was performed using the CO1 gene. The sessile fraction samples were sent to Macrogene, Inc. (Seoul, Republic of Korea), and DNA extraction was performed using the DNeasy PowerMax Soil Kit (Qiagen, Denmark). The sequencing libraries are prepared according to the Illumina Metagenomic Sequencing Library protocols to amplify the LCO-1490 and HCO-2198. The input gDNA 5ng was PCR amplified with 5x reaction buffer, 1mM of dNTP mix, 500nM each of the universal F/R PCR primer, and Herculase II fusion DNA polymerase (Agilent Technologies, Santa Clara, CA). The cycle condition for 1st PCR was 3 min at 95°C for heat activation, and 25 cycles of 30 sec at 95°C, 30 sec at 44.7°C and 30 sec at 72°C, followed by a 5-min final extension at 72°C. The universal primer pair with Illumina adapter overhang sequences used for the first amplifications were as follows.

LCO-1490 Amplicon PCR Forward Primer: 5'GGTCAACAAATCATAAAGATATTGG3’

HCO-2198 Amplicon PCR Reverse Primer: 5'TAAACTTCAGGGTGACCAAAAAATCA3’

The 1st PCR product was purified with AMPure beads (Agencourt Bioscience, Beverly, MA). Following purification, the 10ul of 1st PCR product was PCR amplified for final library construction containing the index using NexteraXT Indexed Primer. The cycle condition for 2nd PCR was same as the 1st PCR condition except for 10 cycles. The PCR product was purified with AMPure beads. The final purified product is then quantified using qPCR according to the qPCR Quantification Protocol Guide (KAPA Library Quantification kits for Illumina Sequencing platforms) and qualified using the TapeStation D1000 ScreenTape (Agilent Technologies, Waldbronn, Germany). And then we sequenced using the MiSeq™ platform (Illumina, San Diego, USA). Subsequently, the demultiplexed FASTQ files were processed with the DADA2 pipe-line to extract Amplicon Sequence Variants (ASVs) for further taxonomic investigation. These ASVs were then subjected to BLASTn searches against NCBI GenBank database to identify their closest matches, retrieve relevant contextual sequences for tree construction, and ascertain the best possible identification for the sequences obtained. Based on the results obtained from Metabarcoding analysis, we searched and estimated the numbers of sessile benthic species. Sessile benthic species were assigned to their respective taxonomic categories, including Porifera, Cnidaria, Mollusca, Annelida, Arthropoda, Bryozoa, Chor-data, Chlorophyta, Phaeophyta, Rhodophyta, and CCA.

 

 

 

The comments below were provided in the previous revision:

The authors need to provide additional information about the molecular methods, from DNA extraction, PCR, and sequencing.

1- What kit was used for DNA

DNA extraction was performed using the DNeasy PowerMax soil kit (Qiagen, Denmark) according to the manufacturer’s instructions.

2- What kit was used for PCR

Herculase II Fusion DNA polymerase (Agilent Technologies, Santa Clara, CA, Cat no. 600679) used for PCR.

3- What primer set was used for PCR

The universal primer pair with Illumina adapter overhang sequences used for the first amplifications were as follows:

LCO-1490 Amplicon PCR Forward Primer: 5'GGTCAACAAATCATAAAGATATTGG3’

HCO-2198 Amplicon PCR Reverse Primer: 5'TAAACTTCAGGGTGACCAAAAAATCA3’

4- Did the authors include blank samples during DNA extractions?

This analysis did not include a blank sample.

5- Did the authors include negative/positive controls during PCR?

Because the primer used in this analysis is a custom primer, it does not contain the target DNA for the primer, so it does not contain positive control but only negative control.

6- What Illumina platform was used to sequence the samples? Was it single or paird-end sequencing?

MiSeq system and 300PE paired-end sequencing used for in this study.

7- What was fragment size?

Approximately 900bp with adapter.

8- Did the authors also sequence the blank samples and negative/positive, so that potential contamination could be account for it?

There was no contamination element in negative control.

9- How was taxonomy performed? what method was used? what database?

Furthermore, one of the major comments was: what method did the authors use to analyze their sequences: OTUs vs. ASVs.

Illumina MiSeq Raw data was classified by sample using index sequence after completion of sequencing, and paired-end FASTQ file was generated for each sample. The target COI (Primer: LCO1490-HCO2198) size is about 600bp, which is beyond the scope of overlapping MiSeq Forward and Reverse read, and the analysis was conducted using only Forward reads. The sequencing adapter region and the primer sequence of the target gene region were removed using the Cutadapt (v3.2) program. In order to error- correction in the amplicon sequencing process, the DADA2 (v1.18.0) package of the R(v4.0.3) program was used. Forward reads were analyzed except for sequences with more than 2 expected errors among forward sequences (Read 1). Then, an error model for each batch was established to remove noise for each sample. The sequencing error-corrected sequences formed ASVs after removing the Chimera sequence using the consensus method of DADA2. These ASVs were then subjected to BLASTn searches against NCBI GenBank database to identify their closest matches, retrieve relevant contextual sequences for tree construction, and ascertain the best possible identification for the sequences obtained. At this time, if the query coverage of the best hit matched to the DB is less than 85% or the identity of the matched area is less than 85%, it is excluded from the taxonomy information. Based on the results obtained from Metabarcoding analysis, we searched and estimated the numbers of all sessile benthic species.

 

There is also a BIG confusion about 16S rRNA (bacteria/archaea) and 18S rRNA (eukaryotes) genes. The authors claimed they used 16S rRNA metabarcoding (not sure what primers though), but they cited a study (Fredericq et al 2019) that talks bacteria and red algal but not animal phyla such as those reported here (e.g., Annelida, Porifera, Cnidaria, etc.). The primers used here may also amplified the 18S rRNA and that is why the authors have a lot of reads/DNA sequences matching eukaryotes. Conversely, they may have used the 18S rRNA gene which would make more sense based on their results (nothing matching bacteria/archaea).

First of all, I apologize for the serious error I made while writing this manuscript. The Metabarcoding analysis mentioned by the reviewer was an analysis utilizing the CO1 gene rather than the 16S rRNA gene. Thus, part 2.4 DNA extraction and metabarcoding of the Materials and Methods section was rewritten using the CO1 gene analysis method.

Author Response File: Author Response.docx

Reviewer 3 Report

Comments and Suggestions for Authors

In their reply to the review comments, the authors state: "A: We thank you for your valuable feedback. To the best of our knowledge, this is the first ARMS study conducted in the southern part of Jeju, where rapid changes in benthic ecosystems are occurring owing to climate change. Our results reveal differences in species diversity according to the installation period and habitat through analyzing benthic community structure and DNA metabarcoding according to the plate surface, installation period, and habitat of ARMS using image analysis. Although previous studies using other artificial structures have reported similar results (especially in terms of plate surfaces), the results on installation period and habitat in this study are different from those obtained in previous ARMS studies."

It is unclear to me how this was addressed in the manuscript. The weakness of this ma is that it is very decriptive and that the only noverlty is that such a study has not been conducted before in Jeju Island  Why is this important? How is this relevant for future research? What do the results say about Jeju Island? What are the difference and smilarities with other localities where ARMS was deployed.

 

Comments on the Quality of English Language

None

Author Response

Responses to Reviewer Comments

 

We are again thankful for the reviewers’ constructive comments, which have helped us to considerably improve the overall presentation of our manuscript. We have responded to each of the reviewer’s comments in a point-by-point manner. In addition, we have provided a revised version of the manuscript with revisions indicated in red font. We hope that the changes incorporated into the revised manuscript satisfactorily address the reviewers’ concerns and that our manuscript is now considered suitable for publication in your journal.

 

 

Reviewer comment:

It is unclear to me how this was addressed in the manuscript. The weakness of this ma is that it is very decriptive and that the only noverlty is that such a study has not been conducted before in Jeju Island Why is this important? How is this relevant for future research? What do the results say about Jeju Island? What are the difference and smilarities with other localities where ARMS was deployed.

 

Author answers:

The manuscript has addressed rapid changes in Jeju Island's benthic communities [Line 46-50, Line 369-379] and addressed the potential of ARMS as a vital tool in understanding and monitoring these shifts [Line 58 - 66].

 

The aim of this study was to test the potential of image analysis and DNA metabarcoding of sessile benthic communities of the ARMS as a screening tool across diverse environmental conditions, including variations in plate faces, installation periods, habitat, and layers. This study underscores the significance of information concerning plate faces [Line 318-324], installation periods [Line 332-335], and habitats [Line 336-346] within ARMS research, highlighting its crucial role and its consideration in future investigations. Additionally, we suggest integrating ARMS image analysis with DNA metabarcoding to enhance and complement studies focusing on benthic diversity for future research [Line 347 - 368].

 

We have detailed the changes in Jeju Island's benthic community and diversity, elucidating these phenomena through our results [Line 369 - 379]. Moreover, we provide a detailed description of crustose coralline algae (CCA) associated with dominant corals in Jeju Island [Line 380 - 399].

 

Due to differences in study objectives and methodologies, direct comparison becomes challenging. However, our discussion section elucidates similarities and differences with prior studies conducted by ARMS image analysis [Line 306 - 324] and DNA analysis [Line 354 - 360].

Author Response File: Author Response.docx