Correction: Senn et al. The Community Structure of eDNA in the Los Angeles River Reveals an Altered Nitrogen Cycle at Impervious Sites. Diversity 2023, 15, 823

In the original publication [1], there was a mistake in Table 1 as published. There was a sorting error with the table before the references were added. The corrected

Table 1. Tabulation of the multiple types of genomic data that were available for evaluation of the L.A. River, including eukaryotes [20,21].

Marker	Description	Target Organisms	Forward Primer	Reverse Primer	Reference
16S	Prokaryotic rRNA small subunit	Bacteria, archaea	GTGYCAGCMGCCGCGGTAA	GGACTACNVGGGTWTCTAAT	F: 515F and R: 806R, see Caporaso et al., 2012 [22]
18S	Eukaryotic rRNA small subunit	Fungi, algae, protists	GTACACACCGCCCGTC	TGATCCTTCTGCAGGTTCACCTAC	Amaral-Zettler et al., 2009 [23]; Euk_1391f and EukBr
PITS	Plant rRNA internal transcribed spacer	Plants	ATGCGATACTTGGTGTGAAT	GACGCTTCTCCAGACTACAAT	Gu et al., 2013 [24]
CO1	Mitochondrial cytochrome oxidase subunit I	Animals	GGWACWGGWTGAACWGTWTAYCCYCC	TANACYTCnGGRTGNCCRAARAAYCA	Leray et al., 2013 [25]
FITS	Fungal rRNA internal transcribed spacer	Fungi	GGAAGTAAAAGTCGTAACAAGG	CAAGAGATCCGTTGTTGAAAGTT	F: ITS5, White et al., 1990 [26]; R: 5.8S, Epp et al., 2012 [27]
12S	Mitochondrial rRNA small subunit	Fish, birds, snakes, insects	TAGAACAGGCTCCTCTAG	TTAGATACCCCACTATGC	Epp et al., 2012 [27]

appears below. The authors state that the scientific conclusions are unaffected. This correction was approved by the Academic Editor. The original publication has also been updated.