Frequency of Gene Polymorphisms in Admixed Venezuelan Women with Recurrent Pregnancy Loss: Microsomal Epoxy Hydroxylase (rs1051740) and Enos (rs1799983)
Abstract
:1. Introduction
2. Materials and Methods
- mEPH forward 5′ GATCGATAAGTTCCGTTTCACC 3′
- reverse 5′ ATCCTTAGTCTTGAAGTGAGGAT 3′
- eNOS, forward 5′ AAGGCAGGAGACAGTGGATG 3′
- reverse 5′ CAGTCAATCCCTTTGGTGCT 3′.
Statistical Analysis of Results
3. Results
Controls (n = 40) | Patients (n = 63) | p | |
---|---|---|---|
Glu298Glu | 34 (68%) | 34 (54%) | 0.53 |
Glu298Asp | 16 (32%) | 23 (36.5%) | 0.85 |
Asp298Asp | 0 (0%) | 6 (9.5%) | 0.04 |
Controls (n = 50) | Patients (n = 63) | p | |
---|---|---|---|
Tyr113Tyr | 37 (74%) | 30 (47.6%) | 0.17 |
Tyr113His | 12 (24%) | 23 (36.5%) | 0.33 |
His113His | 1 (2%) | 10 (15.9%) | 0.03 |
4. Discussion
5. Conclusions
6. Limitations of the Study
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Valko, M.; Leibfritz, D.; Moncol, J.; Cronin, M.T.; Mazur, M.; Telser, J. Free radicals and antioxidants in normal physiological functions and human disease. Int. J. Biochem. Cell Biol. 2007, 39, 44–84. [Google Scholar] [CrossRef]
- Reddy, V.P. Oxidative Stress in Health and Disease. Biomedicines 2023, 11, 2925. [Google Scholar] [CrossRef] [PubMed]
- Averill-Bates, D. Reactive oxygen species and cell signalling. Review. Biochim. Biophys. Acta Mol. Cell Res. 2024, 1871, 119573. [Google Scholar] [CrossRef] [PubMed]
- Pokharel, M.D.; Garcia-Flores, A.; Marciano, D.; Franco, M.C.; Fineman, J.R.; Aggarwal, S.; Wang, T.; Black, S.M. Mitochondrial network dynamics in pulmonary disease: Bridging the gap between inflammation, oxidative stress, and bioenergetics. Redox Biol. 2024, 70, 103049. [Google Scholar] [CrossRef] [PubMed]
- An, G.; Park, J.; Song, J.; Hong, T.; Song, G.; Lim, W. Relevance of the endoplasmic reticulum-mitochondria axis in cancer diagnosis and therapy. Exp. Mol. Med. 2024, 56, 40–50. [Google Scholar] [CrossRef] [PubMed]
- Dyachenko, E.I.; Bel’skaya, L.V. The Role of Amino Acids in Non-Enzymatic Antioxidant Mechanisms in Cancer: A Review. Metabolites 2023, 14, 28. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, A.; Aponte-Mellado, A.; Premkumar, B.J.; Shaman, A.; Gupta, S. The effects of oxidative stress on female reproduction: A review. Reprod. Biol. Endocrinol. 2012, 10, 49. [Google Scholar] [CrossRef] [PubMed]
- Pereira, A.C.; Martel, F. Oxidative stress in pregnancy and fertility pathologies. Cell Biol. Toxicol. 2014, 30, 301–312. [Google Scholar] [CrossRef] [PubMed]
- Grzeszczak, K.; Łanocha-Arendarczyk, N.; Malinowski, W.; Ziętek, P.; Kosik-Bogacka, D. Oxidative Stress in Pregnancy. Biomolecules 2023, 13, 1768. [Google Scholar] [CrossRef] [PubMed]
- Haram, K.; Mortensen, J.H.; Myking, O.; Magann, E.F.; Morrison, J.C. The Role of Oxidative Stress. Adhesion Molecules and Antioxidants in Preeclampsia. Curr. Hypertens. Rev. 2019, 15, 105–112. [Google Scholar] [CrossRef] [PubMed]
- Hussain, T.; Murtaza, G.; Metwally, E.; Kalhoro, D.H.; Kalhoro, M.S.; Rahu, B.A.; Sahito, R.G.A.; Yin, Y.; Yang, H.; Chughtai, M.I.; et al. The Role of Oxidative Stress and Antioxidant Balance in Pregnancy. Mediat. Inflamm. 2021, 2021, 9962860. [Google Scholar] [CrossRef] [PubMed]
- Joó, J.G.; Sulyok, E.; Bódis, J.; Kornya, L. Disrupted Balance of the Oxidant-Antioxidant System in the Pathophysiology of Female Reproduction: Oxidative Stress and Adverse Pregnancy Outcomes. Curr. Issues Mol. Biol. 2023, 45, 8091–8111. [Google Scholar] [CrossRef] [PubMed]
- Tuuli, M.G.; Longtine, M.S.; Nelson, D.M. Review: Oxygen and trophoblast biology—A source of controversy. Placenta 2011, 32, S109–S118. [Google Scholar] [CrossRef] [PubMed]
- Myatt, L. Review: Reactive oxygen and nitrogen species and functional adaptation of the placenta. Placenta 2010, 31, S66–S69. [Google Scholar] [CrossRef] [PubMed]
- Choi, S.; Kim, J.A.; Li, H.Y.; Lee, S.J.; Seok, Y.S.; Kim, T.H.; Han, K.H.; Park, M.H.; Cho, G.J.; Suh, S.H. Altered redox state modulates endothelial KCa2.3 and KCa3.1 levels in normal pregnancy and preeclampsia. Antioxid. Redox Signal. 2019, 30, 505–519. [Google Scholar] [CrossRef] [PubMed]
- Poston, L.; Igosheva, N.; Mistry, H.D.; Seed, P.T.; Shennan, A.H.; Rana, S.; Karumanchi, S.A.; Chappell, L.C. Role of oxidative stress and antioxidant supplementation in pregnancy disorders. Am. J. Clin. Nutr. 2011, 94, S1980–S1985. [Google Scholar] [CrossRef] [PubMed]
- Diniz, M.S.; Magalhães, C.C.; Tocantins, C.; Grilo, L.F.; Teixeira, J.; Pereira, S.P. Nurturing through Nutrition: Exploring the Role of Antioxidants in Maternal Diet during Pregnancy to Mitigate Developmental Programming of Chronic Diseases. Nutrients 2023, 15, 4623. [Google Scholar] [CrossRef] [PubMed]
- Parveen, F.; Faridi, R.M.; Das, V.; Tripathi, G.; Agrawal, S. Genetic association of phase I and phase II detoxification genes with recurrent miscarriages among North Indian women. Mol. Hum. Reprod. 2010, 16, 207–214. [Google Scholar] [CrossRef] [PubMed]
- Shi, X.; Xie, X.; Jia, Y.; Li, S. Maternal genetic polymorphisms and unexplained recurrent miscarriage: A systematic review and meta-analysis. Clin. Genet. 2017, 91, 265–284. [Google Scholar] [CrossRef] [PubMed]
- Hosagrahara, V.P.; Rettie, A.E.; Hassett, C.; Omiecinski, C.J. Functional analysis of human microsomal epoxide hydrolase genetic variants. Chem. Biol. Interact. 2004, 150, 149–159. [Google Scholar] [CrossRef] [PubMed]
- Gautheron, J.; Jéru, I. The Multifaceted Role of Epoxide Hydrolases in Human Health and Disease. Int. J. Mol. Sci. 2020, 22, 13. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.; Zhu, Y.; Basang, W.; Wang, X.; Li, C.; Zhou, X. Roles of Nitric Oxide in the Regulation of Reproduction: A Review. Front. Endocrinol. 2021, 12, 752410. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Chen, S.; Dong, X.; Fu, S.; Zhang, T.; Zheng, W.; Tian, Y.; Huang, D. The Progress of Research on Genetic Factors of Recurrent Pregnancy Loss. Genet. Res. 2023, 2023, 9164374. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Zhang, Z.; Xu, J.; Wang, J.; Yuan, W.; Shen, Y.; Du, J. Genetic association studies of endothelial nitric oxide synthase gene polymorphisms in women with unexplained recurrent pregnancy loss: A systematic and meta-analysis. Mol. Biol. Rep. 2014, 41, 3981–3989. [Google Scholar] [CrossRef] [PubMed]
- Pereza, N.; Peterlin, B.; Volk, M.; Kapović, M.; Ostojić, S. A critical update on endothelial nitric oxide synthase gene variations in women with idiopathic recurrent spontaneous abortion: Genetic association study, systematic review and meta-analyses. Mol. Hum. Reprod. 2015, 21, 466–478. [Google Scholar] [CrossRef] [PubMed]
- Azani, A.; Hosseinzadeh, A.; Azadkhah, R.; Zonouzi, A.A.P.; Zonouzi, A.P.; Aftabi, Y.; Khani, H.; Heidary, L.; Danaii, S.; Bargahi, N.; et al. Association of endothelial nitric oxide synthase gene variants (-786 T>C. intron 4 b/a VNTR and 894 G>T) with idiopathic recurrent pregnancy loss: A case-control study with haplotype and in silico analysis. Eur. J. Obstet. Gynecol. Reprod. Biol. 2017, 215, 93–100. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Li, Q.; Yu, F.; Lin, L.; Yin, W.; Li, J.; Feng, X. Gene polymorphism associated with endothelial nitric oxide synthase (4VNTR, G894T, C786T) and unexplained recurrent spontaneous abortion risk: A meta-analysis. Medicine 2019, 98, e14175. [Google Scholar] [CrossRef] [PubMed]
- Golestanpour, H.; Bahrami, R.; Dastgheib, S.A.; Tabatabaei, R.S.; Javaheri, A.; Karimi-Zarchi, M.; Mirjalili, S.R.; Neamatzadeh, H. A meta-analysis for association of eNOS VNTR 4b/a, - 786 T > C and + 894G > T polymorphisms with risk of recurrent pregnancy loss. Arch. Gynecol. Obstet. 2021, 304, 1135–1151. [Google Scholar] [CrossRef] [PubMed]
- Conesa, A.; Fernández-Mestre, M.; Padrón, D.; Toro, F.; Silva, N.; Tassinari, P.; Blanca, I.; Martin, M.P.; Carrington, M.; Layrisse, Z. Distribution of killer cell immunoglobulin-like receptor genes in the mestizo population from Venezuela. Tissue Antigens 2010, 75, 724–729. [Google Scholar] [CrossRef]
- Del Pilar Fortes, M.; Gill, G.; Paredes, M.E.; Gamez, L.E.; Palacios, M.; Blanca, I.; Tassinari, P. Allele and haplotype frequencies at human leukocyte antigen class I and II genes in Venezuela’s population. Ann. Biol. Clin. 2012, 70, 175–181. [Google Scholar]
- Alemán, I.; Ramírez, A.M.; Hung, A.; Ramírez, C. Endothelial and inducible nitric oxide synthase expression in Venezuelan patients with pre-eclampsia. Investig. Clin. 2008, 49, 321–330. [Google Scholar]
- Hao, F.; Tang, L.C.; Sun, J.X.; Li, W.X.; Zhao, Y.; Xu, X.H.; Jin, L.P. Decreased nitric oxide content mediated by asymmetrical dimethylarginine and protein l-arginine methyltransferase 3 in macrophages induces trophoblast apoptosis: A potential cause of recurrent miscarriage. Hum. Reprod. 2021, 36, 3049–3061. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.Z.; Deng, Z.M.; Dai, F.F.; Liu, H.; Cheng, Y.X. The impact of early pregnancy metabolic disorders on pregnancy outcome and the specific mechanism. Eur. J. Med. Res. 2023, 28, 197. [Google Scholar] [CrossRef] [PubMed]
- Garmendia, J.V.; Gutiérrez, Y.; Blanca, I.; Bianco, N.E.; De Sanctis, J.B. Nitric oxide in different types of hypertension during pregnancy. Clin. Sci. 1997, 93, 413–421. [Google Scholar] [CrossRef] [PubMed]
- Cheng, S.L.; Yu, C.J.; Chen, C.J.; Yang, P.C. Genetic polymorphism of epoxide hydrolase and glutathione S-transferase in COPD. Eur. Respir. J. 2004, 23, 818–824. [Google Scholar] [CrossRef] [PubMed]
- Leeson, C.P.; Hingorani, A.D.; Mullen, M.J.; Jeerooburkhan, N.; Kattenhorn, M.; Cole, T.J.; Muller, D.P.; Lucas, A.; Humphries, S.E.; Deanfield, J.E. Glu298Asp endothelial nitric oxide synthase gene polymorphism interacts with environmental and dietary factors to influence endothelial function. Circ. Res. 2002, 90, 1153–1158. [Google Scholar] [CrossRef] [PubMed]
- Václaviková, R.; Hughes, D.J.; Souček, P. Microsomal epoxide Hydrolase 1 (EPHX1): Gene. structure. Function. and role in human disease. Gene 2015, 571, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Jiang, H.; Quilley, J.; Doumad, A.B.; Zhu, A.G.; Falck, J.R.; Hammock, B.D.; Stier, C.T., Jr.; Carroll, M.A. Increases in plasma trans-EETs and blood pressure reduction in spontaneously hypertensive rats. Am. J. Physiol. Heart Circ. Physiol. 2011, 300, H1990–H1996. [Google Scholar] [CrossRef] [PubMed]
- Dalle Vedove, F.; Fava, C.; Jiang, H.; Zanconato, G.; Quilley, J.; Brunelli, M.; Guglielmi, V.; Vattemi, G.; Minuz, P. Increased epoxyeicosatrienoic acids and reduced soluble epoxide hydrolase expression in the preeclamptic placenta. J. Hypertens. 2016, 34, 1364–1370. [Google Scholar] [CrossRef] [PubMed]
- Sari, I.; Pinarbasi, H.; Pinarbasi, E.; Yildiz, C. Association between soluble epoxy hydrolase gene and preeclampsia. Hypertens. Pregnancy 2017, 36, 315–325. [Google Scholar] [CrossRef] [PubMed]
- Sarı, İ.; Ökten, H.; Aktan, Ç.; Cihan, E. Association of the sEH gene promoter polymorphisms and haplotypes with preeclampsia. J. Med. Biochem. 2020, 39, 428–435. [Google Scholar] [CrossRef] [PubMed]
- Morisseau, C. The Role of Hydrolases in Biology and Xenobiotics Metabolism. Int. J. Mol. Sci. 2022, 23, 4870. [Google Scholar] [CrossRef] [PubMed]
- Hattori, N.; Fujiwara, H.; Maeda, M.; Fujii, S.; Ueda, M. Epoxide hydrolase affects estrogen production in the human ovary. Endocrinology 2000, 141, 3353–3365. [Google Scholar] [CrossRef] [PubMed]
- Popp, S.L.; Abele, I.S.; Buck, M.B.; Stope, M.B.; Blok, L.J.; Hanifi-Moghaddam, P.; Burger, C.W.; Fritz, P.; Knabbe, C. Microsomal epoxide hydrolase expression in the endometrial uterine corpus is regulated by progesterone during the menstrual cycle. J. Mol. Histol. 2010, 41, 111–119. [Google Scholar] [CrossRef] [PubMed]
- Lorenzi, D.; Fernández, C.; Bilinski, M.; Fabbro, M.; Galain, M.; Menazzi, S.; Miguens, M.; Perassi, P.N.; Fulco, M.F.; Kopelman, S.; et al. First custom next-generation sequencing infertility panel in Latin America: Design and first results. JBRA Assist. Reprod. 2020, 24, 104–114. [Google Scholar] [CrossRef] [PubMed]
Controls | RPL | |
---|---|---|
N | 50 | 63 |
Age (years) | 34.3 ± 6.5 | 36.5 ± 5 |
# Pregnancies (%) | 1 (10%) | 2 (47.6%) |
2 (60%) | 3 (36.6%) | |
3 (30%) | >3 (15.6%) | |
# Abortions (%) | 0 | 2 (46.7%) |
>2 (53.3%) | ||
Duration of pregnancy (weeks) | 37.3 ± 2.2 | 7.9 ± 3.9 |
Controls (n = 50) | Patients (n = 63) | p | |
---|---|---|---|
Tyr113Tyr/Glu298Glu | 34 (68%) | 30 (47.6%) | 0.28 |
Tyr113Tyr/Glu298Asp | 3 (6%) | 0 | 0.09 |
Tyr113Tyr/Asp298Asp | 0 | 0 | |
Tyr113His/Glu298Glu | 0 | 0 | |
Tyr113His/Glu298Asp | 13 (26%) | 23 (36.5%) | 0.44 |
Tyr113His/Asp298Asp | 0 | 0 | |
His113His/Glu298Glu | 0 | 4 (6.3%) | 0.14 |
His113His/Glu298Asp | 1 (2%) | 0 | 0.44 |
His113His/Asp298Asp | 0 | 6 (9.5%) | 0.04 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Peña, M.J.; De Sanctis, C.V.; De Sanctis, J.B.; Garmendia, J.V. Frequency of Gene Polymorphisms in Admixed Venezuelan Women with Recurrent Pregnancy Loss: Microsomal Epoxy Hydroxylase (rs1051740) and Enos (rs1799983). Curr. Issues Mol. Biol. 2024, 46, 3460-3469. https://doi.org/10.3390/cimb46040217
Peña MJ, De Sanctis CV, De Sanctis JB, Garmendia JV. Frequency of Gene Polymorphisms in Admixed Venezuelan Women with Recurrent Pregnancy Loss: Microsomal Epoxy Hydroxylase (rs1051740) and Enos (rs1799983). Current Issues in Molecular Biology. 2024; 46(4):3460-3469. https://doi.org/10.3390/cimb46040217
Chicago/Turabian StylePeña, María Johanna, Claudia Valentina De Sanctis, Juan Bautista De Sanctis, and Jenny Valentina Garmendia. 2024. "Frequency of Gene Polymorphisms in Admixed Venezuelan Women with Recurrent Pregnancy Loss: Microsomal Epoxy Hydroxylase (rs1051740) and Enos (rs1799983)" Current Issues in Molecular Biology 46, no. 4: 3460-3469. https://doi.org/10.3390/cimb46040217