Stem Cells Within Three-Dimensional-Printed Scaffolds Facilitate Airway Mucosa and Bone Regeneration and Reconstruction of Maxillary Defects in Rabbits
Abstract
:1. Introduction
2. Materials and Methods
2.1. hNTSC Isolation and Expansion
2.2. Differentiation of hNTSCs at the Air–Liquid Interface (ALI)
2.3. Fabrication of an Artificial Maxillary Graft
2.4. Preparation of hNTSCs Seeded onto Artificial Maxillary Graft
2.5. RNA Extraction and Quantitative Real-Time PCR
2.6. Alcian Blue Staining
2.7. Mineralization Assay
2.8. Maxillary Defect Model and Artificial Maxillary Graft Implantation
2.9. Histological Analysis and Immunohistofluorescence Staining
2.10. Scanning Electron Microscopy (SEM)
2.11. Statistical Analysis
3. Results
3.1. Differentiation of Respiratory Epithelial Cells from hNTSCs
3.2. Cell Distribution and Osteogenic Differentiation of hNTSCs on an Artificial Maxillary Graft In Vitro
3.3. Orthotopic Implantation of AMG-hNTSCs into Maxillary Defects
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Correction Statement
References
- Nyberg, E.L.; Farris, A.L.; Hung, B.P.; Dias, M.; Garcia, J.R.; Dorafshar, A.H.; Grayson, W.L. 3D-Printing Technologies for Craniofacial Rehabilitation, Reconstruction, and Regeneration. Ann. Biomed. Eng. 2017, 45, 45–57. [Google Scholar] [CrossRef]
- Broyles, J.M.; Abt, N.B.; Shridharani, S.M.; Bojovic, B.; Rodriguez, E.D.; Dorafshar, A.H. The fusion of craniofacial reconstruction and microsurgery: A functional and aesthetic approach. Plast. Reconstr. Surg. 2014, 134, 760–769. [Google Scholar] [CrossRef] [PubMed]
- Fisher, M.; Dorafshar, A.; Bojovic, B.; Manson, P.N.; Rodriguez, E.D. The evolution of critical concepts in aesthetic craniofacial microsurgical reconstruction. Plast. Reconstr. Surg. 2012, 130, 389–398. [Google Scholar] [CrossRef] [PubMed]
- Maroulakos, M.; Kamperos, G.; Tayebi, L.; Halazonetis, D.; Ren, Y. Applications of 3D printing on craniofacial bone repair: A systematic review. J. Dent. 2019, 80, 1–14. [Google Scholar] [CrossRef]
- Datta, P.; Ozbolat, V.; Ayan, B.; Dhawan, A.; Ozbolat, I.T. Bone tissue bioprinting for craniofacial reconstruction. Biotechnol. Bioeng. 2017, 114, 2424–2431. [Google Scholar] [CrossRef] [PubMed]
- Kuss, M.A.; Harms, R.; Wu, S.; Wang, Y.; Untrauer, J.B.; Carlson, M.A.; Duan, B. Short-term hypoxic preconditioning promotes prevascularization in 3D bioprinted bone constructs with stromal vascular fraction derived cells. RSC Adv. 2017, 7, 29312–29320. [Google Scholar] [CrossRef] [PubMed]
- Obregon, F.; Vaquette, C.; Ivanovski, S.; Hutmacher, D.W.; Bertassoni, L.E. Three-Dimensional Bioprinting for Regenerative Dentistry and Craniofacial Tissue Engineering. J. Dent. Res. 2015, 94, 143S–152S. [Google Scholar] [CrossRef]
- Smith, D.M.; Cray, J.J.; Weiss, L.E.; Fei, E.K.D.; Shakir, S.; Rottgers, S.A.; Losee, J.E.; Campbell, P.G.; Cooper, G.M. Precise Control of Osteogenesis for Craniofacial Defect Repair. Ann. Plas. Surg. 2012, 69, 485–488. [Google Scholar] [CrossRef] [PubMed]
- Thrivikraman, G.; Athirasala, A.; Twohig, C.; Boda, S.K.; Bertassoni, L.E. Biomaterials for Craniofacial Bone Regeneration. Dent. Clin. N. Am. 2017, 61, 835–856. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.; Huang, S.; Zou, R.; Gao, X.; Ruan, J.; Weir, M.D.; Reynolds, M.A.; Qin, W.; Chang, X.; Fu, H.; et al. Calcium phosphate cement scaffold with stem cell co-culture and prevascularization for dental and craniofacial bone tissue engineering. Dent. Mater. 2019, 35, 1031–1041. [Google Scholar] [CrossRef] [PubMed]
- Montgomery, W.W. Subglottic Stenosis. Int. Surg. 1982, 67, 199–207. [Google Scholar]
- Thomé, R.; Thomé, D.C.; Behlau, M. The use of buccal mucosa graft at posterior cricoid splitting for subglottic stenosis repair. Laryngoscope 2001, 111, 2191–2194. [Google Scholar] [CrossRef] [PubMed]
- Meretsky, C.R.; Polychronis, A.; Schiuma, A.T. A Comparative Analysis of the Advances in Stem Cell Therapy in Plastic Surgery: A Systematic Review of Current Applications and Future Directions. Cureus 2024, 16, e67067. [Google Scholar] [CrossRef]
- Hwang, S.H.; Kim, S.Y.; Park, S.H.; Choi, M.Y.; Back, S.A.; Kim, Y.I.; Sun, D.I.; Kim, S.W. Osteogenic Differentiation of Human Turbinate Mesenchymal Stromal Cells. Tissue Eng. Regen. Med. 2011, 8, 544–553. [Google Scholar]
- Hwang, S.H.; Kim, S.Y.; Park, S.H.; Choi, M.Y.; Kang, H.W.; Seol, Y.J.; Park, J.H.; Cho, D.W.; Hong, O.K.; Rha, J.G.; et al. Human Inferior Turbinate: An Alternative Tissue Source of Multipotent Mesenchymal Stromal Cells. Otolaryng. Head Neck 2012, 147, 568–574. [Google Scholar] [CrossRef] [PubMed]
- Kwon, J.S.; Kim, S.W.; Kwon, D.Y.; Park, S.H.; Son, A.R.; Kim, J.H.; Kim, M.S. In vivo osteogenic differentiation of human turbinate mesenchymal stem cells in an injectable in situ-forming hydrogel. Biomaterials 2014, 35, 5337–5346. [Google Scholar] [CrossRef] [PubMed]
- Park, J.H.; Park, J.Y.; Nam, I.C.; Hwang, S.H.; Kim, C.S.; Jung, J.W.; Jang, J.; Lee, H.; Choi, Y.; Park, S.H.; et al. Human turbinate mesenchymal stromal cell sheets with bellows graft for rapid tracheal epithelial regeneration. Acta Biomater. 2015, 25, 56–64. [Google Scholar] [CrossRef]
- Park, J.H.; Ahn, M.; Park, S.H.; Kim, H.; Bae, M.; Park, W.; Hollister, S.J.; Kim, S.W.; Cho, D.W. 3D bioprinting of a trachea-mimetic cellular construct of a clinically relevant size. Biomaterials 2021, 279, 121246. [Google Scholar] [CrossRef] [PubMed]
- Cubo, N.; Garcia, M.; del Cañizo, J.F.; Velasco, D.; Jorcano, J.L. 3D bioprinting of functional human skin: Production and in vivo analysis. Biofabrication 2017, 9, 015006. [Google Scholar] [CrossRef]
- Wong, A.P.; Bear, C.E.; Chin, S.; Pasceri, P.; Thompson, T.O.; Huan, L.J.; Ratjen, F.; Ellis, J.; Rossant, J. Directed differentiation of human pluripotent stem cells into mature airway epithelia expressing functional CFTR protein. Nat. Biotechnol. 2012, 30, 876–882. [Google Scholar] [CrossRef] [PubMed]
- Stewart, C.E.; Torr, E.E.; Mohd Jamili, N.H.; Bosquillon, C.; Sayers, I. Evaluation of differentiated human bronchial epithelial cell culture systems for asthma research. J. Allergy 2012, 2012, 943982. [Google Scholar] [CrossRef] [PubMed]
- Guillot, P.V.; De Bari, C.; Dell’Accio, F.; Kurata, H.; Polak, J.; Fisk, N.M. Comparative osteogenic transcription profiling of various fetal and adult mesenchymal stem cell sources. Differentiation 2008, 76, 946–957. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.L.; Yi, F.; Pan, H.Z.; Duan, S.L.; Ding, Z.C.; Yuan, G.H.; Qu, J.; Zhang, H.C.; Liu, G.H. Progress and prospects in stem cell therapy. Acta Pharmacol. Sin. 2013, 34, 741–746. [Google Scholar] [CrossRef]
- Mizuno, H. Adipose-derived stem cells for tissue repair and regeneration: Ten years of research and a literature review. J. Nippon. Med. Sch. 2009, 76, 56–66. [Google Scholar] [CrossRef] [PubMed]
- Mundra, V.; Gerling, I.C.; Mahato, R.I. Mesenchymal stem cell-based therapy. Mol. Pharm. 2013, 10, 77–89. [Google Scholar] [CrossRef]
- Ketcham, A.S.; Han, J.K. Complications and management of septoplasty. Otolaryngol. Clin. N. Am. 2010, 43, 897–904. [Google Scholar] [CrossRef] [PubMed]
- Creuzet, S.; Couly, G.; Vincent, C.; Le Douarin, N.M. Negative effect of Hox gene expression on the development of the neural crest-derived facial skeleton. Development 2002, 129, 4301–4313. [Google Scholar] [CrossRef] [PubMed]
- Pelttari, K.; Pippenger, B.; Mumme, M.; Feliciano, S.; Scotti, C.; Mainil-Varlet, P.; Procino, A.; von Rechenberg, B.; Schwamborn, T.; Jakob, M.; et al. Adult human neural crest-derived cells for articular cartilage repair. Sci. Transl. Med. 2014, 6, 251ra119. [Google Scholar] [CrossRef] [PubMed]
- Yun, B.G.; Lee, S.H.; Jeon, J.H.; Kim, S.W.; Jung, C.K.; Park, G.; Kim, S.Y.; Jeon, S.; Lee, M.S.; Park, S.H.; et al. Accelerated Bone Regeneration via Three-Dimensional Cell-Printed Constructs Containing Human Nasal Turbinate-Derived Stem Cells as a Clinically Applicable Therapy. ACS Biomater. Sci. Eng. 2019, 5, 6171–6185. [Google Scholar] [CrossRef]
- Sun, H.; Mei, L.; Song, C.; Cui, X.; Wang, P. The in vivo degradation, absorption and excretion of PCL-based implant. Biomaterials 2006, 27, 1735–1740. [Google Scholar] [CrossRef]
- Woodruff, M.A.; Hutmacher, D.W. The return of a forgotten polymer-Polycaprolactone in the 21st century. Prog. Polym. Sci. 2010, 35, 1217–1256. [Google Scholar] [CrossRef]
- Kangari, P.; Talaei-Khozani, T.; Razeghian-Jahromi, I.; Razmkhah, M. Mesenchymal stem cells: Amazing remedies for bone and cartilage defects. Stem. Cell Res. Ther. 2020, 11, 492. [Google Scholar] [CrossRef] [PubMed]
- Paunescu, V.; Deak, E.; Herman, D.; Siska, I.R.; Tanasie, G.; Bunu, C.; Anghel, S.; Tatu, C.A.; Oprea, T.I.; Henschler, R.; et al. In vitro differentiation of human mesenchymal stem cells to epithelial lineage. J. Cell Mol. Med. 2007, 11, 502–508. [Google Scholar] [CrossRef]
- Mizuta, N.; Hattori, K.; Suzawa, Y.; Iwai, S.; Matsumoto, T.; Tadokoro, M.; Nakano, T.; Akashi, M.; Ohgushi, H.; Yura, Y. Mesenchymal stromal cells improve the osteogenic capabilities of mineralized agarose gels in a rat full-thickness cranial defect model. J. Tissue Eng. Regen. Med. 2013, 7, 51–60. [Google Scholar] [CrossRef] [PubMed]
- Suenaga, H.; Furukawa, K.S.; Suzuki, Y.; Takato, T.; Ushida, T. Bone regeneration in calvarial defects in a rat model by implantation of human bone marrow-derived mesenchymal stromal cell spheroids. J. Mater. Sci.-Mater. Med. 2015, 26, 254. [Google Scholar] [CrossRef]
- Wei, L.C.; Lei, G.H.; Yi, H.W.; Sheng, P.Y. Bone formation in rabbit’s leg muscle after autologous transplantation of bone marrow-derived mesenchymal stem cells expressing human bone morphogenic protein-2. Indian J. Orthop. 2014, 48, 347–353. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.Y.; Lv, Y.G. Reconstructing Bone with Natural Bone Graft: A Review of In Vivo Studies in Bone Defect Animal Model. Nanomaterials 2018, 8, 999. [Google Scholar] [CrossRef]
Name | Forward Primer (5′→3′) | Reverse Primer (5′→3′) | Ref. |
---|---|---|---|
FOXJ1 | GAGCGGCGCTTTCAAGAAG | GGCCTCGGTATTCACCGTC | [20] |
E-cadherin | CCCACCACGTACAAGGGTC | CTGGGGTATTGGGGGCATC | [21] |
BMP2 | TTCCACCATGAAGAATCTTTGGA | CCTGAAGCTCTGCTGAGGTGAT | [22] |
RUNX2 | TCCTCCCCAAGTAGCTACCT | AGCTTCTGTCTGTGCCTTCT | [22] |
GAPDH | AACAGCGACACCCACTCCTC | CATACCAGGAAATGAGCTTGACAA | [22] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Published by MDPI on behalf of the Lithuanian University of Health Sciences. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lim, M.H.; Jeon, J.H.; Park, S.H.; Yun, B.G.; Kim, S.-W.; Cho, D.-W.; Lee, J.H.; Kim, D.H.; Kim, S.W. Stem Cells Within Three-Dimensional-Printed Scaffolds Facilitate Airway Mucosa and Bone Regeneration and Reconstruction of Maxillary Defects in Rabbits. Medicina 2024, 60, 2111. https://doi.org/10.3390/medicina60122111
Lim MH, Jeon JH, Park SH, Yun BG, Kim S-W, Cho D-W, Lee JH, Kim DH, Kim SW. Stem Cells Within Three-Dimensional-Printed Scaffolds Facilitate Airway Mucosa and Bone Regeneration and Reconstruction of Maxillary Defects in Rabbits. Medicina. 2024; 60(12):2111. https://doi.org/10.3390/medicina60122111
Chicago/Turabian StyleLim, Mi Hyun, Jung Ho Jeon, Sun Hwa Park, Byeong Gon Yun, Seok-Won Kim, Dong-Woo Cho, Jeong Hak Lee, Do Hyun Kim, and Sung Won Kim. 2024. "Stem Cells Within Three-Dimensional-Printed Scaffolds Facilitate Airway Mucosa and Bone Regeneration and Reconstruction of Maxillary Defects in Rabbits" Medicina 60, no. 12: 2111. https://doi.org/10.3390/medicina60122111
APA StyleLim, M. H., Jeon, J. H., Park, S. H., Yun, B. G., Kim, S.-W., Cho, D.-W., Lee, J. H., Kim, D. H., & Kim, S. W. (2024). Stem Cells Within Three-Dimensional-Printed Scaffolds Facilitate Airway Mucosa and Bone Regeneration and Reconstruction of Maxillary Defects in Rabbits. Medicina, 60(12), 2111. https://doi.org/10.3390/medicina60122111