Whey Protein Isolate/Calcium Silicate Hydrogels for Bone Tissue Engineering Applications—Preliminary In Vitro Evaluation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of WPI-Based Biocomposites
2.2. Scanning Electron Microscope (SEM) Observations
2.3. Swelling Analysis
2.4. Mechanical Compression Testing
2.5. Fourier Transform Infrared (FTIR) Spectroscopy Analysis
2.6. Cytocompatibility In Vitro
2.7. Statistical Analysis
3. Results and Discussion
3.1. Surface Topography
3.2. Ability to Absorb Liquids
3.3. Mechanical Properties
3.4. ATR-FTIR Results
3.5. Human Osteoblasts Response In Vitro
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bai, X.; Gao, M.; Syed, S.; Zhuang, J.; Xu, X.; Zhang, X.Q. Bioactive hydrogels for bone regeneration. Bioact. Mater. 2018, 3, 401–417. [Google Scholar] [CrossRef]
- Liu, J.; Yang, L.; Liu, K.; Gao, F. Hydrogel scaffolds in bone regeneration: Their promising roles in angiogenesis. Front. Pharmacol. 2023, 14, 1050954. [Google Scholar] [CrossRef]
- Yue, S.; He, H.; Li, B.; Hou, T. Hydrogel as a biomaterial for bone tissue engineering: A review. Nanomaterials 2020, 10, 1511. [Google Scholar] [CrossRef]
- Shahshahani, S.; Shahgholi, M.; Karimipour, A. The thermal performance and mechanical stability of methacrylic acid porous hydrogels in an aqueous medium at different initial temperatures and hydrogel volume fraction using the molecular dynamics simulation. J. Mol. Liq. 2023, 382, 122001. [Google Scholar] [CrossRef]
- Hafezi, M.; Khorasani, S.N.; Zare, M.; Neisiany, R.E.; Davoodi, P. Advanced hydrogels for cartilage tissue engineering: Recent progress and future directions. Polymers 2021, 13, 4199. [Google Scholar] [CrossRef]
- Madhusudanan, P.; Raju, G.; Shankarappa, S. Hydrogel systems and their role in neural tissue engineering. J. R. Soc. Interface 2020, 17, 20190505. [Google Scholar] [CrossRef]
- Arjun Uppuluri, V.N.V.; Sathanantham, S.T.; Bhimavarapu, S.K.; Elumalai, L. Polymeric Hydrogel Scaffolds: Skin Tissue Engineering and Regeneration. Adv. Pharm. Bull. 2022, 12, 437–448. [Google Scholar] [CrossRef]
- Koochaki, A.; Shahgholi, M.; Sajadi, S.M.; Babadi, E.; Inc, M. Investigation of the mechanical stability of polyethylene glycol hydrogel reinforced with cellulose nanofibrils for wound healing: Molecular dynamics simulation. Eng. Anal. Bound. Elem. 2023, 151, 1–7. [Google Scholar] [CrossRef]
- Douglas, T.E.L.; Vandrovcová, M.; Kročilová, N.; Keppler, J.K.; Zárubová, J.; Skirtach, A.G.; Bačáková, L. Application of whey protein isolate in bone regeneration: Effects on growth and osteogenic differentiation of bone-forming cells. J. Dairy Sci. 2018, 101, 28–36. [Google Scholar] [CrossRef]
- Gupta, D.; Kocot, M.; Tryba, A.M.; Serafim, A.; Stancu, I.C.; Jaegermann, Z.; Pamuła, E.; Reilly, G.C.; Douglas, T.E.L. Novel naturally derived whey protein isolate and aragonite biocomposite hydrogels have potential for bone regeneration. Mater. Des. 2020, 188, 108408. [Google Scholar] [CrossRef]
- Dziadek, M.; Kudlackova, R.; Zima, A.; Slosarczyk, A.; Ziabka, M.; Jelen, P.; Shkarina, S.; Cecilia, A.; Zuber, M.; Baumbach, T.; et al. Novel multicomponent organic–inorganic WPI/gelatin/CaP hydrogel composites for bone tissue engineering. J. Biomed. Mater. Res. Part A 2019, 107, 2479–2491. [Google Scholar] [CrossRef]
- Tai, C.S.; Chen, Y.Y.; Chen, W.L. β -Lactoglobulin Influences Human Immunity and Promotes Cell Proliferation. BioMed Res. Int. 2016, 2016, 7123587. [Google Scholar] [CrossRef] [PubMed]
- Srinath, P.; Abdul Azeem, P.; Venugopal Reddy, K. Review on calcium silicate-based bioceramics in bone tissue engineering. Int. J. Appl. Ceram. Technol. 2020, 17, 2450–2464. [Google Scholar] [CrossRef]
- Liu, Z.; He, X.; Chen, S.; Yu, H. Advances in the use of calcium silicate-based materials in bone tissue engineering. Ceram. Int. 2023, 49, 19355–19363. [Google Scholar] [CrossRef]
- Venkatraman, S.K.; Swamiappan, S. Review on calcium- and magnesium-based silicates for bone tissue engineering applications. J. Biomed. Mater. Res. Part A 2020, 108, 1546–1562. [Google Scholar] [CrossRef]
- Youness, R.A.; Tag El-deen, D.M.; Taha, M.A. A Review on Calcium Silicate Ceramics: Properties, Limitations, and Solutions for Their Use in Biomedical Applications. Silicon 2023, 15, 2493–2505. [Google Scholar] [CrossRef]
- Zhang, N.; Molenda, J.A.; Fournelle, J.H.; Murphy, W.L.; Sahai, N. Effects of pseudowollastonite (CaSiO3) bioceramic on in vitro activity of human mesenchymal stem cells. Biomaterials 2010, 31, 7653–7665. [Google Scholar] [CrossRef]
- Klimek, K.; Przekora, A.; Benko, A.; Niemiec, W.; Blazewicz, M.; Ginalska, G. The use of calcium ions instead of heat treatment for β-1,3-glucan gelation improves biocompatibility of the β-1,3-glucan/HA bone scaffold. Carbohydr. Polym. 2017, 164, 170–178. [Google Scholar] [CrossRef]
- Kalaskar, D. Inorganic Biomaterials: Structure, Properties and Applications; Zhang, X., Ed.; Smithers Rapra: Shrewsbury, UK, 2014. [Google Scholar]
- Nandiyanto, A.B.D.; Oktiani, R.; Ragadhita, R. How to Read and Interpret FTIR Spectroscope of Organic Material. Indones. J. Sci. Technol. 2019, 4, 97–118. [Google Scholar] [CrossRef]
- Klimek, K.; Palka, K.; Truszkiewicz, W.; Douglas, T.E.L.; Nurzynska, A.; Ginalska, G. Could Curdlan/Whey Protein Isolate/Hydroxyapatite Biomaterials Be Considered as Promising Bone Scaffolds?—Fabrication, Characterization, and Evaluation of Cytocompatibility towards Osteoblast Cells In Vitro. Cells 2022, 11, 3251. [Google Scholar] [CrossRef]
- Klimek, K.; Tarczynska, M.; Truszkiewicz, W.; Gaweda, K.; Douglas, T.; Ginalska, G. Freeze-Dried Curdlan/Whey Protein Isolate-Based Biomaterial as Promising Scaffold for Matrix-Associated Autologous Chondrocyte Transplantation—A Pilot In-Vitro Study. Cells 2022, 11, 282. [Google Scholar] [CrossRef]
- Rao, X.; Huang, X.; Zhou, Z.; Lin, X. An improvement of the 2ˆ(-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat. Bioinform. Biomath. 2013, 3, 71–85. [Google Scholar]
- Primer-BLAST Tool. Available online: http://www.ncbi.nlm.nih.gov/tools/primer-blast/ (accessed on 12 April 2021).
- Hashemibeni, B.; Dehghani, L.; Sadeghi, F.; Esfandiari, E.; Gorbani, M.; Akhavan, A.; Tahani, S.T.; Bahramian, H.; Goharian, V. Bone repair with differentiated osteoblasts from adipose-derived stem cells in hydroxyapatite/tricalcium phosphate in vivo. Int. J. Prev. Med. 2016, 2016, 62. [Google Scholar] [CrossRef]
- Dziadek, M.; Charuza, K.; Kudlackova, R.; Aveyard, J.; D’Sa, R.; Serafim, A.; Stancu, I.C.; Iovu, H.; Kerns, J.G.; Allinson, S.; et al. Modification of heat-induced whey protein isolate hydrogel with highly bioactive glass particles results in promising biomaterial for bone tissue engineering. Mater. Des. 2021, 205, 109749. [Google Scholar] [CrossRef]
- Baino, F.; Yamaguchi, S. The use of simulated body fluid (SBF) for assessing materials bioactivity in the context of tissue engineering: Review and challenges. Biomimetics 2020, 5, 57. [Google Scholar] [CrossRef]
- Slota, D.; Gląb, M.; Tyliszczak, B.; Dogulas, T.E.L.; Rudnicka, K.; Miernik, K.; Urbaniak, M.M.; Rusek-Wala, P.; Sobczak-upiec, A. Composites based on hydroxyapatite and whey protein isolate for applications in bone regeneration. Materials 2021, 14, 2317. [Google Scholar] [CrossRef] [PubMed]
- Killion, J.A.; Geever, L.M.; Devine, D.M.; Higginbotham, C.L. Fabrication and in vitro biological evaluation of photopolymerisable hydroxyapatite hydrogel composites for bone regeneration. J. Biomater. Appl. 2014, 28, 1274–1283. [Google Scholar] [CrossRef]
- Canillas, M.; De Lima, G.G.; Rodríguez, M.A.; Nugent, M.J.D.; Devine, D.M. Bioactive composites fabricated by freezing-thawing method for bone regeneration applications. J. Polym. Sci. Part B Polym. Phys. 2016, 54, 761–773. [Google Scholar] [CrossRef]
- Movasaghi, Z.; Rehman, S.; Rehman, I.U. Fourier transform infrared (FTIR) spectroscopy of biological tissues. Appl. Spectrosc. Rev. 2008, 43, 134–179. [Google Scholar] [CrossRef]
- Paluszkiewicz, C.; Blazewicz, M.; Podporska, J.; Gumuła, T. Nucleation of hydroxyapatite layer on wollastonite material surface: FTIR studies. Vib. Spectrosc. 2008, 48, 263–268. [Google Scholar] [CrossRef]
- Chen, W.; Liang, Y.; Hou, X.; Zhang, J.; Ding, H.; Sun, S.; Cao, H. Mechanical grinding preparation and characterization of TiO2-coated wollastonite composite pigments. Materials 2018, 11, 593. [Google Scholar] [CrossRef] [PubMed]
- Satyanarayana, R. Ground Characterization and Foundations Proceedings of Indian Geotechnical Conference; Springer: Singapore, 2020. [Google Scholar]
- Gbassi, G.; Yolou, F.; Sarr, S.; Atheba, P.; Amin, C.; Ake, M. Whey proteins analysis in aqueous medium and in artificial gastric and intestinal fluids. Int. J. Biol. Chem. Sci. 2012, 6, 1828–1837. [Google Scholar] [CrossRef]






| Sample Symbol | Content of WPI (%) | Content of CaSiO3 |
|---|---|---|
| 40/0 | 40 | 0 |
| 40/2.32 | 40 | 2.32 |
| 40/5 | 40 | 5 |
| Gene | Primer Sequence (5′–3′) | Product Size (bp) |
|---|---|---|
| Collagen type I (Col I) | F: GGCCCAGAAGAACTGGTACA R: AATCCATCGGTCATGCTCTC | 81 |
| Bone alkaline phosphatase (bALP) | F: TTGGCCAACAGGGTAGATTT R: GGAGGGTCAGATCCAGAATG | 144 |
| Osteocalcin (OC) | F: ACACTCCTCGCCCTATTG R: GATGTGGTCAGCCAACTC | 249 |
| Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | F: CACCACACTGAATCTCCCCT R: TGGTTGAGCACAGGGTACTT | 115 |
| Wavenumber (cm−1) | Assignment |
|---|---|
| 3283 (3273/87/89) | Symmetric stretching O-H |
| 3267 (3273/87/89) | Symmetric stretching O-H |
| 3262 (3273/87/89) | Symmetric stretching O-H |
| 2963 | Deformation CH3 |
| 2935 | Asymmetric stretching C-H |
| 2919 (2917/8/9) | Stretching C-H |
| 2876 (2874) | Symmetric stretching CH3 Stretching C-H, N-H Symmetric stretching CH3 of acyl chains (lipids) |
| 1628 (1630–700) | Amide I region |
| 1624 (1630–700) | Amide I region |
| 1519 (1517) | Amide II |
| 1516 (1517) | Amide II |
| 1393 (1935) | Bending CH3 due to aliphatic side groups of the amino acid residues |
| 1388 (1388) | Bending CH3 Stretching C-O, deformation C-H, deformation N-H |
| 1315 (1317) | Amide III band components of proteins |
| 1240 | Asymmetric stretching PO2− Amide III mode of protein |
| 1237 | Asymmetric stretching PO2− (phosphate I) |
| 1162 | Stretching modes of the C-OH groups of proteins, e.g., serine, threonine, and tyrosine residues |
| 1080 | Symmetric stretching PO2− |
| 986 (985) | OCH3 modes |
| 934 (938) | Unassigned |
| 929 (925–9) | Unassigned |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ivory-Cousins, T.; Nurzynska, A.; Klimek, K.; Baines, D.K.; Truszkiewicz, W.; Pałka, K.; Douglas, T.E.L. Whey Protein Isolate/Calcium Silicate Hydrogels for Bone Tissue Engineering Applications—Preliminary In Vitro Evaluation. Materials 2023, 16, 6484. https://doi.org/10.3390/ma16196484
Ivory-Cousins T, Nurzynska A, Klimek K, Baines DK, Truszkiewicz W, Pałka K, Douglas TEL. Whey Protein Isolate/Calcium Silicate Hydrogels for Bone Tissue Engineering Applications—Preliminary In Vitro Evaluation. Materials. 2023; 16(19):6484. https://doi.org/10.3390/ma16196484
Chicago/Turabian StyleIvory-Cousins, Tayla, Aleksandra Nurzynska, Katarzyna Klimek, Daniel K. Baines, Wieslaw Truszkiewicz, Krzysztof Pałka, and Timothy E. L. Douglas. 2023. "Whey Protein Isolate/Calcium Silicate Hydrogels for Bone Tissue Engineering Applications—Preliminary In Vitro Evaluation" Materials 16, no. 19: 6484. https://doi.org/10.3390/ma16196484
APA StyleIvory-Cousins, T., Nurzynska, A., Klimek, K., Baines, D. K., Truszkiewicz, W., Pałka, K., & Douglas, T. E. L. (2023). Whey Protein Isolate/Calcium Silicate Hydrogels for Bone Tissue Engineering Applications—Preliminary In Vitro Evaluation. Materials, 16(19), 6484. https://doi.org/10.3390/ma16196484

