Rapid Detection of Pine Pathogens Lecanosticta acicola, Dothistroma pini and D. septosporum on Needles by Probe-Based LAMP Assays
by
, , , , and
Chiara Aglietti
1
,
Colton D. Meinecke
2,
Luisa Ghelardini
1,3,*
,
Irene Barnes
4,
Ariska van der Nest
4 and
Caterina Villari
2 1
Department of Agriculture, Food, Environment and Forestry (DAGRI), University of Florence, Piazzale delle Cascine 28, I-50144 Firenze, Italy
2
Warnell School of Forestry & Natural Resources, University of Georgia, Athens, GA 30602-2152, USA
3
Institute for Sustainable Plant Protection, CNR, 50019 Sesto Fiorentino, Italy
4
Department of Biochemistry, Genetics and Microbiology, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria 002, South Africa
*
Author to whom correspondence should be addressed.
Forests 2021, 12(4), 479; https://doi.org/10.3390/f12040479
Submission received: 8 March 2021
/
Revised: 7 April 2021
/
Accepted: 10 April 2021
/
Published: 14 April 2021
(This article belongs to the Special Issue Ecology, Identification and Management of Forest Diseases)
Abstract
:Needle blights are serious needle fungal diseases affecting pines both in natural and productive forests. Among needle blight agents, the ascomycetes Lecanosticta acicola, Dothistroma pini and D. septosporum are of particular concern. These pathogens need specific, fast and accurate diagnostics since they are regulated species in many countries and may require differential management measures. Due to the similarities in fungal morphology and the symptoms they elicit, these species are hard to distinguish using morphological characteristics. The symptoms can also be confused with those caused by insects or abiotic agents. DNA-based detection is therefore recommended. However, the specific PCR assays that have been produced to date for the differential diagnosis of these pathogens can be applied only in a well-furnished laboratory and the procedure takes a relatively long execution time. Surveillance and forest protection would benefit from a faster diagnostic method, such as a loop-mediated isothermal amplification (LAMP) assay, which requires less sophisticated equipment and can also be deployed directly on-site using portable devices. LAMP assays for the rapid and early detection of L. acicola, D. pini and D. septosporum were developed in this work. Species-specific LAMP primers and fluorescent assimilating probes were designed for each assay, targeting the beta tubulin (β-tub2) gene for the two Dothistroma species and the elongation factor (EF-1α) region for L. acicola. Each reaction detected its respective pathogen rapidly and with high specificity and sensitivity in DNA extracts from both pure fungal cultures and directly from infected pine needles. These qualities and the compatibility with inexpensive portable instrumentation position these LAMP assays as an effective method for routine phytosanitary control of plant material in real time, and they could profitably assist the management of L. acicola, D. pini and D. septosporum.
1. Introduction
Needle blights are among the most serious fungal needle diseases affecting pine species worldwide both in plantations and naturally regenerating forest ecosystems. Among the different causal agents, the ascomycetous fungi Lecanosticta acicola (Thümen) H. Sydow, Dothistroma pini Hulbary and D. septosporum (G. Doroguine) M. Morelet are of particular concern [1], causing brown spot needle blight (BSNB) and Dothistroma needle blight (DNB), respectively. Needles infected by these fungi progressively die from the tip and are prematurely shed. The proximal part of the branches and the lower crown are generally defoliated first. Eventually, almost all needles are lost, growth is severely impaired and the trees are weakened and may die after heavy and repeated attacks [2]. Because the photosynthetic activity of diseased needles is severely impaired, these diseases can cause major reductions in tree growth and limit wood production even when less than one-quarter of the canopy is affected [3]. These diseases can damage plants of a young age, thus inhibiting the growth in new plantations and locally impairing natural regeneration [4,5]. Currently, these three fungal pathogens are regulated in many countries of the world. According to the European and Mediterranean Plant Protection Organization (EPPO), L. acicola is categorized as a quarantine species in Morocco, Tunisia and Norway, and is included in the A1 list of quarantine species in Argentina, Brazil, Chile, Uruguay, Bahrain, Kazakhstan, Russia, Turkey and Ukraine and in the A2 list of quarantine species in Jordan [6]; D. septosporum is a quarantine species in Israel and Norway and it has the A2 quarantine status in Turkey and Jordan [7]; and D. pini is categorized as an A2 quarantine species in Turkey [8]. In the European Union, all three species are classified as Regulated Non Quarantine Pests (RNQPs), i.e., species regulated by implementing phytosanitary measures to reduce the economic impact in EU territories [9,10].
For most of the 20th century, DNB was known primarily as a destructive disease of pine plantations in the Southern Hemisphere (for a review of the historical records per country, the reader is referred to [11] and the supplementary data contained therein). Similarly, BSNB was initially confined to the southern part of the USA [12], but starting with a report in Spain in the 1940s [13], the pathogen was reported in several other countries in Europe, Asia and America (for a list of historical records see [14]). Nowadays, outbreaks of DNB and BSNB represent a global phenomenon [5,11,14,15,16,17,18,19,20], and the widespread mortality of natural pine forests and plantations is raising concern, given the commercial and environmental importance of the species. More than 95 pine species are currently confirmed as hosts of these pathogens, with varying degrees of susceptibility [11,14,21]. The infection of plants in other genera of Pinaceae has occasionally been reported for D. septosporum, possibly as a consequence of a high inoculum load from heavily infected neighboring pine plants [22,23,24], while for L. acicola there is a single and recent report of natural infection on a non-pine host, that is, on Cedrus Trew in Turkey [20]. Therefore, the exact number of host species is probably not yet well-defined. Moreover, an increase in DNB severity is expected, especially in the Northern Hemisphere, where natural woodlands and plantation forests are in close proximity, and where climate change could lead to increases in summer precipitation [25,26,27]. However, many other biotic, abiotic and anthropogenic factors could be important drivers for needle blights epidemics. Among these, the movement of infected planting material between regions and countries is thought to be the main anthropogenic pathway of L. acicola, D. pini and D. septosporum [28,29,30,31].
The ingress of plant pathogens from different origins could also lead to the mixing of different genetic populations, even when countries already harbor the same species. Since the three pathogens are known for having high intraspecific genetic variability carried out by sexual reproduction, the mixing of different populations may give rise to haplotypes containing new allele combinations [15,32,33,34,35], some of which might prevail under selective pressure if they were more capable of adapting to local environmental conditions, more virulent in attacking the host or able to better defeat existing resistance mechanisms [36,37]. Thus, it is crucial that efforts to prevent the spread of L. acicola, D. pini and D. septosporum across countries are strengthened. In this regard, there is a great need for user-friendly early detection methods that could be deployed at the point-of-care, that is, directly at the time and place of interest. Examples would be during phytosanitary inspections of commercial consignments at ports of entry or in plant nurseries, to rapidly screen for such pathogens in a highly specific way. These tools would help in the proper implementation of management and treatment measures [38] and in controlling and limiting the spread of L. acicola, D. pini and D. septosporum into pathogen-free areas. However, these three pathogens elicit very similar symptoms on their hosts, making it difficult to discriminate one from the other based only on the morphological characteristics of the symptoms, even for an expert eye [14,39]. Moreover, there can be a lag of several months between infection and symptom expression for all of these species [40], making visual inspection an even less reliable approach for surveillance [29]. DNB symptoms may also be confused with abiotic damage and with damage caused by a number of needle sap-sucker and needle mining insects, such as the red-black pine bug Haematoloma dorsatum (Ahrens), widely distributed in Europe [41,42], Ocoaxo (Fennah) spittlebug species associated with pine forests in Mexico [43] and the Eurasian weevil beetle Brachonyx pineti (Paykull) [44]. DNA-based diagnostic methods are a more accurate alternative, especially because they allow for the species-specific detection of the pathogens even during the latent phase. However, the current available molecular diagnostic methods for the detection of L. acicola, D. pini and D. septosporum mostly rely on PCR [45,46,47,48] and qPCR [46], which are time consuming, and which require a well-equipped laboratory and molecular biology skills, thus being impractical for point-of-care implementation.
An alternative approach to PCR diagnostics would be the use of loop-mediated isothermal amplification (LAMP) [49]. This method allows one to amplify target DNA under constant temperatures, thus removing the need for expensive and bulky thermocyclers that can be replaced by user-friendly and field-suitable portable tools, without losing the benefits of molecular diagnostic methods. Moreover, LAMP is extremely rapid, being able to copy very large amounts of DNA in less than an hour [50], and it is more resistant to PCR inhibitors compared to standard PCR-based methods [51], thus allowing for the use of crude DNA extracts [52,53,54]. All these features make it an ideal solution for in-field point-of-care molecular diagnostics [55]. In addition, the technology has already proved successful for the detection of pathogens in forest systems [54,56,57,58,59,60]. The aim of this study was to develop three LAMP-based diagnostic assays for the rapid and early detection of the pine pathogens L. acicola, D. pini and D. septosporum.
2. Materials and Methods
2.1. Samples
Both axenic fungal cultures (Table 1) and naturally infected pine needle samples (Table 2) were used for optimizing each LAMP assay. The 58 fungal cultures used for this work included (i) 7 strains of L. acicola with different mating types, 17 strains of Dothistroma pini, and 8 strains of D. septosporum, (ii) species phylogenetically related to the former target species and iii) common colonizers of pine needles. Pine needle samples were collected from different symptomatic pine species (Pinus mugo Turra, P. cembra L., P. halepensis Mill., P. brutia Ten., P. sylvestris L., P. nigra J. F. Arnold, P. nigra subsp. laricio (Poir.) Maire, and P. palustris Mill.) in Italy [19], Slovenia [17] and Georgia (USA), and included both needles clearly displaying fungal fruiting bodies and needles showing only incipient symptoms of discolored banding (Table 2). Asymptomatic pine needles of P. taeda L. were collected in Athens (Georgia, USA), from disease-free areas and trees that had never before shown symptoms of BSNB or DNB, and used as a negative control.
2.2. DNA Extraction
All fungal cultures (Table 1) were grown on sterile cellophane in 90 mm Petri dishes containing 1.5% MEA (malt extract agar) and maintained in the dark at 17–22 °C according to species requirements [61]. After 7–15 days, approximately 80 mg (fresh weight) of mycelium from each species was obtained by scraping off the mycelia from the cellophane surface. Total DNA was extracted using the E.Z.N.A.® Fungal DNA mini Kit (Omega, Bio-tek, Norcross, GA, USA), following the manufacturer’s directions and concentrations measured using a QubitTM Fluorometer (InvitrogenTM, Carlsbad, CA, USA). For the extraction of DNA directly from pine needles, 2–3 needles per sample were cut in 5-mm-long pieces in which were included both symptomatic (yellow/red/brown bands and/or fruiting bodies depending on the sample) and asymptomatic (green) parts of the needle. These were then ground into a fine powder using liquid nitrogen and a sterilized mortar and pestle, and 50 mg (fresh weight) was used for extraction using the DNAeasy® PowerPlant® Pro Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.
2.3. LAMP Primers and Probes Design
All available sequences of the elongation factor (EF1- α) and beta-tubulin (β-tub2) genes belonging to L. acicola, D. pini and D. septosporum described in [46,62,63] were retrieved from GenBank (NCBI) and compared with species reported as being phylogenetically closely related, using the multiple alignment server T-COFFEE (online access https://tcoffee.vital-it.ch/apps/tcoffee/index.html accessed on 8 March 2021) with default parameters. Sequence regions containing the highest genetic variability between target species and phylogenetically related fungi, but in which single nucleotide polymorphisms (SNPs) among individuals of the same target species were not present, were selected for primer design. Sets of six LAMP primers were designed for each pathogen using Primer Explorer (V.4, Eiken Chemicals, Tokyo, Japan, http://primerexplorer.jp/e/ accessed on 8 March 2021), following the specifications of [49,51]. The primer sets each consisted of the four primers necessary for amplification, and loop primers to enhance reaction rate and specificity. Primers were designed to target the beta-tubulin (β-tub2) gene of D. septosporum (GenBank Acc. No. FJ467298) and D. pini (GenBank Acc. No. FJ467304), and the elongation-factor (EF-1α) gene of L. acicola (GenBank Acc. No. KJ938441). Of the multiple primer sets generated by the software, those displaying strong mismatches at the 3′ end [64] between the targets and genetically related species were selected. The most specific of each loop primer was selected for each LAMP assay and used to design a sequence-specific assimilating probe for each target species following [65]. FAM (6-carboxyfluorescein) fluorescent strands of each assimilating probe were designed against the backward loop primer for D. pini, and against the forward loop primers for D. septosporum and L. acicola. Quencher strands were retrieved from [65]. All primers and probes were synthesized by either Eurofins Genomics (GmbH, Ebersberg, Germany) or Integrated DNA Technologies (IDT, Coralville, IA, USA) and are reported in Table 3.
2.4. LAMP Reactions
LAMP reactions were performed and optimized in three different laboratories at the University of Florence (Italy), the University of Georgia (United States) and FABI at the University of Pretoria (South Africa) on a Bio-Rad® iCycler Real-time system (BioRad, Hercules, CA, USA), a StepOnePlusTM Real-Time PCR System (Applied BiosystemsTM, Foster City, CA, USA) and a Bio-Rad® CFX 96 Real-Time System (BioRad), respectively. DNA samples were amplified for 35 min in MicroAmp® Fast Reaction Tubes (Applied BiosystemsTM) strips at 65 °C, measuring fluorescence values in real-time every 30 s. Each reaction was terminated with a denaturing step at 85 °C for 5 min. Except where otherwise stated, each isothermal amplification was performed in duplicate in a final volume of 25 µL. The reaction mixture contained 15 μL Isothermal Master Mix (ISO-001nd) (OptiGene Limited, Horsham, UK), 3.05 μL LAMP primer mixture (at final concentrations of 0.28 μM of each F3 and B3, 0.8 μM of Loop primer without probe and 2.8 μM of each FIP and BIP), 0.6 µL of probe mixture (at final concentrations of 0.08 μM for each fluorescent strand and 0.12 μM for the quencher strand), 1.35 μL water (molecular biology grade, Fisher BioReagentsTM, Pittsburgh, PA, USA) and 5 μL of template DNA. For each run, two no-template controls (NTC), in which 5 μL of water were used instead of DNA, were included. The limit of detection of each LAMP assay was determined by testing in triplicate an 11-fold 1:5 serial dilution of target DNA template (ranging from 10 ng μL−1 to 0.001 pg μL−1) for each target species (isolates CV2019013-L. acicola, CMW 29366-D. pini, WC27 Needle 1 Taiga 626-D. septosporum). The same points of DNA dilution retrieved from the same tubes used for LAMP sensitivity tests were also processed for comparison with a qPCR protocol specific for the same three target species [46] as a gold standard. qPCR reactions were performed at a final volume of 20 µL. The reaction mixture contained 1x DreamTaq Green Buffer (Thermo Scientific, Waltham, MA, USA), 2 × 0.2 mM each dNTP (Thermo Scientific), 2.5 μM each of the two respective forward and reverse primers, 0.2 μM of the respective dual-labeled probe, 1 U DreamTaq polymerase (Thermo Scientific), 1 μL of template DNA and water to reach the final volume. Each run included two NTCs and a positive control using the DNA of the target species. The real-time PCR cycling conditions included an initial denaturation step at 95 °C for 10 min followed by 40 cycles of denaturation at 95 °C for 15 s, and annealing and elongation at 60 °C for 55 s. The specificity of each LAMP assay was tested against the genomic DNA extracted from all the fungal strains reported in Table 1, each at a final concentration of 2 ng μL−1.
2.5. Detection on Naturally Infected Pine Needle Samples
In order to assess the performance of each LAMP assay on naturally infected plant tissue, DNA samples extracted from symptomatic needles (Table 2) were tested with all three primer sets (Table 3). The DNA samples were also processed for comparison with the gold-standard qPCR assay [46] described above, following the same protocol and conditions.
3. Results
3.1. LAMP Specificity and Sensitivity
Each LAMP assay demonstrated consistent amplification for all fungal isolates of its corresponding target species, regardless of their geographic origin (Table 1). No amplifications were observed for the non-target species tested by any of the three LAMP primer sets (Table 1). Positive reactions were visible starting at approximately 10 min for each target species (Figure 1; Table 4). Testing serially diluted DNA extracts, the detection limits of each LAMP assay were determined to be 0.128 pg μL−1 for L. acicola, 3.2 pg μL−1 for D. septosporum, and 0.64 pg μL−1 for D. pini (Table 4). The detection limit of the qPCR using the protocol of [46] was 0.128 pg μL−1 for all of the three species, taking an hour and 30 min to complete the analysis (Table 4).
3.2. Detection on Naturally Infected Pine Needles Samples
Positive amplifications were obtained from both pine needles samples bearing fungal conidiomata and from the ones showing only incipient symptoms (Table 2). All results obtained with the LAMP assays were consistent with those of the qPCR assays developed by [46]. No amplification was observed when testing the DNA of asymptomatic pine needles (Figure 1; Table 2).
4. Discussion
For notifiable pathogens, molecular diagnostic methods that enhance the rapid, accurate identification and interception of infected specimens are crucial to preventing their introduction and spread, especially in the case of morphologically similar species such as L. acicola, D. pini and D. septosporum. The LAMP-based assays developed in this work were capable of rapidly identifying these three pathogens in less than 30 min (Figure 1); a substantial improvement compared to the currently available DNA-based diagnostics for these species [45,46,47,48]. These assays also have the potential to be deployable in-field, directly at point-of-care with the use of portable devices developed for supporting LAMP reactions (e.g., Genie® II and III by OptiGene Limited, Horsham, UK) [55,56,59]. To the best of our knowledge, there are no published LAMP-based assays targeting L. acicola and D. pini, while for D. septosporum a LAMP-based assay has been recently published [60].
The LAMP assays demonstrated high specificity, with each test amplifying only the DNA of its respective target species (Table 1). This result was in part aided by the use of loop primers to enable probe-based detection [65], which further reduces the possibility of nonspecific binding. Positive amplification was observed for all tested target strains of each target species, belonging to different mating types and from different geographic origins, showing that the protocol is robust and that geographic variability in target fungi does not affect LAMP primer binding amplification. This indicates that each assay can be implemented across the world without the risk of losing specificity. However, it is noteworthy that the Dothistroma and Lecanosticta species are known to reproduce both asexually and sexually [32,66], reflecting the possibility of genetic recombination and thus the emergence of new haplotypes among their populations [33,34,36]. The emergence of new haplotypes could, in future, interfere with the function of the LAMP assay. We hence recommend that the specificity of the assays is re-confirmed intermittently, as it is good practice for every molecular diagnostic assay targeting sexually reproducing organisms. In addition, LAMP specificity should also be tested when new strains on new hosts and in new areas are discovered.
The detection limit of the assays was found to be 0.128 pg μL−1 for L. acicola, 0.64 pg μL−1 for D. pini and 3.2 pg μL−1 for D. septosporum. The detection limit for L. acicola is comparable to that of the qPCR assay developed by [46], which is adopted by the EPPO as the official tool for the diagnosis for these fungal species [1]. However, for both Dothistroma species, the qPCR method showed higher sensitivity than the LAMP assays, which nevertheless were sensitive enough to detect the target fungal species directly from host tissues (Table 2; Figure 1), including those from samples showing only incipient symptoms. With regard to the tests using needle samples, all results of the LAMP assays were consistent with those obtained with the qPCR method [46], further demonstrating the high specificity and efficiency of the developed assays. It is also worth noting that the LAMP assays developed in this study have been validated on different equipment in three different laboratories across three different continents, ensuring repeatability of the assays, which is a coveted attribute for molecular diagnostic approaches.
Future work should focus on the possibility for the LAMP assays to confirm the presence of L. acicola, D. pini and D. septosporum even before the development of any symptoms, hence testing the efficacy of the assays to detect latent infections. Efforts should also be directed toward validating the developed assays for use at point-of-care on portable devices and using crude DNA extracts, as this has already been successfully performed in numerous pathosystems, including forest pests and pathogen species such as Heterobasidion irregulare Garbel and Otrosina, Hymenoscyphus fraxineus (T. Kowalski) Baral, Queloz and Hosoya, Phytophthora spp, Raffaelea lauricola Harrington, Fraedrich and Aghayeva, Xylella fastidiosa Wells, Raju, Hung, Weisburg, Parl and Beemer, Ceratocystis spp., and Fusarium spp. [54,56,57,58,59].
5. Conclusions
In many parts of the world, Dothistroma and Lecanosticta needle blights are spreading in pine plantations and natural forests over larger areas, showing a general increase in the severity of symptoms and causing increasing damage to local economies, ecosystem functionality and landscapes. In order to avoid further spread of the pathogen to disease-free areas, or the introduction of a second species or new, more virulent genotypes in areas already infected by one of these pathogens, it is critical to implement strict and efficient surveillance measures. It is well-established that the main and riskiest route of medium- to long-distance spread of these fungi is commercial trade and the movement of infected plant material [67], a pathway that is crucial to inspect with maximum efficiency [29,67]. Easy-to-use specific and sensitive diagnostic methods that provide rapid results and that can be used on small portable instruments directly at the points of entry and in the field, such as the LAMP assays developed in this work, which also require minimal training [53,68], would make phytosanitary controls of live plants or plant parts easier and more effective. This would allow for immediate management decisions to be made, and the necessary measures to contain risk and prevent further damage to be applied more quickly and efficiently.
Author Contributions
Conceptualization, C.A., L.G., I.B. and C.V.; Data curation, C.A. and C.V.; Formal analysis, C.A. and C.V.; Funding acquisition, L.G. and C.V.; Methodology, C.A., C.D.M., L.G., A.v.d.N. and C.V.; Supervision, L.G., I.B. and C.V.; Validation, C.D.M., I.B. and A.v.d.N.; Writing—original draft, C.A. and C.V.; Writing—review & editing, C.D.M., L.G., I.B. and A.v.d.N. All authors have read and agreed to the published version of the manuscript. Authorship must be limited to those who have contributed substantially to the work reported.
Funding
Part of this work was funded by the project “Holistic management of emerging forest pests and diseases” (HOMED) a European Union’s Horizon 2020 Programme for Research & Innovation under grant agreement No 771271 to LG. The rest of the work was funded by state and federal funds appropriated to the Warnell School of Forestry and Natural Resources, University of Georgia.
Acknowledgments
The authors wish to thank the colleagues who kindly provided DNA of infected pine needles and fungal strains or cultures used in this study: Renate Heinzelmann and Richard Hamelin (University of British Columbia, Canada), Barbara Wong (Université Laval, Canada), Rein Drenkhan (Estonian University of Life sciences, Estonia), Barbara Piškur (Slovenian Forestry Institute, Slovenia), Josef Janoušek (Phytophthora Research Center, Mendel University in Brno, Brno, Czech Republic). We want to thank Paolo Capretti, Maria Teresa Ceccherini and Guido Marchi (University of Florence, Italy) for providing guidance in the early stages of the experimental planning, and part of the laboratory supplies and equipment.
Conflicts of Interest
The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.
References
- Pehl, L.; Cech, T.L.; Ioos, R. Lecanosticta acicola (formerly Mycosphaerella dearnessii), Dothistroma septosporum (formerly Mycosphaerella pini) and Dothistroma pini. EPPO Bull. 2015, 45, 163–182. [Google Scholar]
- Gibson, I.A.S. Dothistroma Blight of Pinus radiata. Annu. Rev. Phytopathol. 1972, 10, 51–72. [Google Scholar] [CrossRef]
- De Urbina, E.O.; Mesanza, N.; Aragonés, A.; Raposo, R.; Elvira-Recuenco, M.; Boqué, R.; Patten, C.; Aitken, J.; Iturritxa, E. Emerging Needle Blight diseases in Atlantic Pinus ecosystems of Spain. Forests 2016, 8, 18. [Google Scholar] [CrossRef] [Green Version]
- Ivory, M. Resistance to Dothistroma needle blight induced in Pinus radiata by maturity and shade. Trans. Br. Mycol. Soc. 1972, 59, 205–212. [Google Scholar] [CrossRef]
- Rodas, C.A.; Wingfield, M.J.; Granados, G.M.; Barnes, I. Dothistroma needle blight: An emerging epidemic caused by Dothistroma septosporum in Colombia. Plant Pathol. 2016, 65, 53–63. [Google Scholar] [CrossRef]
- EPPO Lecanosticta acicola (SCIRAC), Categorization. EPPO Global Database. 2021. Available online: https://gd.eppo.int/taxon/SCIRAC/categorization (accessed on 18 February 2021).
- EPPO Dothistroma septosporum (SCIRPI), Categorizasion. EPPO Global Database. 2021. Available online: https://gd.eppo.int/taxon/SCIRPI/categorization (accessed on 18 February 2021).
- EPPO Dothistroma pini (DOTSPI), Categorization. EPPO Global Database. 2021. Available online: https://gd.eppo.int/taxon/DOTSPI/categorization (accessed on 18 February 2021).
- European Parliament; Council of the European Union. EU Regulation 2016/2031 of the European Parliament and the Council on protective measures against pests of plants. Off. J. EU 2016, 317, 4–104. Available online: http://eur-lex.europa.eu/legal-content/EN/TXT/?uri=CELEX:32016R2031 (accessed on 8 March 2021).
- European Commission, Directorate-General for Health and Food Safety. Commission Implementing Regulation (EU) 2019/2072 of 28 November 2019 establishing uniform conditions for the implementation of Regulation (EU) 2016/2031 of the European Parliament and the Council, as regards protective measures against pests of plants, and repealing Commission Regulation (EC) No 690/2008 and amending Commission Implementing Regulation (EU) 2018/2019. Off. J. EU 2019, 319, 1. Available online: https://eur-lex.europa.eu/legal-content/EN/TXT/?uri=celex%3A32019R2072 (accessed on 8 March 2021).
- Drenkhan, R.; Tomešová-Haataja, V.; Fraser, S.; Bradshaw, R.E.; Vahalík, P.; Mullett, M.S.; Martín-García, J.; Bulman, L.S.; Wingfield, M.J.; Kirisits, T.; et al. Global geographic distribution and host range of Dothistroma species: A comprehensive review. For. Pathol. 2016, 46, 408–442. [Google Scholar] [CrossRef]
- Siggers, P.V. The brown-spot needle blight of longleaf pine seedlings. J. Forest. 1932, 30, 579–593. [Google Scholar] [CrossRef]
- Martinez, J.B. The mycoses of Pinus insignis in Guipúzcoa. Publ. Inst. For. Investig. Exp. 1942, 13, 1–72. [Google Scholar]
- Van Der Nest, A.; Wingfield, M.J.; Janoušek, J.; Barnes, I. Lecanosticta acicola: A growing threat to expanding global pine forests and plantations. Mol. Plant. Pathol. 2019, 20, 1327–1364. [Google Scholar] [CrossRef] [Green Version]
- Markovskaja, S.; Raitelaitytė, K.; Kačergius, A.; Kolmakov, P.; Vasilevich, V. Occurrence of Dothistroma needle blight in Lithuania and Belarus: The risk posed to native Scots Pine forests. For. Pathol. 2020, 50, e12626. [Google Scholar] [CrossRef]
- Mullett, M.S.; Adamson, K.; Bragança, H.; Bulgakov, T.S.; Georgieva, M.; Henriques, J.; Jürisoo, L.; Laas, M.; Drenkhan, R. New country and regional records of the pine needle blight pathogens Lecanosticta acicola, Dothistroma septosporum and Dothistroma pini. For. Pathol. 2018, 48, e12440. [Google Scholar] [CrossRef]
- Piškur, B.; Hauptman, T.; Jurc, D. Dothistroma Needle Blight in Slovenia is caused by two cryptic species: Dothistroma pini and Dothistroma septosporum. For. Pathol. 2013, 43, 518–521. [Google Scholar] [CrossRef]
- Piou, D.; Ioos, R. First report of Dothistroma pini, a recent agent of the Dothistroma Needle Blight, on Pinus radiata in France. Plant. Dis. 2014, 98, 841. [Google Scholar] [CrossRef]
- Ghelardini, L.; Aglietti, C.; Loria, F.; Cerboneschi, M.; Gionni, A.; Maresi, G.; Moricca, S.; Marchi, G. Dothistroma needle blight in protected pine forests in Italy. Manag. Biol. Invasions 2020, 11, 689–702. [Google Scholar] [CrossRef]
- Oskay, F.; Laas, M.; Mullett, M.; Lehtijärvi, A.; Doğmuş-Lehtijärvi, H.T.; Woodward, S.; Drenkhan, R. First report of Lecanosticta acicola on pine and non-pine hosts in Turkey. For. Pathol. 2020, 50, 12654. [Google Scholar] [CrossRef]
- Mesanza, N.; Raposo, R.; Elvira-Recuenco, M.; Barnes, I.; van der Nest, A.; Hernández, M.; Pascual, M.T.; Barrena, I.; Martín, U.S.; Cantero, A.; et al. New hosts for Lecanosticta acicola and Dothistroma septosporum in newly established arboreta in Spain. For. Pathol. 2021, 51. [Google Scholar] [CrossRef]
- Drenkhan, R.; Adamson, K.; Jürimaa, K.; Hanso, M. Dothistroma septosporum on firs (Abies spp.) in the northern Baltics. For. Pathol. 2014, 44, 250–254. [Google Scholar] [CrossRef]
- Lang, V.K.J. Dothistroma pini an jungen Fichten (Picea abies). For. Pathol. 1987, 17, 316–317. [Google Scholar] [CrossRef]
- Mullett, M.; Fraser, S. Infection of Cedrus species by Dothistroma septosporum. For. Pathol. 2015, 46, 551–554. [Google Scholar] [CrossRef]
- Woods, A.; Coates, K.D.; Hamann, A. Is an unprecedented Dothistroma needle blight epidemic related to climate change? Bioscience 2005, 55, 761–769. [Google Scholar] [CrossRef] [Green Version]
- Watt, M.S.; Kriticos, D.J.; Alcaraz, S.; Brown, A.V.; Leriche, A. The hosts and potential geographic range of Dothistroma needle blight. For. Ecol. Manag. 2009, 257, 1505–1519. [Google Scholar] [CrossRef]
- Woods, A.J.; Martín-García, J.; Bulman, L.; Vasconcelos, M.W.; Boberg, J.; La Porta, N.; Peredo, H.; Vergara, G.; Ahumada, R.; Brown, A.; et al. Dothistroma needle blight, weather and possible climatic triggers for the disease’s recent emergence. For. Pathol. 2016, 46, 443–452. [Google Scholar] [CrossRef] [Green Version]
- Barnes, I.; Wingfield, M.J.; Carbone, I.; Kirisits, T.; Wingfield, B.D. Population structure and diversity of an invasive pine needle pathogen reflects anthropogenic activity. Ecol. Evol. 2014, 4, 3642–3661. [Google Scholar] [CrossRef]
- Bulman, L.S.; Bradshaw, R.E.; Fraser, S.D.; Martín-García, J.; Barnes, I.; Musolin, D.L.; La Porta, N.; Woods, A.J.; Diez-Casero, J.; Koltay, A.; et al. A worldwide perspective on the management and control of Dothistroma needle blight. For. Pathol. 2016, 46, 472–488. [Google Scholar] [CrossRef] [Green Version]
- Capron, A.; Feau, N.; Heinzelmann, R.; Barnes, M.I.; Benowicz, A.; Bradshaw, R.E.; Dale, A.L.; Lewis, K.J.; Owen, T.J.; Reich, R.; et al. Signatures of post-glacial genetic isolation and human-driven migration in the Dothistroma needle Blight pathogen in Western Canada. Phytopathology 2021, 111, 116–127. [Google Scholar] [CrossRef] [PubMed]
- Mullett, M.; Drenkhan, R.; Adamson, K.; Boroń, P.; Lenart-Boroń, A.; Barnes, I.; Tomšovský, M.; Jánošíková, Z.; Adamčíková, K.; Ondrušková, E.; et al. Worldwide genetic structure elucidates the Eurasian origin and invasion pathways of Dothistroma septosporum, causal agent of Dothistroma Needle Blight. J. Fungi 2021, 7, 111. [Google Scholar] [CrossRef]
- Dale, A.L.; Lewis, K.J.; Murray, B.W. Sexual reproduction and gene flow in the pine pathogen Dothistroma septosporum in British Columbia. Phytopathology 2011, 101, 68–76. [Google Scholar] [CrossRef] [Green Version]
- Sadiković, D.; Piškur, B.; Barnes, I.; Hauptman, T.; Diminić, D.; Wingfield, M.J.; Jurc, D. Genetic diversity of the pine pathogen Lecanosticta acicola in Slovenia and Croatia. Plant. Pathol. 2019, 68, 1120–1131. [Google Scholar] [CrossRef]
- Drenkhan, R.; Hantula, J.; Vuorinen, M.; Jankovský, L.; Müller, M.M. Genetic diversity of Dothistroma septosporum in Estonia, Finland and Czech Republic. Eur. J. Plant. Pathol. 2012, 136, 71–85. [Google Scholar] [CrossRef]
- Feau, N.; Ramsfield, T.D.; Myrholm, C.L.; Tomm, B.; Cerezke, H.F.; Benowicz, A.; Samis, E.; Romano, A.; Dale, A.L.; Capron, A.; et al. DNA-barcoding identification of Dothistroma septosporum on Pinus contorta var. latifolia, P. banksiana and their hybrid in northern Alberta, Canada. Can. J. Plant. Pathol. 2020, 1–8. [Google Scholar] [CrossRef]
- Bradshaw, R.E.; Sim, A.D.; Chettri, P.; Dupont, P.; Guo, Y.; Hunziker, L.; McDougal, R.L.; Van Der Nest, A.; Fourie, A.; Wheeler, D.; et al. Global population genomics of the forest pathogen Dothistroma septosporum reveal chromosome duplications in high dothistromin-producing strains. Mol. Plant. Pathol. 2019, 20, 784–799. [Google Scholar] [CrossRef] [Green Version]
- Fisher, M.C.; Henk, D.A.; Briggs, C.J.; Brownstein, J.S.; Madoff, L.C.; McCraw, S.L.; Gurr, S.J. Emerging fungal threats to animal, plant and ecosystem health. Nature 2012, 484, 186–194. [Google Scholar] [CrossRef] [PubMed]
- Lau, H.Y.; Botella, J.R. Advanced DNA-based point-of-care diagnostic methods for plant diseases detection. Front. Plant. Sci. 2017, 8, 2016. [Google Scholar] [CrossRef] [PubMed]
- Barnes, I.; Van Der Nest, A.; Mullett, M.S.; Crous, P.W.; Drenkhan, R.; Musolin, D.L.; Wingfield, M.J. Neotypification of Dothistroma septosporum and epitypification of D. pini, causal agents of Dothistroma needle blight of pine. For. Pathol. 2016, 46, 388–407. [Google Scholar] [CrossRef]
- Millberg, H.; Hopkins, A.J.M.; Boberg, J.; Davydenko, K.; Stenlid, J. Disease development of Dothistroma needle blight in seedlings of Pinus sylvestris and Pinus contorta under Nordic conditions. For. Pathol. 2015, 46, 515–521. [Google Scholar] [CrossRef]
- Moraal, L.G. Bionomics of Haematoloma dorsatum (Hom., Cercopidae) in relation to needle damage in pine forests. Anzeiger für Schädlingskunde Pflanzen und Umweltschutz 1996, 69, 114–118. [Google Scholar] [CrossRef]
- Covassi, M.; Roversi, P.F.; Toccafondi, P. Danni da Haematoloma dorsatum (Ahrens) su conifere (Homoptera, Cercopidae). I. Alterazioni macroscopiche degli apparati fogliari. [Damages caused by Haematoloma dorsatum (Ahrens) on conifers. I. Macro-scopical alterations of leaves]. J. Zool. 1989, 72, 259–275. [Google Scholar]
- Castro-Valderrama, U.; Romero-Nápoles, J.; Peck, D.C.; Valdez-Carrasco, J.M.; Llanderal-Cázares, C.; Bravo-Mojica, H.; Hernández-Rosas, F.; Cibrián-Llanderal, V.D. First report of spittlebug species (Hemiptera: Cercopidae) associated with Pinus species (Pinaceae) in Mexico. Fla. Èntomol. 2017, 100, 206–208. [Google Scholar] [CrossRef]
- Matsiakh, I.; Avtzis, D.N.; Adamson, K.; Augustin, S.; Beram, R.C.; Cech, T.; Drenkhan, R.; Kirichenko, N.; Maresi, G.; Morales-Rodríguez, C.; et al. Damage to foliage of coniferous woody plants. In Field Guide for the Identification of Damage on Woody Sentinel Plants; Roques, A., Cleary, M., Matsiakh, I., Eschen, R., Eds.; CABI Publishing: Wallingford, UK, 2017; pp. 167–188. [Google Scholar] [CrossRef]
- Groenewald, M.; Barnes, I.; Bradshaw, R.E.; Brown, A.V.; Dale, A.; Groenewald, J.Z.; Lewis, K.J.; Wingfield, B.D.; Wingfield, M.J.; Crous, P.W. Characterization and distribution of mating type genes in the Dothistroma needle blight pathogens. Phytopathology 2007, 97, 825–834. [Google Scholar] [CrossRef] [Green Version]
- Ioos, R.; Fabre, B.; Saurat, C.; Fourrier, C.; Frey, P.; Marçais, B. Development, comparison, and validation of real-time and conventional PCR tools for the detection of the fungal pathogens causing Brown Spot and Red Band Needle Blights of Pine. Phytopathology 2010, 100, 105–114. [Google Scholar] [CrossRef] [Green Version]
- Langrell, S.R.H. Nested polymerase chain reaction–based detection of Dothistroma septosporum, red band needle blight of pine, a tool in support of phytosanitary regimes. Mol. Ecol. Resour. 2011, 11, 749–752. [Google Scholar] [CrossRef] [PubMed]
- Janousek, J.; Krumböck, S.; Kirisits, T.; Bradshaw, R.E.; Barnes, I.; Jankovský, L.; Stauffer, C. Development of microsatellite and mating type markers for the pine needle pathogen Lecanosticta acicola. Australas. Plant. Pathol. 2014, 43, 161–165. [Google Scholar] [CrossRef] [Green Version]
- Notomi, T.; Okayama, H.; Masubuchai, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, 63. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nagamine, K.; Hase, T.; Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell. Probes 2002, 16, 223–229. [Google Scholar] [CrossRef] [PubMed]
- Kaneko, H.; Kawana, T.; Fukushima, E.; Suzutani, T. Tolerance of loop-mediated isothermal amplification to a culture medium and biological substances. J. Biochem. Biophys. Methods 2007, 70, 499–501. [Google Scholar] [CrossRef] [PubMed]
- Mikita, K.; Maeda, T.; Yoshikawa, S.; Ono, T.; Miyahira, Y.; Kawana, A. The Direct Boil-LAMP method: A simple and rapid diagnostic method for cutaneous leishmaniasis. Parasitol. Int. 2014, 63, 785–789. [Google Scholar] [CrossRef] [PubMed]
- Tomlinson, J.A.; Ostoja-Starzewska, S.; Webb, K.; Cole, J.A.; Barnes, A.V.; Dickinson, M.; Boonham, N. A loop-mediated isothermal amplification-based method for confirmation of Guignardia citricarpa in citrus black spot lesions. Eur. J. Plant. Pathol. 2013, 136, 217–224. [Google Scholar] [CrossRef]
- Hamilton, J.L.; Workman, J.N.; Nairn, C.J.; Fraedrich, S.W.; Villari, C. Rapid detection of Raffaelea lauricola directly from host plant and beetle vector tissues using loop-mediated isothermal amplification. Plant. Dis. 2020, 104, 3151–3158. [Google Scholar] [CrossRef]
- Njiru, Z.K. Loop-mediated isothermal amplification technology: Towards point of care diagnostics. PLoS Negl. Trop. Dis. 2012, 6, e1572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aglietti, C.; Luchi, N.; Pepori, A.L.; Bartolini, P.; Pecori, F.; Raio, A.; Capretti, P.; Santini, A. Real-time loop-mediated isothermal amplification: An early-warning tool for quarantine plant pathogen detection. AMB Express 2019, 9, 50. [Google Scholar] [CrossRef] [PubMed]
- Qiu, X.; Ye, J.; Zhang, L. The application prospect of loop-mediated isothermal amplification method in forest disease detection. J. Nanjing For. Univ. (Nat. Sci. Ed.) 2012, 36, 135–139. [Google Scholar]
- Sillo, F.; Giordano, L.; Gonthier, P. Fast and specific detection of the invasive forest pathogen Heterobasidion irregulare through a Loop-mediated isothermal AMPlification (LAMP) assay. For. Pathol. 2017, 48, e12396. [Google Scholar] [CrossRef]
- Stehlíková, D.; Luchi, N.; Aglietti, C.; Pepori, A.L.; Diez, J.J.; Santini, A. Real-time loop-mediated isothermal amplification assay for rapid detection of Fusarium circinatum. Biotechniques 2020, 69, 11–17. [Google Scholar] [CrossRef] [PubMed]
- Myrholm, C.; Tomm, B.; Heinzelmann, R.; Feau, N.; Hamelin, R.; McDougal, R.; Winkworth, R.; Ramsfield, T. Development of a rapid loop-mediated isothermal amplification assay for the detection of Dothistroma septosporum. Forests 2021, 12, 362. [Google Scholar] [CrossRef]
- Mullett, M.S.; Barnes, I. Dothistroma isolation and molecular identification methods. In COST ACTION FP1102 Determining Invasiveness and Risk of Dothistroma; Training School Detection and Diagnostics of Dothistroma: Brno, Czech Republic, 2012. Available online: https://www.forestresearch.gov.uk/documents/305/DIAROD_052012_Isolation_and_indentification_97fNCCI.pdf (accessed on 9 March 2021).
- Quaedvlieg, W.; Groenewald, J.; Yáñez-Morales, M.D.J.; Crous, P. DNA barcoding of Mycosphaerella species of quarantine importance to Europe. Pers. Mol. Phylogeny Evol. Fungi 2012, 29, 101–115. [Google Scholar] [CrossRef] [Green Version]
- Van der Nest, A.; Wingfield, M.J.; Ortiz, P.C.; Barnes, I. Biodiversity of Lecanosticta pine-needle blight pathogens suggests a Mesoamerican centre of origin. IMA Fungus 2019, 10, 1–28. [Google Scholar] [CrossRef]
- Kwok, S.; Kellogg, D.E.; McKinney, N.; Spasic, D.; Goda, L.; Levenson, C.; Sninsky, J.J. Effects of primer-template mismatches on the polymerase chain reaction: Human immunodeficiency virus type 1 model studies. Nucleic Acids Res. 1990, 18, 999–1005. [Google Scholar] [CrossRef]
- Kubota, R.; Alvarez, A.M.; Su, W.W.; Jenkins, D.M. FRET-based assimilating probe for sequence-specific real-time monitoring of loop-mediated isothermal alification (LAMP). Biol. Eng. Trans. 2011, 4, 81–100. [Google Scholar] [CrossRef]
- Laas, M.; Adamson, K.; Drenkhan, R. A look into the genetic diversity of Lecanosticta acicola in northern Europe. Fungal Biol. 2019, 123, 773–782. [Google Scholar] [CrossRef] [PubMed]
- EFSA Panel on Plant Health (PLH). Scientific Opinion on the risk to plant health posed by Dothistroma septosporum (Dorog.) M. Morelet (Mycosphaerella pini E. Rostrup, syn. Scirrhia pini) and Dothistroma pini Hulbary to the EU territory with the identification and evaluation of risk reduct. EFSA J. 2013, 11, 3026. [Google Scholar] [CrossRef] [Green Version]
- Thiessen, L.D.; Keune, J.A.; Neill, T.M.; Turechek, W.W.; Grove, G.G.; Mahaffee, W.F. Development of a grower-conducted inoculum detection assay for management of grape powdery mildew. Plant. Pathol. 2016, 65, 238–249. [Google Scholar] [CrossRef]
Figure 1.
Selection of kinetics showing amplification results of the LAMP assays targeting Lecanosticta acicola (a), Dothistroma pini (b) and D. septosporum (c), respectively. Red solid lines represent DNA (2 ng uL−1) extracted from axenic cultures of the corresponding target species. Black solid lines represent DNA extracted from pine needles showing symptoms of the corresponding target species. Black dotted lines represent both DNA extracted from non-symptomatic pine needles and no-template controls.
Figure 1.
Selection of kinetics showing amplification results of the LAMP assays targeting Lecanosticta acicola (a), Dothistroma pini (b) and D. septosporum (c), respectively. Red solid lines represent DNA (2 ng uL−1) extracted from axenic cultures of the corresponding target species. Black solid lines represent DNA extracted from pine needles showing symptoms of the corresponding target species. Black dotted lines represent both DNA extracted from non-symptomatic pine needles and no-template controls.
Table 1.
Fungal isolates used to test the specificity of the Lecanosticta acicola, Dothistroma pini and D. septosporum species-specific loop-mediated isothermal amplification (LAMP) assays.
Table 1.
Fungal isolates used to test the specificity of the Lecanosticta acicola, Dothistroma pini and D. septosporum species-specific loop-mediated isothermal amplification (LAMP) assays.
| Fungal Species | Isolate ID (Mating Type) | Host | Locality | Collector/Collection | LAMP Detection Results | ||
|---|---|---|---|---|---|---|---|
| L. acicola Assay | D. pini Assay | D. septosporum Assay | |||||
| D. septosporum1 | DS 3212 (MAT2) | P. sylvestris | Võru County, Estonia | R. Drenkhan | - | - | + |
| D. septosporum1 | Ds 57 | P. contorta | Pärnu County, Estonia | R. Drenkhan | - | - | + |
| D. septosporum2 | DSEP_KC_19_Ne1_TAIGA_504 (MAT2) | P. contorta var. latifolia | British Columbia, Canada | R. Hamelin | - | - | + |
| D. septosporum2 | DSEP_CLG_22_TAIGA_601 (MAT1) | P. contorta var. latifolia | British Columbia, Canada | R. Hamelin | - | - | + |
| D. septosporum2 | DSEP_PGTIS_P3_P16_Ne2_TAIGA_460 (MAT1) | P. contorta var. latifolia | British Columbia, Canada | R. Hamelin | - | - | + |
| D. septosporum2 | DSEP_WC_27_Ne1_TAIGA_626 (MAT2) | P. contorta var. latifolia | British Columbia, Canada | R. Hamelin | - | - | + |
| D. septosporum2 | DSEP_FLNRO2_19M_Ne1_TAIGA_486 (MAT1) | P. contorta var. latifolia | British Columbia, Canada | R. Hamelin | - | - | + |
| D. septosporum2 | DSEP_SM_1_4_Ne1_TAIGA_484 (MAT2) | P. contorta var. latifolia | British Columbia, Canada | R. Hamelin | - | - | + |
| D. pini2 | CMW 10951 CBS 116487 | P. radiata | Michigan, USA | G. Adams | - | + | - |
| D. pini2 | CMW 37634 | P. cembra | North Dakota, USA | J. Walla | - | + | - |
| D. pini2 | CMW 37786 | P. nigra | Indiana, USA | J. Walla | - | + | - |
| D. pini2 | CMW 38037 | P. ponderosa | South Dakota, USA | J. Walla | - | + | - |
| D. pini2 | CMW 42947 | P. nigra subsp. pallasiana | Kherson, Ukraine | K. Davydenko | - | + | - |
| D. pini2 | CMW 43903 | P. nigra subsp. laricio | La Ferte Imbault, France | I. Barnes | - | + | - |
| D. pini2 | CMW 29366 | P. pallasiana | Tarasovsky, Russia | S.B. Timur | - | + | - |
| D. pini2 | CMW 37633 | P. ponderosa | North Dakota, USA | J. Walla | - | + | - |
| D. pini2 | CMW 41496 | P. nigra | France | I. Barnes | - | + | - |
| D. pini2 | CMW 50237 | Pinus sp. | Arkansas, USA | M.S. Mullett | - | + | - |
| D. pini2 | A10 | P. nigra | Ontario, Canada | S. McGowan | - | + | - |
| D. pini2 | A11 | P. nigra | Ontario, Canada | S. McGowan | - | + | - |
| D. pini2 | A12 | P. nigra | Ontario, Canada | S. McGowan | - | + | - |
| D. pini2 | A13 | P. nigra | Ontario, Canada | S. McGowan | - | + | - |
| D. pini2 | A14 | P. nigra | Ontario, Canada | S. McGowan | - | + | - |
| D. pini2 | A20 | P. nigra | Ontario, Canada | S. McGowan | - | + | - |
| D. pini1 | E18/63-6 | Pinus sp. | Slovenia | B. Piškur | - | + | - |
| L. acicola2 | CV2019013 | P. palustris | Georgia, USA | C. Villari | + | - | - |
| L. acicola1 | 8496 (MAT1) | P. sylvestris | Tartu County, Estonia | R. Drenkhan | + | - | - |
| L. acicola1 | B1599 (MAT1) | P. radiata | France | R. Ioos | + | - | - |
| L. acicola1 | B1569 (MAT11) | P. radiata | France | R. Ioos | + | - | - |
| L. acicola3 | CMW 45427 CBS 133791 | P. strobus | New Hampshire, USA | B. Ostrofsky | + | - | - |
| L. acicola3 | CMW 45428 CBS 322.33 | P. palustris | USA | P.V. Siggers | + | - | - |
| L. acicola3 | MX7 | P. halepensis | Nuevo León, Mexico | J.G. Marmolejo | + | - | - |
| L. brevispora3 | CMW 45424 CBS 133601 | Pinus sp. | Mexico | M. de Jesús Yáñez-Morales | - | - | - |
| L. brevispora3 | CMW 46502 | P. pseudostrobus | Chimaltenango, Guatemala | I. Barnes | - | - | - |
| L. gloeospora3 | CMW 42645 IMI 283812 | P. pseudostrobus | Nuevo León, Mexico | H.C. Evans | - | - | - |
| L. guatemalensis3 | CMW 42206 IMI 281598 | P. oocarpa | Guatemala | H.C. Evans | - | - | - |
| L. guatemalensis3 | CMW 43892 | P. oocarpa | Chiquimula, Guatemala | I. Barnes | - | - | - |
| L. jani3 | CMW 38958 CBS 144456 | P. oocarpa | Jalapa, Guatemala | I. Barnes | - | - | - |
| L. jani3 | CMW 48831 CBS 144447 | P. oocarpa | Alta Verapaz, Guatemala | I. Barnes | - | - | - |
| L. longispora3 | CMW 45429 CBS 133602 | Pinus sp. | Mexico | M. de Jesús Yáñez-Morales | - | - | - |
| L. longispora3 | CMW 45430 | Pinus sp. | Mexico | M. de Jesús Yáñez-Morales | - | - | - |
| L. pharomachri3 | CMW 37134 | P. tecunumanii | Baja Verapaz, Guatemala | I. Barnes | - | - | - |
| L. pharomachri3 | CMW 37136 CBS 144448 | P. tecunumanii | Baja Verapaz, Guatemala | I. Barnes | - | - | - |
| L. tecunumanii3 | CMW 46805 CBS 144450 | P. tecunumanii | Baja Verapaz, Guatemala | I. Barnes | - | - | - |
| L. tecunumanii3 | CMW 49403 CBS 144451 | P. tecunumanii | Baja Verapaz, Guatemala | I. Barnes | - | - | - |
| L. variabilis3 | CMW 42205 CBS144453 | P. caribaea | Santa Barbara, Honduras | H.C. Evans | - | - | - |
| L. variabilis3 | MX1 | P. arizonica var. stormiae | Nuevo León, Mexico | J.G. Marmolejo | - | - | - |
| Leptographium profanum2 | CV20170072 | P. taeda | Georgia, USA | C. Villari | - | - | - |
| Leptographium procerum2 | CV2017311 | P. taeda | Georgia, USA | C. Villari | - | - | - |
| Leptographium sp. 2 | CV20170049 | P. taeda | Georgia, USA | C. Villari | - | - | - |
| Rhizosphaera sp. 2 | CV2018024 | P. taeda | Georgia, USA | C. Villari | - | - | - |
| Cladosporium sp. 2 | CV2018023 | P. taeda | Georgia, USA | C. Villari | - | - | - |
| Alternaria tenuissima2 | CV2018022 | P. taeda | Georgia, USA | C. Villari | - | - | - |
| Dothideomycetes sp. 2 | CV2018020 | P. taeda | Georgia, USA | C. Villari | - | - | - |
| Leotiomycetes sp. 2 | CV2018019 | P. taeda | Georgia, USA | C. Villari | - | - | - |
| Nigrospora oryzae2 | CV2018018 | P. taeda | Georgia, USA | C. Villari | - | - | - |
| Lophodermium conigeum2 | CV2018002 | P. taeda | Georgia, USA | C. Villari | - | - | - |
| Lophodermium australe2 | CV2018001 | P. taeda | Georgia, USA | C. Villari | - | - | - |
1 Reactions performed at the Department of Agricultural, Food, Environmental and Forest Sciences and Technologies (DAGRI), University of Florence (Italy). 2 Reactions performed at the University of Georgia, Athens (United States). 3 Reactions performed at the Forestry and Agricultural Biotechnology (FABI), University of Pretoria (South Africa). CBS = Culture collection of the Westerdijk Fungal Biodiversity Institute, Centraalbureau voor Schimmelcultures, Royal Netherlands Academy of Arts and Sciences (KNAW), Utrecht, The Netherlands. CMW = Culture collection of FABI (University of Pretoria, South Africa). CV = Culture collection of Villari Lab, Warnell School of Forestry & Natural Resources, University of Georgia, Athens, Georgia, United States. IMI = The UK National Fungus collection, CABI Bioscience, Egham, UK.
Table 2.
Description of the pine needles samples tested with the three LAMP assays for the detection of Lecanosticta acicola, Dothistroma pini and D. septosporum, respectively, as well as with the qPCR assay described by [46]. LAMP results are shown as time of amplification (min) while qPCR results are shown as time of amplification (min) and cycle threshold (Ct). Negative result (-). Needles were classified as either fully symptomatic if they were discolored and bearing fruiting bodies (++), with incipient symptoms if they were only displaying discolored banding (+), or asymptomatic if they were displaying none of the above (N).
Table 2.
Description of the pine needles samples tested with the three LAMP assays for the detection of Lecanosticta acicola, Dothistroma pini and D. septosporum, respectively, as well as with the qPCR assay described by [46]. LAMP results are shown as time of amplification (min) while qPCR results are shown as time of amplification (min) and cycle threshold (Ct). Negative result (-). Needles were classified as either fully symptomatic if they were discolored and bearing fruiting bodies (++), with incipient symptoms if they were only displaying discolored banding (+), or asymptomatic if they were displaying none of the above (N).
| Plant Species | Locality | Symptoms on Needles | LAMP Results (min) [Total Reaction Time 35 min] | qPCR Results (min/Ct) [Total Reaction Time 1 h 30 min] | ||||
|---|---|---|---|---|---|---|---|---|
| L. acicola | D. pini | D. septosporum | L. acicola | D. pini | D. septosporum | |||
| Pinus cembra | Val Sarentino, Bolzano, Italy | + | - | - | 15 | - | - | 64/26.95 |
| P. cembra | Val Sarentino, Bolzano, Italy | + | - | - | 20 | - | - | 67/28.53 |
| P. cembra | Val Sarentino, Bolzano, Italy | + | - | - | - | - | - | - |
| P. mugo | Val Sarentino, Bolzano, Italy | + | - | - | - | - | - | - |
| P. mugo | Auronzo di Cadore, Belluno, Italy | ++ | - | - | 20 | - | - | 75/32.73 |
| P. mugo | Paluzza, Udine, Italy | ++ | 20 | - | - | 71/30.58 | - | - |
| P. mugo | Gardone, Brescia, Italy | + | - | - | - | - | - | - |
| P. nigra var. laricio | La Sila, Cosenza, Italy | + | - | - | 15 | - | - | 73/31.66 |
| P. nigra var. laricio | La Sila, Cosenza, Italy | ++ | - | - | 14 | - | - | 63/26.74 |
| P. palustris | Newton, Georgia, USA | + | 20 | - | - | 69/29.61 | - | - |
| P. palustris | Newton, Georgia, USA | ++ | 20 | - | - | 72/30.88 | - | - |
| P. palustris | Newton, Georgia, USA | + | 20 | - | - | 75/32.76 | - | - |
| P. radiata | La Sila, Cosenza, Italy | + | - | - | 12 | - | - | 67/28.71 |
| P. taeda | Athens, Georgia, USA | N | - | - | - | - | - | - |
| Pinus sp. | Slovenia | + | - | 20 | - | - | 71/30.45 | - |
| Pinus sp. | Slovenia | + | - | 20 | - | - | 72/31.33 | - |
| Pinus sp. | Slovenia | ++ | - | 15 | - | - | 62/25.90 | - |
| Pinus sp. | Slovenia | + | - | 20 | - | - | 70/29.90 | - |
| Pinus sp. | Slovenia | ++ | - | 15 | - | - | 65/27.54 | - |
Table 3.
Primers and probes used for the detection of Lecanosticta acicola, Dothistroma pini and D. septosporum using LAMP assays.
Table 3.
Primers and probes used for the detection of Lecanosticta acicola, Dothistroma pini and D. septosporum using LAMP assays.
| Primers | Sequence 5′->3′ |
|---|---|
| LAMP primers—Lecanosticta acicola | |
| La_F3 | GTACGCATGGGTCCTCGA |
| La_B3 | GAAATCACGGTGACCAGGAG |
| LA_FIP | CGTACAGTTACGTAATATGAGCGTGAGCGTGGTATC |
| LA_BIP | GGACTCTTCGCTGCCGCCCGATGACCTTTCACGGGTTA |
| LA_LoopB | TCGCTGTCGCAACACCC |
| LAMP primers—Dothistroma pini | |
| Dp_F3 | GTTGGGATGTATGTGGTGTTA |
| Dp_B3 | CTCCATCGACATCTCCAAGA |
| Dp_FIP | GAAGTAAACATTCAACCGCTCGCACTCGTGAAGAAAGCTTGTG |
| Dp_BIP | CGAGGTACGGACTTCACTTCACAGTAAAGTGATGCTGTGCTG |
| Dp_LoopF | CCTCGTATCTGCGAGTCTTC |
| LAMP primers—Dothistroma septosporum | |
| Ds_F3 | TTTCTGGCAGACCATTTCTG |
| Ds_B3 | ACGGCTCTTTCAAATGACTT |
| Ds_FIP | GTGCCTTCGTATCTGCATTTCATCCAGGACAGTATGTGGAATCC |
| Ds_BIP | CGAGAGCGACTGAGTGTCTATTTCGCATAGTGTTGAAGCACTGG |
| Ds_LoopB | GATGAGGTAGGTGCTCCTCT |
| Assimilating sequence-specific probes | |
| LA_LFPr 1—Lecanosticta acicola | FAM 2-ACGCTGAGGACCCGGATGCGAATGCGGATGCGGATGCCGAGGCGTTTCAAACTTCCACAGAG |
| DP_LBPr 1—Dothistroma pini | FAM 2-ACGCTGAGGACCCGGATGCGAATGCGGATGCGGATGCCGATTCCAGTGTGCTATGGCAAT |
| DS_LFPr 1—Dothistroma septosporum | FAM 2-ACGCTGAGGACCCGGATGCGAATGCGGATGCGGATGCCGAAGTACGAATCTGCATGACGC |
| Quencher strand 3 | TCGGCATCCGCATCCGCATTCGCATCCGGGTCCTCAGCGT-BHQ 4 |
1 The underlined fragment acts as a loop primer; 2 FAM = 6-carboxyfluorescein; 3 Quencher strand was designed as reported in [65]; 4 BHQ = Black HoleQuencher-1 (Biosearch Technologies, Novato, CA, USA).
Table 4.
Comparison of the sensitivity of the LAMP assays developed for the detection of Lecanosticta acicola, Dothistroma pini and D. septosporum, respectively, and the qPCR assay described by [46]. Tested DNA was obtained from axenic cultures of each target species. LAMP results are shown as time of amplification (min) while qPCR results are shown as time of amplification (min) and cycle threshold (Ct).
Table 4.
Comparison of the sensitivity of the LAMP assays developed for the detection of Lecanosticta acicola, Dothistroma pini and D. septosporum, respectively, and the qPCR assay described by [46]. Tested DNA was obtained from axenic cultures of each target species. LAMP results are shown as time of amplification (min) while qPCR results are shown as time of amplification (min) and cycle threshold (Ct).
| Target DNA Concentration (pg µL−1) | LAMP Results (min) [Total Reaction Time 35 min] | qPCR Results (min/Ct) [Total Reaction Time 1 h 30 min] | ||||
|---|---|---|---|---|---|---|
| L. acicola | D. pini | D. septosporum | L. acicola | D. pini | D. septosporum | |
| 10,000 | 10 | 10 | 10 | 40/15.10 | 37/13.51 | 42/16.23 |
| 2000 | 11 | 12 | 11 | 45/17.48 | 40/15.15 | 47/18.54 |
| 400 | 12 | 14 | 13 | 54/22.23 | 47/18.50 | 53/21.36 |
| 80 | 13 | 16 | 14 | 59/24.30 | 51/20.55 | 56/23.22 |
| 16 | 15 | 18 | 18 | 62/25.94 | 56/23.20 | 61/25.61 |
| 3.2 | 16 | 20 | 21 | 68/28.97 | 61/25.37 | 71/30.47 |
| 0.64 | 18 | 22 | - | 72/31.21 | 68/29.22 | 74/32.15 |
| 0.128 | 22 | - | - | 77/33.78 | 74/32.16 | 80/35.00 |
| 0.02 | - | - | - | - | - | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Aglietti, C.; Meinecke, C.D.; Ghelardini, L.; Barnes, I.; van der Nest, A.; Villari, C. Rapid Detection of Pine Pathogens Lecanosticta acicola, Dothistroma pini and D. septosporum on Needles by Probe-Based LAMP Assays. Forests 2021, 12, 479. https://doi.org/10.3390/f12040479
AMA Style
Aglietti C, Meinecke CD, Ghelardini L, Barnes I, van der Nest A, Villari C. Rapid Detection of Pine Pathogens Lecanosticta acicola, Dothistroma pini and D. septosporum on Needles by Probe-Based LAMP Assays. Forests. 2021; 12(4):479. https://doi.org/10.3390/f12040479
Chicago/Turabian StyleAglietti, Chiara, Colton D. Meinecke, Luisa Ghelardini, Irene Barnes, Ariska van der Nest, and Caterina Villari. 2021. "Rapid Detection of Pine Pathogens Lecanosticta acicola, Dothistroma pini and D. septosporum on Needles by Probe-Based LAMP Assays" Forests 12, no. 4: 479. https://doi.org/10.3390/f12040479
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
