Next Article in Journal
Effect of Lignin Modification of Recycled and Fresh Wood Fibers on Physical, Mechanical, and Thermal Properties of Fiberboard
Next Article in Special Issue
Urban–Rural Comparisons of Biogenic Volatile Organic Compounds and Ground-Level Ozone in Beijing
Previous Article in Journal
The Impact of Environmental Regulation on the Green Overall Factor Productivity of Forestry in the Yangtze River Economic Belt
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 14
Issue 10
10.3390/f14102005
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dynamic Physiological Responses of Cinnamomum camphora with Monoterpene Protection under High Temperature Shock

by
Yingying Wang
1,2,†,
Qixia Qian
3,†,
Haozhe Xu
1,2 and
Zhaojiang Zuo
1,2,*
1
Zhejiang Provincial Key Laboratory of Forest Aromatic Plants-based Healthcare Functions, Zhejiang A&F University, Hangzhou 311300, China
2
State Key Laboratory of Subtropical Silviculture, Zhejiang A&F University, Hangzhou 311300, China
3
College of Landscape Architecture, Zhejiang A&F University, Hangzhou 311300, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Forests 2023, 14(10), 2005; https://doi.org/10.3390/f14102005
Submission received: 2 September 2023 / Revised: 3 October 2023 / Accepted: 4 October 2023 / Published: 6 October 2023
(This article belongs to the Special Issue Advances in Plant VOCs and Their Ecological Functions)
Browse Figures
Versions Notes

Abstract

:
Monoterpenes can protect plants against high temperature, but the early events of protection are still unknown. In this study, the dynamic variations in reactive oxygen species metabolism, photosynthetic capacity, and related gene expression in linalool, eucalyptol, and camphor chemotypes of Cinnamomum camphora with and without monoterpene emission under 6 h high-temperature stress were investigated. With respect to the control (28 °C), 40 °C and Fos + 40 °C (fosmidomycin inhibited monoterpene biosynthesis under 40 °C) treatments increased H2O2 and thiobarbituric acid reactive substance levels in the three chemotypes, but without significant differences between the two treatments after 2 h. Compared with the 40 °C treatment, the Fos + 40 °C treatment further aggravated the increase after 4 h, with increases of 13.8%, 12.3%, and 12.3% in H2O2 levels as well as 16.5%, 17.4%, and 9.1% in thiobarbituric acid reactive substance levels, respectively, in linalool, eucalyptol, and camphor chemotypes. When the three chemotypes were treated with 40 °C and Fos + 40 °C, the ascorbic acid content was gradually decreased during the 2 h treatment. After 4 h, the Fos + 40 °C treatment further aggravated the decrease in ascorbic acid content, with decreases of 10.6%, 9.8%, and 20.1%, respectively, in the eucalyptol, linalool, and camphor chemotypes. This could be caused by the further down-regulation of the key gene GGP in antioxidant biosynthesis. Meanwhile, two genes (VTE3 and 4CL) in other non-enzymatic antioxidant formation were also further down-regulated in Fos + 40 °C treatment for 4 h. These might lead to the further increase in reactive oxygen species levels in Fos + 40 °C treatment lacking non-enzymatic antioxidants. The photosynthetic electron yield and transfer (φPo, Ψo and φEo) in the three chemotypes were significantly (p < 0.05) decreased under the 40 °C and Fos + 40 °C treatments for 0.5 h, and the photosynthetic rate was significantly (p < 0.05) decreased in the two treatments for 1 h. After 4 h, the Fos + 40 °C treatment aggravated the decrease, as the genes encoding the components of photosystem II (psbP and psbW) and ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcS and rbcL) were further down-regulated. These dynamic variations in the early events suggested that monoterpenes should act as signaling molecules to improve plant thermotolerance, as blocking monoterpene biosynthesis did not cause immediate effects on the physiological responses in contrast to the monoterpene-emitting plants during the 2 h high temperature stress, but resulted in serious damages after 4 h for suppressing related gene expression. This not only provides new proof for the isoprenoid thermotolerance mechanism by serving a signaling function, but also promotes the utilization of monoterpenes as anti-high-temperature agents, and the cultivation of high-temperature tolerance varieties with abundant monoterpene emission.

1. Introduction

High-temperature weather is becoming more and more serious due to the rising greenhouse gas emissions mainly from anthropogenic activities. High temperature not only impacts human health, but also jeopardizes agroforestry production by changing the phenological phase [1], damaging photosynthetic photosystems (PSI and PSII) and blocking photosynthetic electron yield and transfer [2,3], disrupting the cell membrane system [4], as well as causing secondary oxidative stress by triggering reactive oxygen species (ROS) accumulation [5,6].
Under high temperature, plants obviously increase their emission of volatile organic compounds (VOCs) to respond this stress [7,8,9,10]. Among these VOCs, terpenes are the primary type, with isoprene and monoterpenes as the major components and sesquiterpenes and diterpenes as the minor components [11,12]. For isoprene and monoterpenes, they are synthesized via the methylerythritol 4-phosphate pathway (MEP) [13,14]. Tobacco (Nicotiana tabacum) and Arabidopsis thaliana did not release isoprene, but the plants transferred into the isoprene synthase gene (ISPS) gradually increased isoprene emission with temperature elevation [11]. In tropical forest, the monoterpene emission rate was positively related to the temperature over one day and one year [15]. When Eucalyptus camaldulensis was treated with high temperature, an increase was found in the emission of isoprene and monoterpenes [16]. Under high temperature, Salvia officinalis and grapevine (Vitis vinifera) improved monoterpene emission by up-regulating expression of the genes in the MEP pathway and monoterpene synthases [17,18].
It is well known that terpene VOCs play important roles in plants tolerating high temperature [9,10,13]. When isoprene biosynthesis in Vismia guianensis was blocked by fosmidomycin (Fos) through inhibiting 1-deoxy-D-xylulose-5-phosphate reductoisomerase activity in the MEP pathway, the ROS massively accumulated and photosynthetic capacity markedly declined under high temperature [19]. A similar phenomenon was also found in a grapevine mutation without emitting monoterpenes [18]. For isoprene-emitting tobacco and A. thaliana, they improved thermotolerance by lowering ROS levels and maintaining photosynthesis [20,21]. When ISPS was knocked down in grey poplar (Populus pruinosa), a decrease was found in the PSII efficiency and CO2 assimilation rate under high temperature [22]. For Quercus ilex and Q. suber, the fumigation with several exogenous monoterpenes obviously improved their thermotolerance [23,24].
For the thermotolerance mechanism of isoprenoids, it has been mainly hypothesized that these compounds may directly quench ROS and repair damaged membrane lipid molecules to enhance plant tolerance to high temperatures [25,26,27]. However, isoprene cannot dissolve into cellular membranes in great quantity, and is not involved in thylakoid membrane acyl lipid formation [27]. Meanwhile, there is no in vivo evidence about isoprenoids at a very low concentration scavenging ROS in plant cells. As a result, the hypotheses are suspected by more and more people [13]. Recently, new findings have revealed that isoprenoids serve crucial signaling functions in regulating plant growth and development by adjusting gene expression in phytohormone formation [22], and improving plant thermotolerance by adjusting gene expression in ROS quenching, photosynthesis, and membrane lipid formation [2,4,28]. Whatever the mechanism, it is unsuspected that isoprenoids can protect plants against high temperature, but the early event and dynamic variations during the protecting process are not clear. The answers to these issues are beneficial in providing new insights for uncovering isoprenoid thermotolerance mechanisms.
Cinnamomum camphora is a subtropical evergreen broad-leaved tree species, and has enormous economic and ecological values. This species mainly releases monoterpenes, and contains four main chemotypes, namely, linalool chemotype (LnL), eucalyptol chemotype (EuL), camphor chemotype (CmR), and borneol chemotype (BeL) [29,30]. In response to high temperature, the four chemotypes of C. camphora improved monoterpene formation and emission by raising the expression of the genes in the MEP pathway and monoterpene synthases [30]. Meanwhile, those monoterpenes exhibited crucial functions in the four chemotypes tolerating high temperature, which can decrease ROS by promoting the expression of genes related to non-enzymatic antioxidant formation, maintain photosynthetic capacities by raising the expression of the genes associated with light reaction and CO2 fixation, and maintain membrane system stabilization by adjusting the expression of the genes in membrane lipid metabolism [2,4,28]. Therefore, a new hypothesis has been proposed that isoprenoids should serve signaling functions in improving plant thermotolerance. To provide new evidence for the hypothesis, the early event, and dynamic variations in the three chemotypes of C. camphora (LnL, EuL, and CmR) with and without monoterpene emission were investigated by analyzing the ROS metabolism, photosynthetic capacity, and related gene expression during a 6 h high-temperature shock. The results primarily showed that blocking monoterpene biosynthesis did not immediately impact the physiological responses in the three chemotypes with respect to the monoterpene-emitting plants during 2 h of high-temperature stress, but caused serious damages after 4 h by inhibiting the expression of related genes, indicating that monoterpenes acted as signaling molecules to improve plant thermotolerance.

2. Materials and Methods

2.1. Plant Materials and High Temperature Treatment

In July, the LnL, EuL, and CmR seedlings (1 year old) with a height of approximately 30 cm were transferred into illumination incubators, with 12 seedlings in each chemotype. The culturing conditions in the incubators were 16 h light at 28 °C and 8 h dark at 20 °C, with a humidity of 60%. The light intensity was 300 μmol·m−2·s−1, which was supplied with LEDs (400–700 nm). Each seedling was cultured in a pot (diameter of 12 cm) filled with soil/sand (1:1) mixture, and was watered with Hoagland nutrient solution every 3 days, with 200 mL for each pot. After adaption for 10 days, these seedlings were used for high-temperature treatment.
For each chemotype, the seedlings were randomly divided into 3 groups, with 4 seedlings in each group and each plant as a replicate. One group was randomly selected, of which seedlings were sprayed with 30 mM Fos to inhibit the biosynthesis of monoterpenes, with 20 mL for each plant [30]. After 8 h, they were treated with high temperature at 40 °C. The other two groups were sprayed with distilled water and kept under 28 °C for 8 h, of which one group was treated with high temperature at 40 °C and another group was still kept under 28 °C (the control). During the 6 h treatment with high temperature, the 3rd to 5th leaves from the top were used to determine the dynamic variations in H2O2 levels, thiobarbituric acid reactive substance (TBARS) content, ascorbic acid (AsA) content, photosynthetic capacity, and related gene expression.

2.2. Measurement of H2O2 Content

H2O2 content was measured by using the xylenol orange method [2]. A total of 0.5 g of C. camphora leaves were ground to a homogenate with 1.5 mL cold acetone and centrifuged at 10,000× g for 10 min at 4 °C. A total of 1 mL of the supernatant of was added into 2 mL double distilled water, and extracted with 3 mL CCl4 and CHCl3 (3:1) solution. The upper aqueous phase of 1 mL was mixed with 2 mL of xylenol orange solution, and the absorbance at 560 nm was measured after incubation at 30 °C for 30 min.

2.3. Determination of TBARS Content

A total of 0.5 g of C. camphora leaves were homogenized with 50 mM phosphate-buffered solution (pH 7.8), and centrifuged at 12,000× g for 25 min at 4 °C. A total of 1 mL of the supernatant was mixed with 2 mL of reaction solution, which contained 20% trichloroacetic acid and 0.6% thiobarbituric acid, and then were placed into a boiling water bath for 15 min. After centrifugation, the absorbance of the supernatant was determined at 450, 532, and 600 nm, and the TBARS content was calculated using the formula given by Xu et al. [6].

2.4. Determination of Ascorbic Acid Content

The content of AsA was determined following the method of molybdenum blue colorimetry [31]. The leaf samples of 0.5 g were ground to a homogenate with 2 mL oxalic acid–EDTA solution (50 mM oxalic acid and 0.2 mM EDTA) and centrifuged at 5000× g for 10 min. A total of 1 mL of the supernatant was added into the reaction solution which was prepared with 4 mL oxalic acid-EDTA solution, 0.5 mL metaphosphoric acid–acetic acid solution (375 mM metaphosphoric acid and 8% acetic acid), 1 mL 5% sulfuric acid, and 2 mL 5% ammonium molybdate solution. The absorbance at 760 nm was measured after incubation at 30 °C for 15 min.

2.5. Assay of Chlorophyll Fluorescence Transient

Chlorophyll fluorescence transient was measured according to our previous method described by Tian et al. [2]. The C. camphora leaf was dark-adapted for 30 min, and the chlorophyll fluorescence transient was determined with a non-modulation chlorophyll fluorescence analyzer (YZQ-500, YZQ Technology Co., Beijing, China). For analyzing the kinetic curve, four fluorescence parameters were calculated following the equations given by Christen et al. [32], including PSII maximum quantum yield for primary photochemistry (φPo), quantum yield for electron transport at t = 0 (φEo), probability that a trapped exciton moves an electron into the electron transport chain beyond QA− (ΨO), and maximum quantum yield of non-photochemical deexcitation (φDo).

2.6. Measurement of Gas Exchange

The gas exchange in C. camphora was measured with a Li-6800 portable photosynthesis system (LI-COR Biosciences, NE, USA). The measuring conditions were set following a previous study [29], with a light intensity of 800 μmol·m−2·s−1, leaf chamber temperature of 30 °C, and reference CO2 concentration of 400 μmol·mol−1. The photosynthetic rate and intercellular CO2 concentration (Ci) were recorded after stabilization.

2.7. qRT-PCR Analysis

Under high temperature, the 3 chemotypes showed similar physiological responses, of which LnL was used to analyze the changes in related gene expression. The total RNA in LnL was extracted by using an Easy Plant RNA Extraction Kit (Zhejiang Easy-Do Biotech Co., LTD, Zhejiang, China), of which the concentration and purity were measured by detecting the ratio of the absorbance at 260 and 280 nm. Then, the total RNA was reverse transcribed into cDNA using a kit, Easy gDNA Removal RT MasterMix (Zhejiang Easy-Do Biotech Co., LTD, Zhejiang, China). According to the transcriptome analysis of C. camphora in our previous study [28], 7 genes associated with non-enzymatic antioxidant formation (GGP, VTE3, and 4CL) and photosynthesis (psbP, psbW, rbcS, and rbcL) were selected due to their crucial functions in the corresponding physiological process and remarkable responses to monoterpenes under high temperature. They were analyzed by quantitative real-time PCR (qRT-PCR) to indicate the related gene expression. The 18s rRNA gene was used as the reference gene. They were amplified on a real-time PCR instrument (QuantStuddloTM 3, Thermo, Waltham, MA, USA) using specific primers (Table 1). Gene expression changes were calculated using the 2−ΔΔCt method [33], and the gene expression level in the control at 0 h was assigned the value of 1.

2.8. Statistical Analysis

The software Origin 8.5 (Origin Lab, Northampton, MA, USA) was used to compare the differences between the treatments according to the Tukey test in one-way ANOVA.

3. Results

3.1. Effects of Monoterpene Emission on H2O2 Content Variations under High Temperature

When LnL, EuL, and CmR C. camphora were stressed by high temperature without (40 °C) and with (Fos + 40 °C) monoterpene biosynthesis blockage by Fos, the H2O2 content was significantly (p < 0.05) higher than that in the control at 28 °C after 0.5 h (except for EuL after 1 h). In the treatments with 40 °C and Fos + 40 °C, the H2O2 content in the three chemotypes was gradually increased during the 2 h treatment, but without significant differences between the two treatments. However, the H2O2 content in Fos + 40 °C treatment was significantly (p < 0.05) higher than that in 40 °C treatment after 4 h, with increases of 13.8%, 12.3%, and 12.3%, respectively, in LnL, EuL, and CmR (Figure 1).

3.2. Effects of Monoterpene Emission on TBARS Content Changes under High Temperature

When LnL, EuL, and CmR C. camphora were treated with 40 °C and Fos + 40 °C, the TBARS content was gradually increased with the prolongation of the treatment time, and was significantly (p < 0.05) higher than that in the control since the second h. After 4 h, Fos + 40 °C treatment further aggravated the increase in TBARS content compared with 40 °C treatment. At the sixth h, the TBARS content in LnL, EuL, and CmR treated with Fos + 40 °C reached the highest level, with increases of 101.1% (p < 0.05), 103.0% (p < 0.05), and 91.9% (p < 0.05), respectively, in contrast to the control (Figure 2).

3.3. Effects of Monoterpene Emission on Ascorbic Acid Content Variations under High Temperature

In the treatments with 40 °C and Fos + 40 °C for 1 h, the AsA content in the three chemotypes was significantly (p < 0.05) lower than that in the control, but no significant difference was detected between the two treatments. After 4 h, Fos + 40 °C treatment further aggravated the decline in AsA content in contrast to 40 °C treatment. At the sixth h, the AsA content in LnL, EuL, and CmR treated with Fos + 40 °C was reduced to the lowest level, with decreases of 47.1% (p < 0.05), 25.1% (p < 0.05) and 45.2% (p < 0.05), respectively, compared with the control (Figure 3).

3.4. Effects of Monoterpene Emission on PSII Efficiency Changes under High Temperature

For LnL, EuL, and CmR, the φPo significantly (p < 0.05) declined in 40 °C and Fos + 40 °C treatments for 0.5 h, but without significant difference between the two treatments. After 4 h, the φPo in Fos + 40 °C treatment was significantly (p < 0.05) lower than that in 40 °C treatment (Figure 4A–C). Similar variations were also found in φEO and ΨO, and Fos + 40 °C treatment further aggravated their reduction in the three chemotypes following the fourth h (Figure 4D–I).
Conversely, φDO showed an increasing trend in LnL, EuL, and CmR treated with 40 °C and Fos + 40 °C, and Fos + 40 °C treatment further aggravated its increase following the fourth h (Figure 4J–L).

3.5. Effects of Monoterpene Emission on Photosynthetic Rate Variations under High Temperature

When LnL, EuL, and CmR were treated with 40 °C and Fos + 40 °C, the photosynthetic rate was significantly (p < 0.05) lower than that in the control since the second h. After 4 h, Fos + 40 °C treatment further aggravated the decrease in photosynthetic rate compared with 40 °C treatment. At the sixth h, the photosynthetic rate in LnL, EuL, and CmR treated with Fos + 40 °C was decreased to the lowest level, with decreases of 32.7% (p < 0.05), 23.2% (p < 0.05), and 29.0% (p < 0.05), respectively, in contrast to the control (Figure 5A–C).
With respect to photosynthetic rate, Ci exhibited an opposite variation in the three chemotypes treated with 40 °C and Fos + 40 °C, and Fos + 40 °C treatment further aggravated its increase with respect to 40 °C treatment since the fourth h (Figure 5D–F).

3.6. Effects of Monoterpene Emission on Gene Expression Alterations under High Temperature

The expression of GGP in LnL was gradually down-regulated during the 2 h treatment at 40 °C, and then kept at a relatively stable low level. However, its expression was gradually down-regulated during the 4 h treatment with Fos + 40 °C. At the fourth h, the expression level of GGP in Fos + 40 °C treatment decreased by 24.7% (p < 0.05) compared with that in the 40 °C treatment (Figure 6A).
Similarly, the expressions of VTE3, 4CL, psbP, psbW, rbcS, and rbcL were also down-regulated in the 40 °C and Fos + 40 °C treatments, with a significant (p < 0.05) difference between the two treatments at the fourth h (Figure 6B–G).

4. Discussion

Under high temperature, ROS accumulate to a high level in plant cells, which is harmful to biomacromolecules (DNA and proteins) and can oxidize membrane lipids, resulting in TBARS formation [5]. When rice (Oryza sativa) and wheat (Triticum aestivum) were stressed by high temperature, they quickly accumulated ROS and TBARS to high levels [34,35]. Under high temperature, the levels of 1O2 and total ROS in Microcystis aeruginosa cells gradually increased with temperature elevation [36]. In previous study, the contents of H2O2, O2ˉ·, and TBARS in EuL C. camphora gradually increased with temperature elevation [37]. Similarly, a high temperature also promoted H2O2 accumulation and TBARS formation in LnL, EuL, and CmR, with a gradual increasing trend in H2O2 and TBARS contents during the 2 h and 6 h treatments, respectively (Figure 1 and Figure 2).
When isoprene biosynthesis in V. guianensis was blocked by Fos, an effective inhibitor of the MEP pathway, the plant increased ROS accumulation under high temperature and developed more serious oxidative stress [19]. In LnL, EuL, and CmR, Fos can effectively block monoterpene biosynthesis, and the emission rate declined by 92.7%, 89.9%, and 90.9% under high temperature, respectively [30]. Under high temperature weather for 8 h, adult C. camphora plants accumulated more H2O2, O2ˉ,· and TBARS when the monoterpene biosynthesis was blocked by Fos [6]. Similarly, Fos + 40 °C treatment also further aggravated the H2O2 and TBARS accumulation in the three chemotypes following the fourth h (Figure 1 and Figure 2), suggesting that monoterpenes should not directly quench ROS for lacking immediate effects.
To reduce oxidative damages, plants develop a series of enzymatic and non-enzymatic antioxidants to adjust ROS levels in the cells [5]. For enzymatic antioxidants, superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) play important roles in scavenging ROS when plants undergo abiotic stresses, e.g., the three enzymes served a scavenging function in C. camphora stressed by acid rain [5]. Under high temperature, C. camphora raised SOD and POD activities to control ROS levels, while the plant with monoterpene biosynthesis blockage further raised SOD and POD activities due to the induction of increased ROS levels [6,28]. In this study, similar variations of the two antioxidant enzyme activities were also found in LnL, EuL, and CmR seedlings (Supplementary Figure S1). When C. camphora was fumigated with exogenous monoterpenes such as linalool, eucalyptol, camphor, borneol, terpinene, and β-pinene under high temperature, SOD and POD activities gradually declined with monoterpene concentration elevation, as these monoterpenes exhibited negative effects on antioxidant enzyme gene expression [2,28]. These results demonstrate that antioxidant enzymes might not play a main role in controlling ROS levels in the plants with abundant monoterpene emission under high temperature.
For non-enzymatic antioxidants, they mainly include AsA, glutathione, tocopherol, carotenoids, phenolic, and flavonoid compounds [5,38]. Under high temperature, a decline was found in AsA and glutathione contents in mung bean (Vigna radiata) [39] and eggplant (Solanum melongena) [40] seedlings as well as pepper (Capsicum annuum) fruits [41] due to their consumption in quenching ROS. When C. camphora was stressed by acid rain, the levels of AsA and glutathione also declined [5]. In the treatment with exogenous glutathione, mung bean enhanced its tolerance to high temperature by improving AsA and glutathione contents to alleviate secondary oxidative stress [39]. In this study, the high temperature also decreased the AsA content in the three chemotypes, while Fos + 40 °C treatment further aggravated the decrease following the fourth h (Figure 3).
Under high temperature for 8 h, monoterpene biosynthesis blockage suppressed the expression of genes in non-enzymatic antioxidant (AsA, glutathione, tocopherol, phenolics, and flavonoids) formation in C. camphora, while monoterpene fumigation promoted the expression of these genes [2,28]. GGP encodes GDP-L-galactose phosphorylase, which catalyzes the first committed step in galactose biosynthesis for AsA formation [42], the over-expression of which can improve AsA content in tomato (Solanum lycopersicum) [43]. In this study, it was down-regulated in the 40 °C treatment, and further down-regulated in the Fos + 40 °C treatment for 4 h (Figure 6A), which might have led to the corresponding reduction in AsA content (Figure 3). VTE3 encodes 2-methyl-6-phytyl-1,4-benzoquinone (MPBQ)/2-methyl-6-solanyl-1,4-benzoquinone (MSBQ) methyltransferase, which is involved in a key methylation step in tocopherol generation [44]. 4CL encodes 4-coumarate-CoA ligase in the biosynthesis of phenylpropanoids, such as phenolics and flavonoids [45]. Compared with 40 °C treatment, Fos + 40 °C treatment further down-regulated the expression of VTE3 and 4CL at the fourth h (Figure 6B,C), which may cause the inhibition of the formation of other non-enzymatic antioxidants such as tocopherol, phenolics, and flavonoids. Therefore, the reduction in non-enzymatic antioxidants under Fos + 40 °C treatment should intensify ROS accumulation.
Chlorophylls and carotenoids are important photosynthetic pigments, which serve important functions in capturing and transferring light energy as well as transducing it to electric energy [5]. When C. camphora pretreated with Fos was stressed by high temperature (35 °C and 45 °C) for 8 h, the content of chlorophylls and carotenoids was not changed in contrast to that in single high-temperature treatment [37]. This indicates that Fos treatment does not affect photosynthetic pigment synthesis in a short time.
When tomato was treated with high temperature, a remarkable decline was found in φPo, φEO, and ΨO, while a remarkable increase was found in φDO [46]. Similar variations were also found in wild barley (Hordeum spontaneum) and tobacco under high-temperature stress [47,48]. In M. aeruginosa cells, the variations in these fluorescence parameters gradually enhanced with temperature elevation [36]. Similarly, high temperature also caused a decrease in φPo, φEO, and ΨO as well as an increase in φDO in LnL, EuL, and CmR (Figure 4), indicating that high temperature decreased plant PSII efficiency by influencing photosynthetic electron yield and transfer and raising the thermal dissipation of the absorbed light energy [36,46].
Under high temperature, V. guianensis aggravated the decrease in PSII efficiency after blocking isoprene biosynthesis [19], and a grapevine mutation without emitting monoterpenes decreased PSII efficiency compared with the monoterpene-emitting plant [18]. After fumigation with α-pinene and limonene, Q. ilex maintained the PSII efficiency at a high level by maintaining the photosynthetic electron yield and transfer in response to high temperature [24]. When C. camphora was treated with Fos + high temperature (38 and 40 °C) for 8 h, the PSII efficiency was decreased in contrast to that only under high temperature treatment, due to the down-regulation of the genes related to the photosynthetic electron transport chain [2,28]. Compared with the 40 °C treatment, Fos + 40 °C treatment further decreased the PSII efficiency in LnL, EuL, and CmR after 4 h (Figure 4). psbP and psbW encode PSII oxygen-evolving enhancer protein 2 [49] and PsbW protein [50] for PSII assembly, respectively. They were further down-regulated in Fos + 40 °C treatment for 4 h (Figure 6D,E), suggesting that the expression of the genes related to the photosynthetic electron transport chain might have been further suppressed at that time, resulting in the aggravated reduction in PSII efficiency.
Compared with the 40 °C treatment, the Fos + 40 °C treatment further lowered the photosynthetic rate after 4 h, leading to a Ci increase (Figure 5). This was consistent with the aggravated decrease in photosynthetic rate in V. guianensis with isoprene biosynthesis blockage [19], and a grapevine mutation without emitting monoterpenes [18] under high temperature. In high-temperature treatment, Q. suber can maintain the photosynthetic rate at a high level after fumigation with several exogenous monoterpenes, such as α-pinene, sabinene, β-pinene, β-ocimene, myrcene, and limonene [23]. rbcS and rbcL separately code for the small and large chains of ribulose-1,5-bisphosphate carboxylase/oxygenase [51]. The expression of the two genes and other CO2 fixation-related genes in C. camphora treated with Fos + high temperature for 8 h was down-regulated, while exogenous monoterpene fumigation showed recovery effects [2,28]. With respect to the 40 °C treatment, Fos + 40 °C treatment aggravated the down-regulation of rbcS and rbcL after 4 h (Figure 6F,G), which should intensify the decrease in photosynthetic rate (Figure 5). Meanwhile, the lower PSII efficiency in Fos + 40 °C treatment may also contribute to the intensified decrease in photosynthetic rate for reducing assimilatory power (NADPH and ATP) supply.
In the 40 °C and Fos + 40 °C treatments, LnL, EuL, and CmR increased the ROS and TBARS levels, reduced AsA content, and decreased PSII efficiency and photosynthetic rate, without showing a significant difference between the two treatments within 2 h, indicating that monoterpenes did not directly play thermotolerance roles in C. camphora undergoing high temperature shock in short period. In the ecosystem, the VOCs from damaged plants can act as signaling molecules to induce neighbor plants performing defense responses by initiating defense gene expression [52,53]. In tobacco, the treatment with terpene VOCs (α-caryophyllene, β-caryophyllene, and caryophyllene oxide) triggered the expression of three defense genes (NtOsmotin, NtODC, and NtACIII) after 3 h [54]. In contrast to the 40 °C treatment, the Fos + 40 °C treatment aggravated the down-regulation of the genes related to non-enzymatic antioxidant formation and photosynthesis since the fourth h, which should lead to a further increase in ROS levels and a decrease in photosynthetic capacities following that time. Therefore, monoterpenes should act as signaling molecules to improve C. camphora thermotolerance, which not only provides new proof for the current hypothesis about isoprenoids serving signaling functions in improving plant thermotolerance, but also promotes the development and utilization of monoterpenes as anti-high temperature agents, as well as the cultivation of high temperature tolerance varieties with abundant monoterpene emission.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/f14102005/s1, Figure S1: Effects of monoterpene emission on the activities of superoxide dismutase (SOD) and peroxidase (POD) in linalool (A,D), eucalyptol (B,E) and camphor (C,F) chemotypes of C. camphora under high temperature for 6 h. Compared with the control at 28 °C, the treatment with 40 °C significantly (p < 0.05) improved the SOD and POD activities in the 3 chemotypes, and the treatment with blocking monoterpene biosynthesis by fosmidomycin (Fos) under 40 °C (Fos + 40 °C) further improved the two enzyme activities. The measurement of the two enzyme activities was following the methods described in our previous study [37].

Author Contributions

Methodology, Y.W.; investigation, Y.W., Q.Q. and H.X.; writing—original draft, Z.Z.; writing—review & editing, Z.Z.; supervision, Z.Z.; funding acquisition, Z.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (No. 32371830, 31870585), and the Natural Science Foundation of Zhejiang Province (No. LY17C160004).

Data Availability Statement

The data presented in this study are available upon request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Katz, D.S.W.; Dzul, A.; Kendel, A.; Batterman, S.A. Effect of intra-urban temperature variation on tree flowering phenology, airborne pollen, and measurement error in epidemiological studies of allergenic pollen. Sci. Total Environ. 2019, 653, 1213–1222. [Google Scholar] [CrossRef]
  2. Tian, Z.; Luo, Q.; Li, Y.; Zuo, Z. Terpinene and β-pinene acting as signaling molecules to improve Cinnamomum camphora thermotolerance. Ind. Crop. Prod. 2020, 154, 112641. [Google Scholar] [CrossRef]
  3. Crous, K.Y.; Uddling, J.; De Kauwe, M.G. Temperature responses of photosynthesis and respiration in evergreen trees from boreal to tropical latitudes. New Phytol. 2022, 234, 353–374. [Google Scholar] [CrossRef] [PubMed]
  4. Cai, Y.; Xu, C.; Zheng, T.; Zuo, Z. Thermal protection function of camphor on Cinnamomum camphora cell membrane by acting as a signaling molecule. Plant Physiol. Biochem. 2023, 198, 107672. [Google Scholar] [CrossRef] [PubMed]
  5. Ma, Y.; Wang, B.; Zhang, R.; Gao, Y.; Zhang, X.; Li, Y.; Zuo, Z. Initial simulated acid rain impacts reactive oxygen species metabolism and photosynthetic abilities in Cinnamonum camphora undergoing high temperature. Ind. Crop. Prod. 2019, 135, 352–361. [Google Scholar] [CrossRef]
  6. Xu, C.; Wang, B.; Luo, Q.; Ma, Y.; Zheng, T.; Wang, Y.; Cai, Y.; Zuo, Z. The uppermost monoterpenes improving Cinnamomum camphora thermotolerance by serving signaling functions. Front. Plant Sci. 2022, 13, 1072931. [Google Scholar] [CrossRef] [PubMed]
  7. Velikova, V.; Várkonyi, Z.; Szabó, M.; Maslenkova, L.; Nogues, I.; Kovács, L.; Peeva, V.; Busheva, M.; Garab, G.; Sharkey, T.D.; et al. Increased thermostability of thylakoid membranes in isoprene-emitting leaves probed with three biophysical techniques. Plant Physiol. 2011, 157, 905–916. [Google Scholar] [CrossRef]
  8. Taylor, T.C.; Smith, M.N.; Slot, M.; Feeley, K.J. The capacity to emit isoprene differentiates the photosynthetic temperature responses of tropical plant species. Plant Cell Environ. 2019, 42, 2448–2457. [Google Scholar] [CrossRef]
  9. Monson, R.K.; Weraduwage, S.M.; Rosenkranz, M.; Schnitzler, J.P.; Sharkey, T.D. Leaf isoprene emission as a trait that mediates the growth-defense tradeoff in the face of climate stress. Oecologia 2021, 197, 885–902. [Google Scholar] [CrossRef]
  10. Byron, J.; Kreuzwieser, J.; Purser, G.; van Haren, J.; Ladd, S.N.; Meredith, L.K.; Werner, C.; Williams, J. Chiral monoterpenes reveal forest emission mechanisms and drought responses. Nature 2022, 609, 307–312. [Google Scholar] [CrossRef]
  11. Zuo, Z. Why algae release volatile organic compounds—the emission and roles. Front. Microbiol. 2019, 10, 491. [Google Scholar] [CrossRef] [PubMed]
  12. Palmer, P.I.; Marvin, M.R.; Siddans, R.; Kerridge, B.J.; Moore, D.P. Nocturnal survival of isoprene linked to formation of upper tropospheric organic aerosol. Science 2022, 375, 562–566. [Google Scholar] [CrossRef] [PubMed]
  13. Lantz, A.T.; Allman, J.; Weraduwage, S.M.; Sharkey, T.D. Isoprene: New insights into the control of emission and mediation of stress tolerance by gene expression. Plant Cell Environ. 2019, 42, 2808–2826. [Google Scholar] [CrossRef]
  14. Zuo, Z. Emission of cyanobacterial volatile organic compounds and their roles in blooms. Front. Microbiol. 2023, 14, 1097712. [Google Scholar] [CrossRef] [PubMed]
  15. Jardine, K.J.; Jardine, A.B.; Holm, J.A.; Lombardozzi, D.L.; Negron-Juarez, R.I.; Martin, S.T.; Beller, H.R.; Gimenez, B.O.; Higuchi, N.; Chambers, J.Q. Monoterpene ‘thermometer’ of tropical forest-atmosphere response to climate warming. Plant Cell Environ. 2017, 40, 441–452. [Google Scholar] [CrossRef]
  16. Guidolotti, G.; Pallozzi, E.; Gavrichkova, O.; Scartazza, A.; Mattioni, M.; Loreto, F.; Calfapietra, C. Emission of constitutive isoprene, induced monoterpenes, and other volatiles under high temperatures in Eucalyptus camaldulensis: A 13C labelling study. Plant Cell Environ. 2019, 42, 1929–1938. [Google Scholar] [CrossRef] [PubMed]
  17. Grausgruber-Gröger, S.; Schmiderer, C.; Steinborn, R.; Novak, J. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae). J. Plant Physiol. 2012, 169, 353–359. [Google Scholar] [CrossRef]
  18. Bertamini, M.; Faralli, M.; Varotto, C.; Grando, M.S.; Cappellin, L. Leaf monoterpene emission limits photosynthetic downregulation under heat stress in field-grown grapevine. Plants 2021, 10, 181. [Google Scholar] [CrossRef]
  19. Rodrigues, T.B.; Baker, C.R.; Walker, A.P.; McDowell, N.; Rogers, A.; Higuchi, N.; Chambers, J.Q.; Jardine, K.J. Stimulation of isoprene emissions and electron transport rates as key mechanisms of thermal tolerance in the tropical species Vismia guianensis. Glob. Chang. Biol. 2020, 26, 5928–5941. [Google Scholar] [CrossRef]
  20. Pollastri, S.; Jorba, I.; Hawkins, T.J.; Llusià, J.; Michelozzi, M.; Navajas, D.; Peñuelas, J.; Hussey, P.J.; Knight, M.R.; Loreto, F. Leaves of isoprene-emitting tobacco plants maintain PSII stability at high temperatures. New Phytol. 2019, 223, 1307–1318. [Google Scholar] [CrossRef]
  21. Zuo, Z.; Weraduwage, S.M.; Lantz, A.T.; Sanchez, L.M.; Weise, S.E.; Wang, J.; Childs, K.L.; Sharkey, T.D. Isoprene acts as a signaling molecule in gene networks important for stress responses and plant growth. Plant Physiol. 2019, 180, 124–152. [Google Scholar] [CrossRef] [PubMed]
  22. Behnke, K.; Ehlting, B.; Teuber, M.; Bauerfeind, M.; Louis, S.; Hänsch, R.; Polle, A.; Bohlmann, J.; Schnitzler, J.P. Transgenic, non-isoprene emitting poplars don’t like it hot. Plant J. 2007, 51, 485–499. [Google Scholar] [CrossRef] [PubMed]
  23. Delfine, S.; Csiky, O.; Seufert, G.; Loreto, F. Fumigation with exogenous monoterpenes of a non-isoprenoid-emitting oak (Quercus suber): Monoterpene acquisition, translocation, and effect on the photosynthetic properties at high temperatures. New Phytol. 2000, 146, 27–36. [Google Scholar] [CrossRef]
  24. Peñuelas, J.; Llusià, J. Linking photorespiration, monoterpenes and thermotolerance in Quercus. New Phytol. 2002, 155, 227–237. [Google Scholar] [CrossRef]
  25. Vickers, C.E.; Possell, M.; Cojocariu, C.I.; Velikova, V.B.; Laothawornkitkul, J.; Ryan, A.; Mullineaux, P.M.; Hewitt, C.N. Isoprene synthesis protects transgenic tobacco plants from oxidative stress. Plant Cell Environ. 2009, 32, 520–531. [Google Scholar] [CrossRef]
  26. Pollastri, S.; Tsonev, T.; Loreto, F. Isoprene improves photochemical efficiency and enhances heat dissipation in plants at physiological temperatures. J. Exp. Bot. 2014, 65, 1565–1570. [Google Scholar] [CrossRef]
  27. Harvey, C.M.; Li, Z.; Tjellström, H.; Blanchard, G.J.; Sharkey, T.D. Concentration of isoprene in artificial and thylakoid membranes. J. Bioenergy Biomembr. 2015, 47, 419–429. [Google Scholar] [CrossRef]
  28. Xu, C.; Ma, Y.; Tian, Z.; Luo, Q.; Zheng, T.; Wang, B.; Zuo, Z. Monoterpene emissions and their protection effects on adult Cinnamomum camphora against high temperature. Trees Struct. Funct. 2022, 36, 711–721. [Google Scholar] [CrossRef]
  29. Luo, Q.; Xu, C.; Zheng, T.; Ma, Y.; Li, Y.; Zuo, Z. Leaf morphological and photosynthetic differences among four chemotypes of Cinnamomum camphora in different seasons. Ind. Crop. Prod. 2021, 169, 113651. [Google Scholar] [CrossRef]
  30. Tian, Z.; Luo, Q.; Zuo, Z. Seasonal emission of monoterpenes from four chemotypes of Cinnamomum camphora. Ind. Crop. Prod. 2021, 163, 113327. [Google Scholar] [CrossRef]
  31. Liu, J.; Hu, T.; Feng, P.; Yao, D.; Gao, F.; Hong, X. Effect of potassium fertilization during fruit development on tomato quality, potassium uptake, water and potassium use efficiency under deficit irrigation regime. Agr. Water Manag. 2021, 250, 106831. [Google Scholar] [CrossRef]
  32. Christen, D.; Schönmanna, S.; Jermini, M.; Strasser, R.J.; Défago, G. Characterization and early detection of grapevine (Vitis vinifera) stress responses to esca disease by in situ chlorophyll fluorescence and comparison with drought stress. Environ. Exp. Bot. 2007, 60, 504–514. [Google Scholar] [CrossRef]
  33. Peng, X.; Wang, B.; Wang, X.; Ni, B.; Zuo, Z. Variations in aroma and specific flavor in strawberry under different colored light-quality selective plastic film. Flavour Fragr. J. 2020, 35, 350–359. [Google Scholar] [CrossRef]
  34. Djanaguiraman, M.; Boyle, D.L.; Welti, R.; Jagadish, S.V.K.; Prasad, P.V.V. Decreased photosynthetic rate under high temperature in wheat is due to lipid desaturation, oxidation, acylation, and damage of organelles. BMC Plant Biol. 2018, 18, 55. [Google Scholar] [CrossRef] [PubMed]
  35. Liu, J.; Hasanuzzaman, M.; Wen, H.; Zhang, J.; Peng, T.; Sun, H.; Zhao, Q. High temperature and drought stress cause abscisic acid and reactive oxygen species accumulation and suppress seed germination growth in rice. Protoplasma 2019, 256, 1217–1227. [Google Scholar] [CrossRef]
  36. Zheng, T.; Zhou, M.; Yang, L.; Wang, Y.; Wang, Y.; Meng, Y.; Liu, J.; Zuo, Z. Effects of high light and temperature on Microcystis aeruginosa cell growth and β-cyclocitral emission. Ecotox. Environ. Safe 2020, 192, 110313. [Google Scholar] [CrossRef] [PubMed]
  37. Zuo, Z.; Wang, B.; Ying, B.; Zhou, L.; Zhang, R. Monoterpene emissions contribute to thermotolerance in Cinnamomum camphora. Trees Struct. Funct. 2017, 31, 1759–1771. [Google Scholar] [CrossRef]
  38. Kirkan, B. Antioxidant potential, enzyme inhibition activity, and phenolic profile of extracts from Stachys cretica subsp. vacillans. Ind. Crop. Prod. 2019, 140, 111639. [Google Scholar] [CrossRef]
  39. Nahar, K.; Hasanuzzaman, M.; Alam, M.M.; Fujita, M. Exogenous glutathione confers high temperature stress tolerance in mung bean (Vigna radiata L.) by modulating antioxidant defense and methylglyoxal detoxification system. Environ. Exp. Bot. 2015, 112, 44–54. [Google Scholar] [CrossRef]
  40. Liu, R.; Shu, B.; Wang, Y.; Yu, B.; Wang, Y.; Gan, Y.; Liang, Y.; Qiu, Z.; Yang, J.; Yan, S.; et al. Transcriptome analysis reveals key genes involved in the eggplant response to high-temperature stress. Environ. Exp. Bot. 2023, 211, 105369. [Google Scholar] [CrossRef]
  41. Liu, C.; Luo, S.; Zhao, Y.; Miao, Y.; Wang, Q.; Ye, L.; Gao, L.; Ahammed, G.J.; Cheng, Y. Multiomics analyses reveal high temperature-induced molecular regulation of ascorbic acid and capsaicin biosynthesis in pepper fruits. Environ. Exp. Bot. 2022, 201, 104941. [Google Scholar] [CrossRef]
  42. Bulley, S.; Laing, W. The regulation of ascorbate biosynthesis. Curr. Opin. Plant Biol. 2016, 33, 15–22. [Google Scholar] [CrossRef]
  43. Koukounaras, A.; Mellidou, I.; Patelou, E.; Kostas, S.; Shukla, V.; Engineer, C.; Papaefthimiou, D.; Amari, F.; Chatzopoulos, D.; Mattoo, A.K.; et al. Over-expression of GGP1 and GPP genes enhances ascorbate content and nutritional quality of tomato. Plant Physiol. Biochem. 2022, 193, 124–138. [Google Scholar] [CrossRef]
  44. Mène-Saffrané, L.; DellaPenna, D. Biosynthesis, regulation and functions of tocochromanols in plants. Plant Physiol. Biochem. 2010, 48, 301–309. [Google Scholar] [CrossRef] [PubMed]
  45. Wang, C.; Yu, J.; Cai, Y.; Zhu, P.; Liu, C.; Zhao, A.; Lü, R.; Li, M.; Xu, F.; Yu, M. Characterization and functional analysis of 4-coumarate: CoA ligase genes in mulberry. PLoS ONE 2016, 11, e0155814. [Google Scholar]
  46. Zushi, K.; Kajiwara, S.; Matsuzoe, N. Chlorophyll a fluorescence OJIP transient as a tool to characterize and evaluate response to heat and chilling stress in tomato leaf and fruit. Sci. Hortic. 2012, 148, 39–46. [Google Scholar] [CrossRef]
  47. Jedmowski, C.; Brüggemann, W. Imaging of fast chlorophyll fluorescence induction curve (OJIP) parameters, applied in a screening study with wild barley (Hordeum spontaneum) genotypes under heat stress. J. Photoch. Photobio. B 2015, 151, 153–160. [Google Scholar] [CrossRef]
  48. Che, Y.; Wang, H.; Zhang, B.; Gao, S.; Wang, Z.; Wang, Y.; Zhang, H.; Sun, G. Elevated air temperature damage to photosynthetic apparatus alleviated by enhanced cyclic electron flow around photosystem I in tobacco leaves. Ecotox. Environ. Safe 2020, 204, 111136. [Google Scholar]
  49. Liang, M.H.; Dai, J.L.; Xie, S.R.; Wu, J.X.; Chen, H.H.; Jiang, J.G. Orange protein (DbOR) from the salt-tolerant green alga Dunaliella bardawil mediates photosynthesis against heat stress via interacting with DbPsbP1. Algal Res. 2023, 72, 103105. [Google Scholar] [CrossRef]
  50. Plöchinger, M.; Schwenkert, S.; von Sydow, L.; Schröder, W.P.; Meurer, J. Functional update of the auxiliary proteins PsbW, PsbY, HCF136, PsbN, TerC and ALB3 in maintenance and assembly of PSII. Front. Plant Sci. 2016, 7, 423. [Google Scholar] [CrossRef]
  51. Chen, Y.; Wang, B.; Chen, J.; Wang, X.; Wang, R.; Peng, S.; Chen, L.; Ma, L.; Luo, J. Identification of Rubisco rbcL and rbcS in Camellia oleifera and their potential as molecular markers for selection of high tea oil cultivars. Front. Plant Sci. 2015, 6, 189. [Google Scholar] [CrossRef] [PubMed]
  52. Ye, M.; Glauser, G.; Lou, Y.; Erb, M.; Hu, L. Molecular dissection of early defense signaling underlying volatile-mediated defense regulation and herbivore resistance in rice. Plant Cell 2019, 31, 687–698. [Google Scholar] [CrossRef] [PubMed]
  53. Kutty, N.N.; Mishra, M. Dynamic distress calls: Volatile info chemicals induce and regulate defense responses during herbivory. Front. Plant Sci. 2023, 14, 1135000. [Google Scholar] [CrossRef] [PubMed]
  54. Nagashima, A.; Higaki, T.; Koeduka, T.; Ishigami, K.; Hosokawa, S.; Watanabe, H.; Matsui, K.; Hasezawa, S.; Touhara, K. Transcriptional regulators involved in responses to volatile organic compounds in plants. J. Biol. Chem. 2019, 294, 2256–2266. [Google Scholar] [CrossRef]
Forests 14 02005 g001
Figure 1. Effects of monoterpene emission on the increase in H2O2 content in linalool (A), eucalyptol (B), and camphor (C) chemotypes of C. camphora under high temperature. Fos + 40 °C: C. camphora was sprayed with fosmidomycin (Fos) to block monoterpene biosynthesis, and then stressed by 40 °C high temperature. At every time point, different lowercase letters indicate the significant difference at p < 0.05 between the treatments. Means ± SE (n = 4).
Figure 1. Effects of monoterpene emission on the increase in H2O2 content in linalool (A), eucalyptol (B), and camphor (C) chemotypes of C. camphora under high temperature. Fos + 40 °C: C. camphora was sprayed with fosmidomycin (Fos) to block monoterpene biosynthesis, and then stressed by 40 °C high temperature. At every time point, different lowercase letters indicate the significant difference at p < 0.05 between the treatments. Means ± SE (n = 4).
Forests 14 02005 g001
Forests 14 02005 g002
Figure 2. Effects of monoterpene emission on the increase in thiobarbituric acid reactive substance (TBARS) content in linalool (A), eucalyptol (B), and camphor (C) chemotypes of C. camphora under high temperature. Fos + 40 °C: C. camphora was sprayed with fosmidomycin (Fos) to block monoterpene biosynthesis, and then stressed by 40 °C high temperature. At every time point, different lowercase letters indicate the significant difference at p < 0.05 among the treatments. Means ± SE (n = 4).
Figure 2. Effects of monoterpene emission on the increase in thiobarbituric acid reactive substance (TBARS) content in linalool (A), eucalyptol (B), and camphor (C) chemotypes of C. camphora under high temperature. Fos + 40 °C: C. camphora was sprayed with fosmidomycin (Fos) to block monoterpene biosynthesis, and then stressed by 40 °C high temperature. At every time point, different lowercase letters indicate the significant difference at p < 0.05 among the treatments. Means ± SE (n = 4).
Forests 14 02005 g002
Forests 14 02005 g003
Figure 3. Effects of monoterpene emission on the decrease in ascorbic acid (AsA) content in linalool (A), eucalyptol (B), and camphor (C) chemotypes of C. camphora under high temperature. Fos + 40 °C: C. camphora was sprayed with fosmidomycin (Fos) to block monoterpene biosynthesis, and then stressed with 40 °C high temperature. At every time point, different lowercase letters indicate the significant difference at p < 0.05 among the treatments. Means ± SE (n = 4).
Figure 3. Effects of monoterpene emission on the decrease in ascorbic acid (AsA) content in linalool (A), eucalyptol (B), and camphor (C) chemotypes of C. camphora under high temperature. Fos + 40 °C: C. camphora was sprayed with fosmidomycin (Fos) to block monoterpene biosynthesis, and then stressed with 40 °C high temperature. At every time point, different lowercase letters indicate the significant difference at p < 0.05 among the treatments. Means ± SE (n = 4).
Forests 14 02005 g003
Forests 14 02005 g004
Figure 4. Effects of monoterpene emission on the variations in PSII efficiency in linalool (A,D,G,J), eucalyptol (B,E,H,K), and camphor (C,F,I,L) chemotypes of C. camphora under high temperature. (A–C): φPO; (D–F): φEO; (G–I): ΨO; (J–L): φDO. Fos + 40 °C: C. camphora was sprayed with fosmidomycin (Fos) to block monoterpene biosynthesis, and then stressed with 40 °C high temperature. At every time point, different lowercase letters indicate the significant difference at p < 0.05 among the treatments. Means ± SE (n = 4).
Figure 4. Effects of monoterpene emission on the variations in PSII efficiency in linalool (A,D,G,J), eucalyptol (B,E,H,K), and camphor (C,F,I,L) chemotypes of C. camphora under high temperature. (A–C): φPO; (D–F): φEO; (G–I): ΨO; (J–L): φDO. Fos + 40 °C: C. camphora was sprayed with fosmidomycin (Fos) to block monoterpene biosynthesis, and then stressed with 40 °C high temperature. At every time point, different lowercase letters indicate the significant difference at p < 0.05 among the treatments. Means ± SE (n = 4).
Forests 14 02005 g004
Forests 14 02005 g005
Figure 5. Effects of monoterpene emission on the variations in photosynthetic rate (A–C) and intercellular CO2 concentration (Ci) (D–F) in linalool (A,D), eucalyptol (B,E), and camphor (C,F) chemotypes of C. camphora under high temperature. Fos + 40 °C: C. camphora was sprayed with fosmidomycin (Fos) to block monoterpene biosynthesis, and then stressed with 40 °C high temperature. At every time point, different lowercase letters indicate the significant difference at p < 0.05 among the treatments. Means ± SE (n = 4).
Figure 5. Effects of monoterpene emission on the variations in photosynthetic rate (A–C) and intercellular CO2 concentration (Ci) (D–F) in linalool (A,D), eucalyptol (B,E), and camphor (C,F) chemotypes of C. camphora under high temperature. Fos + 40 °C: C. camphora was sprayed with fosmidomycin (Fos) to block monoterpene biosynthesis, and then stressed with 40 °C high temperature. At every time point, different lowercase letters indicate the significant difference at p < 0.05 among the treatments. Means ± SE (n = 4).
Forests 14 02005 g005
Forests 14 02005 g006
Figure 6. Effects of monoterpene emission on expression of the genes related to non-enzymatic antioxidant formation (GGP, VTE3, and 4CL) and photosynthesis (psbP, psbW, rbcS, and rbcL) in the linalool chemotype of C. camphora under high temperature. (A) GGP; (B) VTE3; (C) 4CL; (D) psbP; (E) psbW; (F) rbcS; (G) rbcL. Fos + 40 °C: C. camphora was sprayed with fosmidomycin (Fos) to block monoterpene biosynthesis, and then stressed with 40 °C high temperature. At every time point, different lowercase letters indicate the significant difference at p < 0.05 among the treatments. Means ± SE (n = 4).
Figure 6. Effects of monoterpene emission on expression of the genes related to non-enzymatic antioxidant formation (GGP, VTE3, and 4CL) and photosynthesis (psbP, psbW, rbcS, and rbcL) in the linalool chemotype of C. camphora under high temperature. (A) GGP; (B) VTE3; (C) 4CL; (D) psbP; (E) psbW; (F) rbcS; (G) rbcL. Fos + 40 °C: C. camphora was sprayed with fosmidomycin (Fos) to block monoterpene biosynthesis, and then stressed with 40 °C high temperature. At every time point, different lowercase letters indicate the significant difference at p < 0.05 among the treatments. Means ± SE (n = 4).
Forests 14 02005 g006
Table 1. Primers of qRT-PCR used in the study.
Table 1. Primers of qRT-PCR used in the study.
GeneProteinForward (5′ to 3′)Reverse (3′ to 5′)
18s rRNA18s rRNAATTCGTGCCTTGCCTTAACCATGCTAATGTATCCAGAG
GGPGDP-L-Galactose phosphorylaseGTCCTTGAATGCCTTCCCCAGCGCTTGTTTCTCCGCATAG
VTE32-Methyl-6-phytyl-1,4-benzoquinone (MPBQ)/2-methyl-6-solanyl-1,4-benzoquinone (MSBQ) methyltransferaseGAGGATGTCAGCAAGCCTGTATATGTTGCCGCCATTGCAC
4CL4-Coumarate-CoA ligaseGATCGCTCTCGCGAAGTACACTCCGCCCTTTGGACTTTCT
PsbPPSII oxygen-evolving enhancer protein 2AGGAAAGCAAGCCTACTCCGGTATGTTTGCCGTTGCCACA
PsbWPSII PsbW proteinTGCCAACAGAGTACTGGCTCTGCCCCCTTATGTACATGGC
rbcSRibulose-1,5-bisphosphate carboxylase/oxygenase small chainCATGGGATGGGTTCCTTGCTCTTGGCGGTTGTTGTCGAAG
rbcLRibulose-1,5-bisphosphate carboxylase/oxygenase large chainCCAAAACTTTCCAAGGCCCGTCCCAATAGGGGACGACCAT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Y.; Qian, Q.; Xu, H.; Zuo, Z. Dynamic Physiological Responses of Cinnamomum camphora with Monoterpene Protection under High Temperature Shock. Forests 2023, 14, 2005. https://doi.org/10.3390/f14102005

AMA Style

Wang Y, Qian Q, Xu H, Zuo Z. Dynamic Physiological Responses of Cinnamomum camphora with Monoterpene Protection under High Temperature Shock. Forests. 2023; 14(10):2005. https://doi.org/10.3390/f14102005

Chicago/Turabian Style

Wang, Yingying, Qixia Qian, Haozhe Xu, and Zhaojiang Zuo. 2023. "Dynamic Physiological Responses of Cinnamomum camphora with Monoterpene Protection under High Temperature Shock" Forests 14, no. 10: 2005. https://doi.org/10.3390/f14102005

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop