Figure 1.
Study Methodology. A flowchart to demonstrate the methodology of the study including both the pre-injury priming versus immediate and post-injury timing of the topical application modalities, study time points and the non-invasive and invasive measures used.
Figure 1.
Study Methodology. A flowchart to demonstrate the methodology of the study including both the pre-injury priming versus immediate and post-injury timing of the topical application modalities, study time points and the non-invasive and invasive measures used.
Figure 2.
Consort Flow Diagram.
Figure 2.
Consort Flow Diagram.
Figure 3.
Punch biopsy methodology. Diagrammatic representation of the methodology for each of the groups (Pre-injury: pre-emptive priming (7-days), pre-injury: pre-emptive priming (3-days), day of injury (immediate application on day 0), post-injury (delayed 2 weeks post injury) including biopsy time points and time of topical applications. Each group applied both topical formulations twice daily for the duration of the study until week 8, with only the starting time point differing between groups.
Figure 3.
Punch biopsy methodology. Diagrammatic representation of the methodology for each of the groups (Pre-injury: pre-emptive priming (7-days), pre-injury: pre-emptive priming (3-days), day of injury (immediate application on day 0), post-injury (delayed 2 weeks post injury) including biopsy time points and time of topical applications. Each group applied both topical formulations twice daily for the duration of the study until week 8, with only the starting time point differing between groups.
Figure 4.
Mast cell tryptase (MCT) analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) MCT immunohistochemical marker images demonstrate a reduction with EGCG in all groups compared to placebo at weeks 4 and 8. (B) MCT measurements (#/mm2) showed that EGCG-treated scars were significantly lower at weeks 4 and 8 compared to placebo (p < 0.01) for all groups. Between group analysis demonstrated a significant difference at week 4 (Anova p = 0.001) and this was identified as Priming Group 1 (7 days priming) with the greatest differences compared to Group 2 (p = 0.002), Group 3 (p = 0.003) and Group 4 (p = 0.005). (C) Quantitative real-time reverse transcriptase–PCR (QRT-PCR) analysis confirmed down-regulation of MCT (p < 0.05) in EGCG samples compared to placebo at week 4 in all groups. Significance: ★ p ≤ 0.01. Error bars: mean ± SD. Scale bars = 50 μm. (DAPI = blue, MCT = orange).
Figure 4.
Mast cell tryptase (MCT) analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) MCT immunohistochemical marker images demonstrate a reduction with EGCG in all groups compared to placebo at weeks 4 and 8. (B) MCT measurements (#/mm2) showed that EGCG-treated scars were significantly lower at weeks 4 and 8 compared to placebo (p < 0.01) for all groups. Between group analysis demonstrated a significant difference at week 4 (Anova p = 0.001) and this was identified as Priming Group 1 (7 days priming) with the greatest differences compared to Group 2 (p = 0.002), Group 3 (p = 0.003) and Group 4 (p = 0.005). (C) Quantitative real-time reverse transcriptase–PCR (QRT-PCR) analysis confirmed down-regulation of MCT (p < 0.05) in EGCG samples compared to placebo at week 4 in all groups. Significance: ★ p ≤ 0.01. Error bars: mean ± SD. Scale bars = 50 μm. (DAPI = blue, MCT = orange).
Figure 5.
Mast cell chymase (MCC) analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) MCC images show a reduction at weeks 4 and 8 in EGCG samples compared to placebo in all groups. (B) MCC measurements (#/mm2) showed EGCG samples were significantly lower compared to placebo at weeks 4 and 8 (p < 0.01) in all groups. Between groups there were significant differences at week 4 (Anova p = 0.001). Group 1 had a greater difference than Group 3 (p = 0.01) and Group 4 (p = 0.001), and Group 2 had a larger difference than Group 4 (p = 0.009). (C) Subsequent QRT-PCR analysis confirmed down-regulation of MCC (p < 0.05) in EGCG samples compared to placebo at week 4 in all groups. Significance: ★ p ≤ 0.01. Error bars: mean ± SD. Scale bars = 50 μm. (DAPI = blue, MCC = green).
Figure 5.
Mast cell chymase (MCC) analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) MCC images show a reduction at weeks 4 and 8 in EGCG samples compared to placebo in all groups. (B) MCC measurements (#/mm2) showed EGCG samples were significantly lower compared to placebo at weeks 4 and 8 (p < 0.01) in all groups. Between groups there were significant differences at week 4 (Anova p = 0.001). Group 1 had a greater difference than Group 3 (p = 0.01) and Group 4 (p = 0.001), and Group 2 had a larger difference than Group 4 (p = 0.009). (C) Subsequent QRT-PCR analysis confirmed down-regulation of MCC (p < 0.05) in EGCG samples compared to placebo at week 4 in all groups. Significance: ★ p ≤ 0.01. Error bars: mean ± SD. Scale bars = 50 μm. (DAPI = blue, MCC = green).
Figure 6.
CKit analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) CKit staining images showed a reduction in mast cells with EGCG compared to placebo. (B) Further analysis showed a significant difference between EGCG and placebo samples measurements (#/mm2) at weeks 4 and 8 (p < 0.01) and between the groups at week 4 (Anova p = 0.01). The greatest difference was in Group 1 compared to Group 3 (p = 0.02) and Group 4 (p = 0.02). Significance: ★ p ≤ 0.01. Error bars: mean ± SD. Scale bars = 50 μm. (DAPI = blue, CKit = red).
Figure 6.
CKit analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) CKit staining images showed a reduction in mast cells with EGCG compared to placebo. (B) Further analysis showed a significant difference between EGCG and placebo samples measurements (#/mm2) at weeks 4 and 8 (p < 0.01) and between the groups at week 4 (Anova p = 0.01). The greatest difference was in Group 1 compared to Group 3 (p = 0.02) and Group 4 (p = 0.02). Significance: ★ p ≤ 0.01. Error bars: mean ± SD. Scale bars = 50 μm. (DAPI = blue, CKit = red).
Figure 7.
Immune cell marker analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo (Fc epsilon RI (FcεRI)). (A) FcεRI immunohistochemical images demonstrated a reduction in expression in EGCG samples compared to placebo. Scale bars = 50 μm. (B) There were greater levels of FcεRI in scar tissue compared to uninjured skin predominantly at scar edges and less centrally, and this was highest at week 4 in all groups. There was a significant reduction in FcεRI at week 4 in EGCG treated samples compared to placebo in all groups (p < 0.01) but no significant difference between groups. Significance: ★ p < 0.05 Scale bars = 50 μm.
Figure 7.
Immune cell marker analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo (Fc epsilon RI (FcεRI)). (A) FcεRI immunohistochemical images demonstrated a reduction in expression in EGCG samples compared to placebo. Scale bars = 50 μm. (B) There were greater levels of FcεRI in scar tissue compared to uninjured skin predominantly at scar edges and less centrally, and this was highest at week 4 in all groups. There was a significant reduction in FcεRI at week 4 in EGCG treated samples compared to placebo in all groups (p < 0.01) but no significant difference between groups. Significance: ★ p < 0.05 Scale bars = 50 μm.
Figure 8.
Immune cell marker analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo (Langerin). (A) Langerin immunohistochemical images showed reduced expression in EGCG samples compared to placebo samples. Scale bars = 20 μm. (B) Analysis of the total number of cells in the whole epidermis demonstrated a significant reduction in EGCG-treated samples compared to placebo samples at week 4 in Group 1 only (p = 0.02). No differences were observed between the groups. Significance: ★ p < 0.05 Scale bars = 50 μm.
Figure 8.
Immune cell marker analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo (Langerin). (A) Langerin immunohistochemical images showed reduced expression in EGCG samples compared to placebo samples. Scale bars = 20 μm. (B) Analysis of the total number of cells in the whole epidermis demonstrated a significant reduction in EGCG-treated samples compared to placebo samples at week 4 in Group 1 only (p = 0.02). No differences were observed between the groups. Significance: ★ p < 0.05 Scale bars = 50 μm.
Figure 9.
Immune cell analysis of total number of M1 macrophages in whole tissue. (A) M1 macrophage analysis demonstrated higher expression at week 4 compared to uninjured skin, reaching levels similar to uninjured skin by week 8 in treated and placebo samples in all groups. (B) There were no significant differences seen in EGCG samples compared to placebo samples or between the groups. Scale bars = 50 μm.
Figure 9.
Immune cell analysis of total number of M1 macrophages in whole tissue. (A) M1 macrophage analysis demonstrated higher expression at week 4 compared to uninjured skin, reaching levels similar to uninjured skin by week 8 in treated and placebo samples in all groups. (B) There were no significant differences seen in EGCG samples compared to placebo samples or between the groups. Scale bars = 50 μm.
Figure 10.
Immune cell analysis of total number of M2 macrophages in whole tissue. (A) There was an increase in M2 macrophages in both treated and placebo samples, with greater numbers seen in EGCG-treated scars by week 4 after injury compared with placebo scars. (B) Measurements showed that levels were similar when comparing placebo with EGCG treated samples at each time point. Scale bars = 50 μm.
Figure 10.
Immune cell analysis of total number of M2 macrophages in whole tissue. (A) There was an increase in M2 macrophages in both treated and placebo samples, with greater numbers seen in EGCG-treated scars by week 4 after injury compared with placebo scars. (B) Measurements showed that levels were similar when comparing placebo with EGCG treated samples at each time point. Scale bars = 50 μm.
Figure 11.
Immune cell analysis of total number of CD8T cells in whole tissue. (A) CD8T cell marker analysis showed that levels were higher than uninjured skin in all groups and in placebo and treated samples. (B) CD8T cell levels were similar at week 4 and at week 8 and no significant differences were noted between treated and placebo or between groups. Scale bars = 50 μm.
Figure 11.
Immune cell analysis of total number of CD8T cells in whole tissue. (A) CD8T cell marker analysis showed that levels were higher than uninjured skin in all groups and in placebo and treated samples. (B) CD8T cell levels were similar at week 4 and at week 8 and no significant differences were noted between treated and placebo or between groups. Scale bars = 50 μm.
Figure 12.
Clinical images of the scar sites over 8 weeks for each of the groups. Scars healed well in all groups and with both topical formulations. Scars were slightly paler in color with EGCG compared to placebo. No great visual differences were noted between the groups.
Figure 12.
Clinical images of the scar sites over 8 weeks for each of the groups. Scars healed well in all groups and with both topical formulations. Scars were slightly paler in color with EGCG compared to placebo. No great visual differences were noted between the groups.
Figure 13.
Clinical analysis of blood flow using non-invasive objective device; full-field laser perfusion imaging (FLPI). (A) FLPI images of epigallocatechin-3-gallate (EGCG) compared to placebo in all groups. (B) Group 1 FLPI measurements. (C) Group 2 FLPI measurements. (D) Group 3 FLPI measurements. (E) Group 4 FLPI measurements. (F) Between group comparison analysis for FLPI at week 1. Significance: ★ p ≤ 0.01.
Figure 13.
Clinical analysis of blood flow using non-invasive objective device; full-field laser perfusion imaging (FLPI). (A) FLPI images of epigallocatechin-3-gallate (EGCG) compared to placebo in all groups. (B) Group 1 FLPI measurements. (C) Group 2 FLPI measurements. (D) Group 3 FLPI measurements. (E) Group 4 FLPI measurements. (F) Between group comparison analysis for FLPI at week 1. Significance: ★ p ≤ 0.01.
Figure 14.
Clinical analysis of blood flow using non-invasive objective device; dynamic-optical coherence tomography (D-OCT). (A) D-OCT images of EGCG arms compared to placebo. (B) Group 1 D-OCT measurements. (C) Group 2 D-OCT measurements. (D) Group 3 D-OCT measurements. (E) Group 4 D-OCT measurements. (F) Group comparison analysis for D-OCT at week 1. (G) Group comparison analysis for D-OCT at week 2. (H) Group comparison analysis for D-OCT at week 8. Significance: ★ p ≤ 0.01.
Figure 14.
Clinical analysis of blood flow using non-invasive objective device; dynamic-optical coherence tomography (D-OCT). (A) D-OCT images of EGCG arms compared to placebo. (B) Group 1 D-OCT measurements. (C) Group 2 D-OCT measurements. (D) Group 3 D-OCT measurements. (E) Group 4 D-OCT measurements. (F) Group comparison analysis for D-OCT at week 1. (G) Group comparison analysis for D-OCT at week 2. (H) Group comparison analysis for D-OCT at week 8. Significance: ★ p ≤ 0.01.
Figure 15.
mRNA-sequencing results (Cluster analysis and Venn diagram). (A) Cluster analysis of differential expression genes. Hierarchical clustering analysis was carried out with the log10(FPKM + 1) of union differential expression genes of all comparison groups under different experimental conditions. Highly expressed genes are indicated in red, and genes with low expression are indicated in blue. Samples were ordered from those with lowest expression levels on the left to highest expression levels on the right side. (B) Venn diagrams to illustrate the number of common and unique differential expression genes among comparison groups. Group 1 had the greatest number of differentially expressed genes compared to all other groups.
Figure 15.
mRNA-sequencing results (Cluster analysis and Venn diagram). (A) Cluster analysis of differential expression genes. Hierarchical clustering analysis was carried out with the log10(FPKM + 1) of union differential expression genes of all comparison groups under different experimental conditions. Highly expressed genes are indicated in red, and genes with low expression are indicated in blue. Samples were ordered from those with lowest expression levels on the left to highest expression levels on the right side. (B) Venn diagrams to illustrate the number of common and unique differential expression genes among comparison groups. Group 1 had the greatest number of differentially expressed genes compared to all other groups.
Figure 16.
mRNA-sequencing results (Gene Ontology). Gene Ontology. The Gene Ontology (GO) enrichment analysis results are displayed through bar and dot plots. They display the number of genes that are significantly enriched in each GO term.
Figure 16.
mRNA-sequencing results (Gene Ontology). Gene Ontology. The Gene Ontology (GO) enrichment analysis results are displayed through bar and dot plots. They display the number of genes that are significantly enriched in each GO term.
Figure 17.
Angiogenesis marker CD31 analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) Cluster of differentiation 31 (CD31) images demonstrated a reduction in vessel density in EGCG samples compare to placebo. (B) CD31 vessel density measurements. (C) Quantitative real-time reverse transcriptase–PCR (QRT-PCR) analysis for CD31. Significance: ★ p ≤ 0.01. Error bars: mean ± SD. Scale bars = 50 μm.
Figure 17.
Angiogenesis marker CD31 analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) Cluster of differentiation 31 (CD31) images demonstrated a reduction in vessel density in EGCG samples compare to placebo. (B) CD31 vessel density measurements. (C) Quantitative real-time reverse transcriptase–PCR (QRT-PCR) analysis for CD31. Significance: ★ p ≤ 0.01. Error bars: mean ± SD. Scale bars = 50 μm.
Figure 18.
Angiogenesis marker Vascular Endothelial Growth Factor A (VEGF-A) analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) VEGF-A images also confirmed a decrease in EGCG samples compared to placebo. (B) VEGF-A (epidermal and dermal) percentage marker area measurements. (C) QRT-PCR of VEGF-A. Significance: ★ p ≤ 0.01. Error bars: mean ± SD. Scale bars = 50 μm.
Figure 18.
Angiogenesis marker Vascular Endothelial Growth Factor A (VEGF-A) analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) VEGF-A images also confirmed a decrease in EGCG samples compared to placebo. (B) VEGF-A (epidermal and dermal) percentage marker area measurements. (C) QRT-PCR of VEGF-A. Significance: ★ p ≤ 0.01. Error bars: mean ± SD. Scale bars = 50 μm.
Figure 19.
Antioxidant Heme-oxygenase 1 (HO-1) effects of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) HO-1 immunohistochemical stain images. (B) HO-1 percentage marker area measurements. Scale bars = 100 μm. Error bars: mean ± SD. Significance: ★ p ≤ 0.01.
Figure 19.
Antioxidant Heme-oxygenase 1 (HO-1) effects of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) HO-1 immunohistochemical stain images. (B) HO-1 percentage marker area measurements. Scale bars = 100 μm. Error bars: mean ± SD. Significance: ★ p ≤ 0.01.
Figure 20.
Antioxidant Nuclear factor erythroid 2-related factor 2 (NRF2) effects of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) NRF2 immunohistochemical stain images. (B) NRF2 percentage marker area measurements. Scale bars = 100 μm. Error bars: mean ± SD. Significance: ★ p ≤ 0.01.
Figure 20.
Antioxidant Nuclear factor erythroid 2-related factor 2 (NRF2) effects of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) NRF2 immunohistochemical stain images. (B) NRF2 percentage marker area measurements. Scale bars = 100 μm. Error bars: mean ± SD. Significance: ★ p ≤ 0.01.
Figure 21.
Skin thickness analysis (High frequency ultrasound (HFUS)) of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) Images of skin/scar thickness using high frequency ultrasound (HFUS). (B) Group 1 skin thickness HFUS. (C) Group 2 skin thickness HFUS. (D) Group 3 skin thickness HFUS. (E) Group 4 skin thickness HFUS. Significance: ★ p ≤ 0.01. Error bars: mean ± SD. Scale bars = 100 μm.
Figure 21.
Skin thickness analysis (High frequency ultrasound (HFUS)) of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) Images of skin/scar thickness using high frequency ultrasound (HFUS). (B) Group 1 skin thickness HFUS. (C) Group 2 skin thickness HFUS. (D) Group 3 skin thickness HFUS. (E) Group 4 skin thickness HFUS. Significance: ★ p ≤ 0.01. Error bars: mean ± SD. Scale bars = 100 μm.
Figure 22.
H + E skin/scar thickness. H + E scar thickness measurements demonstrated reduced scar thickness with EGCG at weeks 4 and 8 in Group 1 (p = 0.03, p = 0.03, respectively), Group 2 (p = 0.04, p = 0.002, respectively) and Group 4 (p = 0.01, p = 0.03, respectively). Significance: ★ p < 0.05.
Figure 22.
H + E skin/scar thickness. H + E scar thickness measurements demonstrated reduced scar thickness with EGCG at weeks 4 and 8 in Group 1 (p = 0.03, p = 0.03, respectively), Group 2 (p = 0.04, p = 0.002, respectively) and Group 4 (p = 0.01, p = 0.03, respectively). Significance: ★ p < 0.05.
Figure 23.
Herovici analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) Herovici images demonstrating mature and immature collagen. (B) Herovici collagen I:III ratio analysis. Error bars: mean ± SD. Scale bars = 100 μm.
Figure 23.
Herovici analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) Herovici images demonstrating mature and immature collagen. (B) Herovici collagen I:III ratio analysis. Error bars: mean ± SD. Scale bars = 100 μm.
Figure 24.
Clinical elastin probe analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) Clinical elastin probe viscoelasticity measurements are presented for Group 1. (B) Group 2 viscoelasticity measurements. (C) Group 3 viscoelasticity measurements. (D) Group 4 viscoelasticity measurements. (E) Between group comparisons for viscoelasticity at week 8. Significance: ★ p ≤ 0.01.
Figure 24.
Clinical elastin probe analysis of topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) Clinical elastin probe viscoelasticity measurements are presented for Group 1. (B) Group 2 viscoelasticity measurements. (C) Group 3 viscoelasticity measurements. (D) Group 4 viscoelasticity measurements. (E) Between group comparisons for viscoelasticity at week 8. Significance: ★ p ≤ 0.01.
Figure 25.
Immunohistochemical analysis of elastin for topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) Immunohistochemical images for elastin. (B) Elastin percentage marker area measurements. (C) Quantitative real-time reverse transcriptase–PCR (QRT-PCR) analysis for elastin. Significance: ★ p ≤ 0.01. Error bars: mean ± SD. Scale bars = 100 μm.
Figure 25.
Immunohistochemical analysis of elastin for topical epigallocatechin-3-gallate (EGCG) versus placebo. (A) Immunohistochemical images for elastin. (B) Elastin percentage marker area measurements. (C) Quantitative real-time reverse transcriptase–PCR (QRT-PCR) analysis for elastin. Significance: ★ p ≤ 0.01. Error bars: mean ± SD. Scale bars = 100 μm.
Figure 26.
Key findings: Topical Epigallocatechin-3-gallate (EGCG) reduces angiogenesis, mast cells and increases elastin content in human skin scarring. A summary of the methodology of the study and the key outcomes linked with the corresponding time points.
Figure 26.
Key findings: Topical Epigallocatechin-3-gallate (EGCG) reduces angiogenesis, mast cells and increases elastin content in human skin scarring. A summary of the methodology of the study and the key outcomes linked with the corresponding time points.
Table 1.
Demographic data. Demographic information for 40 healthy volunteers.
Table 1.
Demographic data. Demographic information for 40 healthy volunteers.
Demographics | Characteristics | Number | Percentage (%) |
---|
Participants | Total | 40 | 100 |
Gender | Male | 15 | 37.5 |
| Female | 25 | 62.5 |
Ethnicity | Caucasian | 38 | 95 |
| Other | 2 | 5 |
Age (years) | 21–30 | 23 | 57.5 |
| 31–35 | 17 | 42.5 |
Table 2.
Objective non-invasive device modalities which were used at each weekly time point over 8 weeks during this study to monitor the progression of healing.
Table 2.
Objective non-invasive device modalities which were used at each weekly time point over 8 weeks during this study to monitor the progression of healing.
Objective Non-Invasive Device | Description |
---|
Full-field Laser Perfusion Imaging (FLPI) (Moor Instruments Ltd., Axminster, UK) | - -
Measures blood flow in the skin’s microcirculation - -
Tissue thickness sampled is 1 mm - -
Capillary diameters up to 10 μm - -
Flow rates of 0.01–10 mm/s
|
Dynamic-optical coherence tomography (D-OCT) (Vivosight, Michaelson, UK) | - -
Detects high-speed changes in back-scattered light caused by moving cells in vessels and produces blood flow measurements by depth - -
Uses low-coherence near infrared light - -
Lateral optical resolution of <7.5 μm - -
Axial resolution of 10 μm - -
Penetration depth approximately 1.2–1.8 mm - -
Scan area of 6 mm × 6 mm
|
High-frequency ultrasound (HFUS) (DermaScan-C, Cortex Technologies, Denmark) | - -
Uses sound waves and provides measure of skin thickness - -
Ultrasonic waves partially reflected at the boundary between adjacent structures and produce echoes of different amplitudes - -
50 MHz probe - -
Resolution of 30 × 60 μm - -
Penetration depth of 3 mm - -
Scan area of 2.7 × 6 mm
|
Elastin Probe (Dermalab) (Dermalab, Cortex Technologies, Denmark) | - -
Principle: Stress/strain by preset vacuum - -
Measures ViscoElasticity - -
Probe: 10 mm suction aperture - -
Low weight (approx. 7 g) for minimum skin bias.
|
Table 3.
Immunohistochemical antibodies. Primary antibodies, secondary antibodies, concentration of antibodies, incubation times and detection methods used for immunohistochemistry in this study.
Table 3.
Immunohistochemical antibodies. Primary antibodies, secondary antibodies, concentration of antibodies, incubation times and detection methods used for immunohistochemistry in this study.
Primary Antibody Name, Product Code and Company | Primary Antibody Raised Species, Isotype and Concentration | Primary ANTIBODY Incubation Details | Secondary Antibody, Company, Concentration, Incubation Details | Detection Method |
---|
Mast cell tryptase Ab2378, Abcam, Cambridge, UK | Mouse (monoclonal), IgG1, 1:2000 dilution | Overnight, 4 °C | Alexa Fluor® 647 Goat anti-mouse IgG 1:200 Abcam, ab150119 (30 min room temp) | Fluorescence |
Mast cell chymase Ab186417, Abcam, Cambridge, UK | Rabbit (monoclonal), IgG, 1:1000 dilution | Overnight, 4 °C | Alexa Fluor® 488 Goat anti-rabbit IgG 1:200 Abcam, A-11034 (30 min room temp) | Fluorescence |
CKIT (CD117) A4502, Dako, UK | Rabbit (polyclonal) IgG, 1:200 dilution | Overnight, 4 °C | Alexa Fluor® 546 Goat anti-rabbit IgG 1:200 Abcam, A-11010 (30 min room temp) | Fluorescence |
Anti-Fc epsilon RI Ab54411, Abcam, Cambridge, UK | Mouse (monoclonal) IgG2b, 1:100 dilution | Overnight, 4 °C | Universal antibody by Novolink TM Leica Biosystems Newcastle ltd, Newcastle Upon Tyne, UK cat. RE7150-K (1 h room temp) | Peroxidase |
Langerin Ab192027, Abcam, Cambridge, UK | Rabbit (monoclonal) IgG, 1:1000 dilution | 1 h, room temperature | Universal antibody by Novolink TM Leica Biosystems Newcastle ltd, Newcastle Upon Tyne, UK cat. RE7150-K (1 h room temp) | Peroxidase |
CD68 (For M1/M2) M0718, Dako, UK | Mouse (monoclonal) EBM11, 1:50 dilution | Overnight, 4 °C | Alexa Fluor™ 647 Goat anti-mouse IgG 1:200 Abcam, ab150119 (45 min room temp) | Fluorescence |
HLA DR + DP + DQ (MHC Class II) (For M1) Ab7856, Abcam, Cambridge, UK | Mouse (monoclonal) IgG1, 1:800 dilution | Overnight, 4 °C | Alexa Fluor™ 546 Goat anti-mouse IgG 1:400 Invitrogen, A11010 (45 min room temp) | Fluorescence |
CD206 (For M2) Ab64693, Abcam, Cambridge, UK | Rabbit (polyclonal) IgG, 1:1000 dilution | Overnight, 4 °C | Alexa Fluor™ 488 Goat anti-mouse IgG 1:400 Abcam, A-11034 (45 min room temp) | Fluorescence |
VEGF-A, Ab1316, Abcam, Cambridge, UK | Mouse (monoclonal), IgG1, 1:100 dilution | Overnight, 4 °C | Universal antibody by Novolink TM Leica Biosystems Newcastle ltd, Newcastle Upon Tyne, UK cat. RE7150-K (1 h room temp) | Peroxidase |
CD31, Ab134168, Abcam, Cambridge, UK | Rabbit (monoclonal), IgG, 1:300 dilution | 1 h, room temperature | Universal antibody by Novolink TM Leica Biosystems Newcastle ltd, Newcastle Upon Tyne, UK cat. RE7150-K (1 h room temp) | Peroxidase |
Heme-oxygenase 1 Ab13248, Abcam, Cambridge, UK | Mouse (monoclonal), IgG1, 1:1000 dilution | Overnight, 4 °C | Universal antibody by Novolink TM Leica Biosystems Newcastle ltd, Newcastle Upon Tyne, UK cat. RE7150-K (1 h room temp) | Peroxidase |
Nrf2 Ab31163, Abcam, Cambridge, UK | Rabbit (polyclonal) IgG, 1:500 dilution | Overnight, 4 °C | Universal antibody by Novolink TM Leica Biosystems Newcastle ltd, Newcastle Upon Tyne, UK cat. RE7150-K (1 h room temp) | Peroxidase |
ElastinAb23747, Abcam, Cambridge, UK | Rabbit (polyclonal), IgG, 1:600 dilution | Overnight, 4 °C | Universal antibody by Novolink TM Leica Biosystems Newcastle ltd, Newcastle Upon Tyne, UK cat. RE7150-K (1 h room temp) | Peroxidase |
Table 4.
mRNA-Sequencing Software.
Table 4.
mRNA-Sequencing Software.
Analysis | Software | Version | Parameters | Remarks |
---|
Mapping to reference genome | STAR | V2.5 | -outFilterMismatchNmax 2 | |
Quantification | HTSeq | v0.6.1 | -m union | |
Differential Expression Analysis | DEGseq | v1.34.1 | |log2Fold change| > 1 && Padj < 0.005 | Without biological replicates |
DESeq2 | v1.20.0 | Padj < 0.05 | With biological replicates |
GO Enrichment | GOSeq, topGO, hmmscan | v1.34.1 | Padj < 0.05 | padj < 0.05 were considered significantly enriched |
KEGG Pathway Enrichment | KOBAS | v3.0 | Padj < 0.05 | padj < 0.05 were considered significantly enriched |
Reactome Enrichment | clusterProfiler | v3.8.1 | Padj < 0.05 | padj < 0.05 were considered significantly enriched |
Alternative Splicing | rMATS | v4.0.2 | -cstat 0.0001 -libType | |
Mutation | GATK | v3.8 | FS > 30.0 and QD < 2.0 | |
Table 5.
Details of primers and probes used for QRT-PCR.
Table 5.
Details of primers and probes used for QRT-PCR.
Gene Name | Primers (bp) | Accession Number | Probe Number (Roche) |
---|
FP: Forward Primer |
---|
RP: Reverse Primer |
---|
Vascular endothelial growth factor A (VEGF-A) | FP: TGCCCGCTGCTGTCTAAT (18) | NM_001025366.2 | 1 |
RP: TCTCCGCTCTGAGCAAGG (18) |
Cluster of differentiation 31 (CD31) (PECAM-1) | FP: CAAAGACAACCCCACTGAAGAC (22) | NM_000442.4 | 24 |
RP: CGCAATGATCAAGAGAGCAATG (22) |
Mast cell tryptase (TPSAB1) | FP: GCGATGTGGACAATGATGAG (20) | NM_003294.3 | 6 |
RP: TCCATTATGGGGACCTTCAC (20) |
Mast cell chymase (CMA1) | FP: ACGGAACTTTGTGCTGACG (19) | NM_001836.4 | 4 |
RP: GGCTCCAAGGGTGACTGTTA (20) |
Elastin (ELN) | FP: CAGCTAAATACGGTGCTGCTG (21) | NM_000501.3 | 27 |
RP: AATCCGAAGCCAGGTCTTG (19) |
Ribosomal protein L32 (RPL32) | FP: CCGTCCCTTCTCTCTTCCTC (20) | NM_001007073.1 | 10 |
RP: TGTCGCAGAGTGTCTTCCAA (20) |
Succinate Dehydrogenase Complex Flavoprotein Subunit A (SDHA) | FP: CAGACCATCTACGGAGCAGAG (21) | NM_004168.3 | 12 |
RP: GATGGGCTTGGAGTAATCGT (20) |
Table 6.
Table of differentially expressed downregulated genes for Group 1 at week 4. The table gives an example of the first 20 most differentially expressed genes which were downregulated with EGCG compared to placebo in Group 1 at week 4. The yellow highlighted cells represent the hemoglobin genes that were downregulated with EGCG.
Table 6.
Table of differentially expressed downregulated genes for Group 1 at week 4. The table gives an example of the first 20 most differentially expressed genes which were downregulated with EGCG compared to placebo in Group 1 at week 4. The yellow highlighted cells represent the hemoglobin genes that were downregulated with EGCG.
Number | Gene ID | Group 1 (EGC—Week 4) Value | Group 1 (Placebo—Week 4) Value | Log2 Fold Change | p Value | Padjust | Significance | Gene Name |
---|
1 | ENSG00000244734 | 18.56061 | 225.2407 | −3.60115 | 2.81074 × 10−53 | 5.78282 × 10−49 | TRUE | HBB |
2 | ENSG00000188536 | 4.112765 | 40.62404 | −3.30415 | 3.67202 × 10−28 | 3.77741 × 10−24 | TRUE | HBA2 |
3 | ENSG00000022556 | 0.393985 | 3.272487 | −3.05417 | 1.70303 × 10−14 | 1.16794 × 10−10 | TRUE | NLRP2 |
4 | ENSG00000125740 | 2.008868 | 5.408491 | −1.42884 | 1.91979 × 10−9 | 5.64253 × 10−6 | TRUE | FOSB |
5 | ENSG00000269821 | 0.067574 | 0.230412 | −1.76967 | 1.21023 × 10−7 | 0.000177853 | TRUE | KCNQ1OT1 |
6 | ENSG00000188487 | 1.146598 | 3.394829 | −1.56598 | 3.31126 × 10−7 | 0.000454173 | TRUE | INSC |
7 | ENSG00000235790 | 2.764742 | 10.97189 | −1.98859 | 3.77457 × 10−7 | 0.000485363 | TRUE | RP11-73M7.6 |
8 | ENSG00000206172 | 0.363042 | 3.016038 | −3.05445 | 6.16103 × 10−7 | 0.000667142 | TRUE | HBA1 |
9 | ENSG00000153404 | 1.660928 | 4.729576 | −1.50972 | 9.92432 × 10−7 | 0.001020915 | TRUE | PLEKHG4B |
10 | ENSG00000251179 | 0.946775 | 4.310849 | −2.18688 | 3.62523 × 10−6 | 0.002983423 | TRUE | TMEM92-AS1 |
11 | ENSG00000143127 | 7.800331 | 19.39026 | −1.31372 | 4.01682 × 10−6 | 0.003178539 | TRUE | ITGA10 |
12 | ENSG00000123500 | 9.860847 | 24.65212 | −1.32193 | 1.07717 × 10−5 | 0.007641981 | TRUE | COL10A1 |
13 | ENSG00000214548 | 87.26785 | 236.9831 | −1.44126 | 1.36264 × 10−5 | 0.009043557 | TRUE | MEG3 |
14 | ENSG00000280434 | 0.051907 | 0.219281 | −2.07878 | 1.66595 × 10−5 | 0.010386463 | TRUE | RP4-671O14.6 |
15 | ENSG00000009694 | 1.286276 | 2.949952 | −1.19749 | 1.94901 × 10−5 | 0.011234653 | TRUE | TENM1 |
16 | ENSG00000121904 | 2.304434 | 5.345737 | −1.21398 | 1.86173 × 10−5 | 0.011234653 | TRUE | CSMD2 |
17 | ENSG00000153707 | 7.23834 | 13.25146 | −0.87242 | 1.96582 × 10−5 | 0.011234653 | TRUE | PTPRD |
18 | ENSG00000198796 | 4.718508 | 9.722793 | −1.04304 | 2.37611 × 10−5 | 0.012864772 | TRUE | ALPK2 |
19 | ENSG00000157680 | 2.948852 | 7.57578 | −1.36124 | 2.89488 × 10−5 | 0.014679513 | TRUE | DGKI |
20 | ENSG00000271811 | 0.310289 | 1.285483 | −2.05062 | 3.09708 × 10−5 | 0.015171256 | TRUE | RP1-79C4.4 |
Table 7.
Uninjured skin analysis. Table displaying the percentage differences between EGCG treated uninjured skin and placebo treated uninjured skin in Groups 1 and 2 pre-emptive priming groups for different parameters measured. Group 1 (Pre-injury: pre-emptive priming 7 days), Group 2 (Pre-injury: pre-emptive priming 3 days).
Table 7.
Uninjured skin analysis. Table displaying the percentage differences between EGCG treated uninjured skin and placebo treated uninjured skin in Groups 1 and 2 pre-emptive priming groups for different parameters measured. Group 1 (Pre-injury: pre-emptive priming 7 days), Group 2 (Pre-injury: pre-emptive priming 3 days).
Uninjured Skin Analysis | Parameter | Group 1 (%) | Group 2 (%) |
---|
Non-invasive device analysis | FLPI | −5 | −8 |
D-OCT | −22 | −24 |
Elastin | 0.4 | 0.1 |
HFUS | 0.6 | 0.4 |
Immunohistochemical analysis | MCT | −15 | −7 |
MCC | −16 | −14 |
CKIT | −17 | −15 |
FcεRI | −17 | −3 |
Langerin | −4 | −5 |
CD31 | −10 | −10 |
VEGF-A | −11 | −8 |
HO−1 | 4 | 8 |
NRF2 | 6 | −2 |
Elastin | 7 | 3 |