Immunomodulatory Properties of Pomegranate Peel Extract in a Model of Human Peripheral Blood Mononuclear Cell Culture
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Protocol
2.2. Plant Material and Extractions
2.3. HPLC Analysis
2.4. PBMC Cultures
2.5. MTT Assay
2.6. Apoptosis/Necrosis Assay
2.7. Quantification of Autophagy by Acridine Orange Staining
2.8. Quantification of Oxidative Stress
2.9. Quantification of PHA-Stimulated PBMCs Proliferation
2.10. Flow Cytometry
2.11. Real-Time Quantitative PCR
2.12. Cytokine Measurement
2.13. Statistical Analysis
3. Results
3.1. Characterization of Polyphenols from PoPEX
3.2. Dose-Dependent Cytotoxicity of PoPEx in Human PBMC Culture
3.3. Modulatory Effect of PoPEx on Autophagy in PBMC Culture
3.4. Modulatory Effect of PoPEx on Oxidative Stress in PBMC Cultures
3.5. Dose-Dependent Effect of PoPEx on Cell Proliferation and T-Cell Subset Changes in PBMC Culture Stimulated with PHA
3.6. PoPEx Differently Modulates the Expression of Activation/Inhibitory Molecules on T Cell Subsets
3.7. PoPEx Differently Modulates Cytokine Production in PHA-Stimulated PBMC Cultures
3.8. Modulatory Effect of PoPEx on Tregs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Baradaran Rahimi, V.; Ghadiri, M.; Ramezani, M.; Askari, V.R. Antiinflammatory and anti-cancer activities of pomegranate and its constituent, ellagic acid: Evidence from cellular, animal, and clinical studies. Phytother. Res. 2020, 34, 685–720. [Google Scholar] [CrossRef] [PubMed]
- Ismail, T.; Sestili, P.; Akhtar, S. Pomegranate peel and fruit extracts: A review of potential anti-inflammatory and anti-infective effects. J. Ethnopharmacol. 2012, 143, 397–405. [Google Scholar] [CrossRef] [PubMed]
- Omer, H.A.A.; Abdel-Magid, S.S.; Awadalla, I.M. Nutritional and chemical evaluation of dried pomegranate (Punica granatum L.) peels and studying the impact of level of inclusion in ration formulation on productive performance of growing Ossimi lambs. Bull. Natl. Res. Cent. 2019, 43, 1–10. [Google Scholar] [CrossRef]
- Valentina, S.; Spyros, P.; Aliki, T.; Vladimiros, L.; Aikaterini, T.; Giannis, P.; Alexandros, D.; Ioannis, T. Anti-Inflammatory Properties of Pomegranate. Int. J. Adv. Res. Microbiol. Immunol. 2020, 2, 1–13. [Google Scholar]
- Karaaslan, M.; Vardin, H.; Varlıklıöz, S.; Yılmaz, F.M. Antiproliferative and antioxidant activities of Turkish pomegranate (Punica granatum L.) accessions. Int. J. Food Sci. Technol. 2014, 49, 82–90. [Google Scholar] [CrossRef]
- Rahimi, V.B.; Askari, V.R.; Mousavi, S.H. Ellagic acid reveals promising anti-aging effects against d-galactose-induced aging on human neuroblastoma cell line, SH-SY5Y: A mechanistic study. Biomed. Pharm. 2018, 108, 1712–1724. [Google Scholar] [CrossRef]
- Di Nunzio, M.; Toselli, M.; Verardo, V.; Caboni, M.F.; Bordoni, A. Counteraction of oxidative damage by pomegranate juice: Influence of the cultivar. J. Sci. Food Agric. 2013, 93, 3565–3573. [Google Scholar] [CrossRef]
- Charanjit Kaur, R.K.; Abhijit, K.; Chirag, G.; Sangita, S.; Praveen, K.; Ram, C.; Sarika, J.; Islam, K. Characterization of antioxidants and hypoglycemic potential of pomegranate grown in India: A preliminary investigation. J. Food Biochem. 2014, 38, 397–406. [Google Scholar] [CrossRef]
- Grabeža, M.; Škrbić, R.; Stojiljković, M.P.; Rudić-Grujić, V.; Paunović, M.; Arsić, A.; Petrović, S.; Vučić, V.; Mirjanić-Azarić, B.; Šavikin, K.; et al. Beneficial effects of pomegranate peel extract on plasma lipid profile, fatty acids levels and blood pressure in patients with diabetes mellitus type-2: A randomized, double-blind, placebo-controlled study. J. Funct. Foods 2020, 64, 103692. [Google Scholar] [CrossRef]
- Maryam, P.; Nicola, C.; Abdur, R.; Mohammad, A.S.; Zhanibek, Y.; Muhammad, U.K.; Muhammad, I.; Mohammad, S.M. Pomegranate as a source of bioactive constituents: A review on their characterization, properties and applications. Crit. Rev. Food Sci. Nutr. 2020, 61, 982–999. [Google Scholar]
- Allam, G.; Abuelsaad, A.S.; Alblihed, M.A.; Alsulaimani, A.A. Ellagic acid reduces murine schistosomiasis mansoni immunopathology via up-regulation of IL-10 and down-modulation of pro-inflammatory cytokines production. Immunopharmacol. Immunotoxicol. 2016, 38, 286–297. [Google Scholar] [CrossRef]
- Valentina, S.; Dimitris, T.; Dionisios, A.; Spiros, P.; Giannis, P.; Anna Maria, G.; Maria, M.; Aspasia, A.; Vladimiros, L. Pomegranate as an anti-viral agent and immune system stimulant. Int. J. Adv. Res. Microbiol. Immunol. 2021, 3, 1–12. [Google Scholar]
- Surucic, R.; Tubic, B.; Stojiljkovic, M.P.; Djuric, D.M.; Travar, M.; Grabez, M.; Savikin, K.; Skrbic, R. Computational study of pomegranate peel extract polyphenols as potential inhibitors of SARS-CoV-2 virus internalization. Mol. Cell Biochem. 2021, 476, 1179–1193. [Google Scholar] [CrossRef] [PubMed]
- Schieber, M.; Chandel, N.S. ROS function in redox signaling and oxidative stress. Curr. Biol. 2014, 24, R453–R462. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shaygannia, E.; Bahmani, M.; Zamanzad, B.; Rafieian-Kopaei, M. A Review Study on Punica granatum L. J. Evid. Based Complement. Altern. Med. 2016, 21, 221–227. [Google Scholar] [CrossRef] [Green Version]
- Negi, P.S.; Jayaprakasha, G.K.; Jena, B.S. Antioxidant and antimutagenic activities of pomegranate peel extracts. Food Chem. 2003, 80, 393–397. [Google Scholar] [CrossRef]
- Mise Yonar, S.; Yonar, M.E.; Yonturk, Y.; Pala, A. Effect of ellagic acid on some haematological, immunological and antioxidant parameters of rainbow trout (Oncorhynchus mykiss). J. Anim. Physiol. Anim. Nutr. 2014, 98, 936–941. [Google Scholar] [CrossRef]
- Peng, S.Y.; Lin, L.C.; Chen, S.R.; Farooqi, A.A.; Cheng, Y.B.; Tang, J.Y.; Chang, H.W. Pomegranate Extract (POMx) Induces Mitochondrial Dysfunction and Apoptosis of Oral Cancer Cells. Antioxidants 2021, 10, 1117. [Google Scholar] [CrossRef]
- Aman, Y.; Schmauck-Medina, T.; Hansen, M.; Morimoto, R.I.; Simon, A.K.; Bjedov, I.; Palikaras, K.; Simonsen, A.; Johansen, T.; Tavernarakis, N.; et al. Autophagy in healthy aging and disease. Nat. Aging 2021, 1, 634–650. [Google Scholar] [CrossRef]
- Colombo, E.; Sangiovanni, E.; Dell’agli, M. A review on the anti-inflammatory activity of pomegranate in the gastrointestinal tract. Evid. Based Complement. Altern. Med. 2013, 2013, 247145. [Google Scholar] [CrossRef] [Green Version]
- Singh, K.; Jaggi, A.S.; Singh, N. Exploring the ameliorative potential of Punica granatum in dextran sulfate sodium induced ulcerative colitis in mice. Phytother. Res. 2009, 23, 1565–1574. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Banerjee, N.; Ivanov, I.; Pfent, C.M.; Prudhomme, K.R.; Bisson, W.H.; Dashwood, R.H.; Talcott, S.T.; Mertens-Talcott, S.U. Comparison of anti-inflammatory mechanisms of mango (Mangifera Indica L.) and pomegranate (Punica Granatum L.) in a preclinical model of colitis. Mol. Nutr. Food Res. 2016, 60, 1912–1923. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shukla, M.; Gupta, K.; Rasheed, Z.; Khan, K.A.; Haqqi, T.M. Consumption of hydrolyzable tannins-rich pomegranate extract suppresses inflammation and joint damage in rheumatoid arthritis. Nutrition 2008, 24, 733–743. [Google Scholar] [CrossRef] [Green Version]
- Fikry, E.M.; Gad, A.M.; Eid, A.H.; Arab, H.H. Caffeic acid and ellagic acid ameliorate adjuvant-induced arthritis in rats via targeting inflammatory signals, chitinase-3-like protein-1 and angiogenesis. Biomed. Pharm. 2019, 110, 878–886. [Google Scholar] [CrossRef] [PubMed]
- Morzelle, M.C.; Salgado, J.M.; Telles, M.; Mourelle, D.; Bachiega, P.; Buck, H.S.; Viel, T.A. Neuroprotective Effects of Pomegranate Peel Extract after Chronic Infusion with Amyloid-beta Peptide in Mice. PLoS ONE 2016, 11, e0166123. [Google Scholar] [CrossRef]
- Houston, D.M.; Bugert, J.; Denyer, S.P.; Heard, C.M. Anti-inflammatory activity of Punica granatum L. (Pomegranate) rind extracts applied topically to ex vivo skin. Eur. J. Pharm. Biopharm. 2017, 112, 30–37. [Google Scholar] [CrossRef]
- de Oliveira, J.F.; Garreto, D.V.; da Silva, M.C.; Fortes, T.S.; de Oliveira, R.B.; Nascimento, F.R.; Da Costa, F.B.; Grisotto, M.A.; Nicolete, R. Therapeutic potential of biodegradable microparticles containing Punica granatum L. (pomegranate) in murine model of asthma. Inflamm. Res. 2013, 62, 971–980. [Google Scholar] [CrossRef]
- Pinheiro, A.; Goncalves, J.S.; Dourado, A.W.A.; de Sousa, E.M.; Brito, N.M.; Silva, L.K.; Batista, M.C.A.; de Sa, J.C.; Monteiro, C.; Fernandes, E.S.; et al. Punica granatum L. Leaf Extract Attenuates Lung Inflammation in Mice with Acute Lung Injury. J. Immunol. Res. 2018, 2018, 6879183. [Google Scholar]
- Bachoual, R.; Talmoudi, W.; Boussetta, T.; Braut, F.; El-Benna, J. An aqueous pomegranate peel extract inhibits neutrophil myeloperoxidase in vitro and attenuates lung inflammation in mice. Food Chem. Toxicol. 2011, 49, 1224–1228. [Google Scholar] [CrossRef]
- Ghavipour, M.; Sotoudeh, G.; Tavakoli, E.; Mowla, K.; Hasanzadeh, J.; Mazloom, Z. Pomegranate extract alleviates disease activity and some blood biomarkers of inflammation and oxidative stress in Rheumatoid Arthritis patients. Eur. J. Clin. Nutr. 2017, 71, 92–96. [Google Scholar] [CrossRef]
- Balbir-Gurman, A.; Fuhrman, B.; Braun-Moscovici, Y.; Markovits, D.; Aviram, M. Consumption of pomegranate decreases serum oxidative stress and reduces disease activity in patients with active rheumatoid arthritis: A pilot study. Isr. Med. Assoc. J. 2011, 13, 474–479. [Google Scholar] [PubMed]
- Razani, Z.; Dastani, M.; Kazerani, H.R. Cardioprotective Effects of Pomegranate (Punica granatum) Juice in Patients with Ischemic Heart Disease. Phytother. Res. 2017, 31, 1731–1738. [Google Scholar] [CrossRef] [PubMed]
- Hosseini, B.; Saedisomeolia, A.; Wood, L.G.; Yaseri, M.; Tavasoli, S. Effects of pomegranate extract supplementation on inflammation in overweight and obese individuals: A randomized controlled clinical trial. Complement. Clin. Pr. 2016, 22, 44–50. [Google Scholar] [CrossRef] [PubMed]
- Ertam, I.; Mutlu, B.; Unal, I.; Alper, S.; Kivcak, B.; Ozer, O. Efficiency of ellagic acid and arbutin in melasma: A randomized, prospective, open-label study. J. Derm. 2008, 35, 570–574. [Google Scholar] [CrossRef]
- Da Cunha, L.R.; Muniz-Junqueira, M.I.; Dos Santos Borges, T.K. Impact of polyphenols in phagocyte functions. J. Inflamm. Res. 2019, 12, 205–217. [Google Scholar] [CrossRef] [Green Version]
- Shakoor, H.; Feehan, J.; Apostolopoulos, V.; Platat, C.; Al Dhaheri, A.S.; Ali, H.I.; Ismail, L.C.; Bosevski, M.; Stojanovska, L. Immunomodulatory Effects of Dietary Polyphenols. Nutrients 2021, 13, 728. [Google Scholar] [CrossRef]
- Laily, N.; Harahap, A.R.; Aji, G.K.; Sukarti, I.; Ascobat, P.; Wijayanti, R.D.E. Potential use of Pomegranate (Punica granatum) Extract as an Immune-Stimulant Based on in vitro and in vitro Models. Mal. J. Nutr. 2016, 22, 279–287. [Google Scholar]
- Soha, H.M.; Mahmoud, R.M.; Ashoush, I.S.; Attia, M.Y. Immunomodulatory and Antioxidant Activity of Pomegranate Juice Incorporated with Spirulina and Echinacea Extracts Sweetened By Stevioside. J. Agric. Vet. Sci. 2015, 8, 161–174. [Google Scholar]
- Du, L.; Li, J.; Zhang, X.; Wang, L.; Zhang, W.; Yang, M.; Hou, C. Pomegranate peel polyphenols inhibits inflammation in LPS-induced RAW264.7 macrophages via the suppression of TLR4/NF-kappaB pathway activation. Food Nutr. Res. 2019, 63, 62–69. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.Y.; Kina, T.; Iwanaga, Y.; Noguchi, H.; Matsumura, K.; Hyon, S.H. Tea polyphenol inhibits allostimulation in mixed lymphocyte culture. Cell Transplant. 2007, 16, 75–83. [Google Scholar] [CrossRef] [Green Version]
- Dugo, L.; Belluomo, M.G.; Fanali, C.; Russo, M.; Cacciola, F.; Maccarrone, M.; Sardanelli, A.M. Effect of Cocoa Polyphenolic Extract on Macrophage Polarization from Proinflammatory M1 to Anti-Inflammatory M2 State. Oxid. Med. Cell Longev. 2017, 2017, 6293740. [Google Scholar] [CrossRef] [PubMed]
- Waterman, P.G.; Mole, S. Analysis of Phenolic Plant Metabolites; Oxford Blackwell Scientific Publications: Oxford, UK, 1994. [Google Scholar]
- Zhishen, J.; Mengcheng, T.; Jianming, W. The determination of flavonoid contents in mulberry and their scavenging effects on superoxide radicals. Food Chem. 1999, 64, 555–559. [Google Scholar] [CrossRef]
- Stojanović, I.; Šavikin, K.; Đedović, N.; Živković, J.; Saksida, T.; Momčilović, M.; Koprivica, I.; Vujičić, M.; Stanisavljević, S.; Miljković, Đ.; et al. Pomegranate peel extract ameliorates autoimmunity in animal models of multiple sclerosis and type 1 diabetes. J. Funct. Foods 2017, 35, 522–530. [Google Scholar] [CrossRef]
- Murai, M.; Turovskaya, O.; Kim, G.; Madan, R.; Karp, C.L.; Cheroutre, H.; Kronenberg, M. Interleukin 10 acts on regulatory T cells to maintain expression of the transcription factor Foxp3 and suppressive function in mice with colitis. Nat. Immunol. 2009, 10, 1178–1184. [Google Scholar] [CrossRef]
- Thome, M.P.; Filippi-Chiela, E.C.; Villodre, E.S.; Migliavaca, C.B.; Onzi, G.R.; Felipe, K.B.; Lenz, G. Ratiometric analysis of Acridine Orange staining in the study of acidic organelles and autophagy. J. Cell Sci. 2016, 129, 4622–4632. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Yamada, H.; Wakamori, S.; Hirokane, T.; Ikeuchi, K.; Matsumoto, S. Structural Revisions in Natural Ellagitannins. Molecules 2018, 23, 1901. [Google Scholar] [CrossRef] [Green Version]
- Chirumbolo, S.; Bjorklund, G.; Lysiuk, R.; Vella, A.; Lenchyk, L.; Upyr, T. Targeting Cancer with Phytochemicals via Their Fine Tuning of the Cell Survival Signaling Pathways. Int. J. Mol. Sci. 2018, 19, 3568. [Google Scholar] [CrossRef] [Green Version]
- Sharifi-Rad, J.; Quispe, C.; Castillo, C.M.S.; Caroca, R.; Lazo-Velez, M.A.; Antonyak, H.; Polishchuk, A.; Lysiuk, R.; Oliinyk, P.; De Masi, L.; et al. Ellagic Acid: A Review on Its Natural Sources, Chemical Stability, and Therapeutic Potential. Oxid. Med. Cell Longev. 2022, 2022, 3848084. [Google Scholar] [CrossRef]
- Venusova, E.; Kolesarova, A.; Horky, P.; Slama, P. Physiological and Immune Functions of Punicalagin. Nutrients 2021, 13, 2150. [Google Scholar] [CrossRef]
- Lim, S.C.; Hroudova, J.; Van Bergen, N.J.; Lopez Sanchez, M.I.; Trounce, I.A.; McKenzie, M. Loss of mitochondrial DNA-encoded protein ND1 results in disruption of complex I biogenesis during early stages of assembly. FASEB J. 2016, 30, 2236–2248. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tonelli, C.; Chio, I.I.C.; Tuveson, D.A. Transcriptional Regulation by Nrf2. Antioxid Redox Signal. 2018, 29, 1727–1745. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khan, N.; Hadi, N.; Afaq, F.; Syed, D.N.; Kweon, M.H.; Mukhtar, H. Pomegranate fruit extract inhibits prosurvival pathways in human A549 lung carcinoma cells and tumor growth in athymic nude mice. Carcinogenesis 2007, 28, 163–173. [Google Scholar] [CrossRef]
- Asmaa, M.J.; Ali, A.J.; Farid, J.M.; Azman, S. Growth inhibitory effects of crude pomegranate peel extract on chronic myeloid leukemia, K562 cells. Int. J. Appl. Basic Med. Res. 2015, 5, 100–105. [Google Scholar] [PubMed] [Green Version]
- Sineh Sepehr, K.; Baradaran, B.; Mazandarani, M.; Yousefi, B.; Abdollahpour Alitappeh, M.; Khori, V. Growth-Inhibitory and Apoptosis-Inducing Effects of Punica granatum L. var. spinosa (Apple Punice) on Fibrosarcoma Cell Lines. Adv. Pharm. Bull. 2014, 4, 583–590. [Google Scholar]
- Turkmen, F.U.; Sarigullu Onalan, F.E.; Mercimek Takci, H.A. Antioxidant activities of pomegranate peel methanolic and water extracts by in vitro methods. Nat. Sci. Discov. 2021, 4, 1–6. [Google Scholar] [CrossRef]
- Hussain, T.; Tan, B.; Yin, Y.; Blachier, F.; Tossou, M.C.; Rahu, N. Oxidative Stress and Inflammation: What Polyphenols Can Do for Us? Oxid. Med. Cell. Longev. 2016, 2016, 7432797. [Google Scholar] [CrossRef] [Green Version]
- Tugcu, B.; Nacaroglu, S.A.; Gedikbasi, A.; Uhri, M.; Acar, N.; Ozdemir, H. Protective effect of pomegranate juice on retinal oxidative stress in streptozotocin-induced diabetic rats. Int. J. Ophthalmol. 2017, 10, 1662–1668. [Google Scholar]
- Cao, Y.; Chen, J.; Ren, G.; Zhang, Y.; Tan, X.; Yang, L. Punicalagin Prevents Inflammation in LPS-Induced RAW264.7 Macrophages by Inhibiting FoxO3a/Autophagy Signaling Pathway. Nutrients 2019, 11, 2794. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.; Das, J.K.; Kumar, A.; Peng, H.Y.; Ren, Y.; Xiong, X.; Yang, J.M.; Song, J. Autophagy in T-cell differentiation, survival and memory. Immunol. Cell Biol. 2021, 99, 351–360. [Google Scholar] [CrossRef]
- Zachari, M.; Ganley, I.G. The mammalian ULK1 complex and autophagy initiation. Essays Biochem. 2017, 61, 585–596. [Google Scholar]
- Vega-Rubin-de-Celis, S. The Role of Beclin 1-Dependent Autophagy in Cancer. Biology 2019, 9, 4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Birgisdottir, A.B.; Mouilleron, S.; Bhujabal, Z.; Wirth, M.; Sjottem, E.; Evjen, G.; Zhang, W.; Lee, R.; O’Reilly, N.; Tooze, S.A.; et al. Members of the autophagy class III phosphatidylinositol 3-kinase complex I interact with GABARAP and GABARAPL1 via LIR motifs. Autophagy 2019, 15, 1333–1355. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ye, X.; Zhou, X.J.; Zhang, H. Exploring the Role of Autophagy-Related Gene 5 (ATG5) Yields Important Insights Into Autophagy in Autoimmune/Autoinflammatory Diseases. Front. Immunol. 2018, 9, 2334. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.; Liu, Q.; Bi, Y. Autophagy and apoptosis are regulated by stress on Bcl2 by AMBRA1 in the endoplasmic reticulum and mitochondria. Biol. Med. Model. 2019, 16, 18. [Google Scholar] [CrossRef] [Green Version]
- Liu, W.J.; Ye, L.; Huang, W.F.; Guo, L.J.; Xu, Z.G.; Wu, H.L.; Yang, C.; Liu, H.F. p62 links the autophagy pathway and the ubiqutin-proteasome system upon ubiquitinated protein degradation. Cell Mol. Biol. Lett. 2016, 21, 29. [Google Scholar] [CrossRef] [Green Version]
- Subkorn, P.; Norkaew, C.; Deesrisak, K.; Tanyong, D. Punicalagin, a pomegranate compound, induces apoptosis and autophagy in acute leukemia. PeerJ 2021, 9, e12303. [Google Scholar] [CrossRef]
- Wang, S.G.; Huang, M.H.; Li, J.H.; Lai, F.I.; Lee, H.M.; Hsu, Y.N. Punicalagin induces apoptotic and autophagic cell death in human U87MG glioma cells. Acta Pharm. Sin. 2013, 34, 1411–1419. [Google Scholar] [CrossRef]
- Ganesan, T.; Sinniah, A.; Chik, Z.; Alshawsh, M.A. Punicalagin Regulates Apoptosis-Autophagy Switch via Modulation of Annexin A1 in Colorectal Cancer. Nutrients 2020, 12, 2430. [Google Scholar] [CrossRef]
- Pagliarini, V.; Wirawan, E.; Romagnoli, A.; Ciccosanti, F.; Lisi, G.; Lippens, S.; Cecconi, F.; Fimia, G.M.; Vandenabeele, P.; Corazzari, M.; et al. Proteolysis of Ambra1 during apoptosis has a role in the inhibition of the autophagic pro-survival response. Cell Death Differ. 2012, 19, 1495–1504. [Google Scholar] [CrossRef] [Green Version]
- Yun, H.R.; Jo, Y.H.; Kim, J.; Shin, Y.; Kim, S.S.; Choi, T.G. Roles of Autophagy in Oxidative Stress. Int. J. Mol. Sci. 2020, 21, 3289. [Google Scholar] [CrossRef] [PubMed]
- Mizushima, N.; Levine, B.; Cuervo, A.M.; Klionsky, D.J. Autophagy fights disease through cellular self-digestion. Nature 2008, 451, 1069–1075. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rasheed, Z.; Akhtar, N.; Anbazhagan, A.N.; Ramamurthy, S.; Shukla, M.; Haqqi, T.M. Polyphenol-rich pomegranate fruit extract (POMx) suppresses PMACI-induced expression of pro-inflammatory cytokines by inhibiting the activation of MAP Kinases and NF-kappaB in human KU812 cells. J. Inflamm. 2009, 6, 1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marques, L.C.; Pinheiro, A.J.; Araujo, J.G.; de Oliveira, R.A.; Silva, S.N.; Abreu, I.C.; de Sousa, E.M.; Fernandes, E.S.; Luchessi, A.D.; Silbiger, V.N.; et al. Anti-Inflammatory Effects of a Pomegranate Leaf Extract in LPS-Induced Peritonitis. Planta Med. 2016, 82, 1463–1467. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaur, S.; Bansal, Y.; Kumar, R.; Bansal, G. A panoramic review of IL-6: Structure, pathophysiological roles and inhibitors. Bioorg. Med. Chem. 2020, 28, 115327. [Google Scholar] [CrossRef]
- Mastrogiovanni, F.; Romani, A.; Santi, L.; Lacetera, N.; Bernini, R. Anti-proliferative effect of pomegranate peel extracts on bovine peripheral blood mononuclear cells (PBMCs). Nat. Prod. Res. 2021, 35, 1696–1701. [Google Scholar] [CrossRef]
- Da Rocha, S.; Bigot, J.; Onodi, F.; Cosette, J.; Corre, G.; Poupiot, J.; Fenard, D.; Gjata, B.; Galy, A.; Neildez-Nguyen, T.M.A. Temporary Reduction of Membrane CD4 with the Antioxidant MnTBAP Is Sufficient to Prevent Immune Responses Induced by Gene Transfer. Mol. Methods Clin. Dev. 2019, 14, 285–299. [Google Scholar] [CrossRef] [Green Version]
- Smith-Garvin, J.E.; Koretzky, G.A.; Jordan, M.S. T cell activation. Annu. Rev. Immunol. 2009, 27, 591–619. [Google Scholar] [CrossRef]
- Reddy, M.; Eirikis, E.; Davis, C.; Davis, H.M.; Prabhakar, U. Comparative analysis of lymphocyte activation marker expression and cytokine secretion profile in stimulated human peripheral blood mononuclear cell cultures: An in vitro model to monitor cellular immune function. J. Immunol. Methods 2004, 293, 127–142. [Google Scholar] [CrossRef]
- Cibrian, D.; Sanchez-Madrid, F. CD69: From activation marker to metabolic gatekeeper. Eur. J. Immunol. 2017, 47, 946–953. [Google Scholar] [CrossRef]
- Wikenheiser, D.J.; Stumhofer, J.S. ICOS Co-Stimulation: Friend or Foe? Front. Immunol. 2016, 7, 304. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Patsoukis, N.; Wang, Q.; Strauss, L.; Boussiotis, V.A. Revisiting the PD-1 pathway. Sci. Adv. 2020, 6, eabd2712. [Google Scholar] [CrossRef] [PubMed]
- Ding, S.; Jiang, H.; Fang, J. Regulation of Immune Function by Polyphenols. J. Immunol. Res. 2018, 2018, 1264074. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Golubovskaya, V.; Wu, L. Different Subsets of T Cells, Memory, Effector Functions, and CAR-T Immunotherapy. Cancers 2016, 8, 36. [Google Scholar] [CrossRef] [Green Version]
- Chen, T.; Guo, J.; Cai, Z.; Li, B.; Sun, L.; Shen, Y.; Wang, S.; Wang, Z.; Wang, Z.; Wang, Y.; et al. Th9 Cell Differentiation and Its Dual Effects in Tumor Development. Front. Immunol. 2020, 11, 1026. [Google Scholar] [CrossRef]
- Gong, F.; Zheng, T.; Zhou, P. T Follicular Helper Cell Subsets and the Associated Cytokine IL-21 in the Pathogenesis and Therapy of Asthma. Front. Immunol. 2019, 10, 2918. [Google Scholar] [CrossRef] [Green Version]
- Bessler, H.; Djaldetti, M. On the link between ellagic acid and the immune balance between human mononuclear and colon carcinoma cells. Immunol. Curr. Res. 2017, 1, 1000101. [Google Scholar]
- Promsong, A.; Chung, W.O.; Satthakarn, S.; Nittayananta, W. Ellagic acid modulates the expression of oral innate immune mediators: Potential role in mucosal protection. J. Oral Pathol. Med. 2015, 44, 214–221. [Google Scholar] [CrossRef]
- Lu, X.Y.; Han, B.; Deng, X.; Deng, S.Y.; Zhang, Y.Y.; Shen, P.X.; Hui, T.; Chen, R.H.; Li, X.; Zhang, Y. Pomegranate peel extract ameliorates the severity of experimental autoimmune encephalomyelitis via modulation of gut microbiota. Gut. Microbes 2020, 12, 1857515. [Google Scholar] [CrossRef]
- Vallarino, G.; Salis, A.; Lucarini, E.; Turrini, F.; Olivero, G.; Roggeri, A.; Damonte, G.; Boggia, R.; Di Cesare Mannelli, L.; Ghelardini, C.; et al. Healthy Properties of a New Formulation of Pomegranate-Peel Extract in Mice Suffering from Experimental Autoimmune Encephalomyelitis. Molecules 2022, 27, 914. [Google Scholar] [CrossRef]
- Petrou, P.; Ginzberg, A.; Binyamin, O.; Karussis, D. Beneficial effects of a nano formulation of pomegranate seed oil, GranaGard, on the cognitive function of multiple sclerosis patients. Mult. Scler. Relat. Disord. 2021, 54, 103103. [Google Scholar] [CrossRef] [PubMed]
- Scaioli, E.; Belluzzi, A.; Ricciardiello, L.; Del Rio, D.; Rotondo, E.; Mena, P.; Derlindati, E.; Danesi, F. Pomegranate juice to reduce fecal calprotectin levels in inflammatory bowel disease patients with a high risk of clinical relapse: Study protocol for a randomized controlled trial. Trials 2019, 20, 327. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seo, Y.; Mun, C.H.; Park, S.H.; Jeon, D.; Kim, S.J.; Yoon, T.; Ko, E.; Jo, S.; Park, Y.B.; Namkung, W.; et al. Punicalagin Ameliorates Lupus Nephritis via Inhibition of PAR2. Int. J. Mol. Sci. 2020, 21, 4975. [Google Scholar] [CrossRef] [PubMed]
- Parisi, V.; Vassallo, A.; Pisano, C.; Signorino, G.; Cardile, F.; Sorrentino, M.; Colelli, F.; Fucci, A.; D’Andrea, E.L.; De Tommasi, N.; et al. A Herbal Mixture from Propolis, Pomegranate, and Grape Pomace Endowed with Anti-Inflammatory Activity in an In Vivo Rheumatoid Arthritis Model. Molecules 2020, 25, 2255. [Google Scholar] [CrossRef]
- Anderson, K.C.; Teuber, S.S. Ellagic acid and polyphenolics present in walnut kernels inhibit in vitro human peripheral blood mononuclear cell proliferation and alter cytokine production. Ann. N. Y. Acad. Sci. 2010, 1190, 86–96. [Google Scholar] [CrossRef]
- Kashiwada, Y.; Nonaka, G.; Nishioka, I.; Ballas, L.M.; Jiang, J.B.; Janzen, W.P.; Lee, K.H. Tannins as selective inhibitors of protein kinase C. Bioorganic Med. Chem. Lett. 1992, 2, 239–244. [Google Scholar] [CrossRef]
- Narayanan, B.A.; Geoffroy, O.; Willingham, M.C.; Re, G.G.; Nixon, D.W. p53/p21(WAF1/CIP1) expression and its possible role in G1 arrest and apoptosis in ellagic acid treated cancer cells. Cancer. Lett. 1999, 136, 215–221. [Google Scholar] [CrossRef]
- Rosenblum, M.D.; Way, S.S.; Abbas, A.K. Regulatory T cell memory. Nat. Rev. Immunol. 2016, 16, 90–101. [Google Scholar] [CrossRef]
- Zhu, C.; Zhang, A.; Huang, S.; Ding, G.; Pan, X.; Chen, R. Interleukin-13 inhibits cytokines synthesis by blocking nuclear factor-κB and c-Jun N-terminal kinase in human mesangial cells. J. Biomed. Res. 2010, 24, 308–316. [Google Scholar] [CrossRef] [Green Version]
- Cihakova, D.; Barin, J.G.; Afanasyeva, M.; Kimura, M.; Fairweather, D.; Berg, M.; Talor, M.V.; Baldeviano, G.C.; Frisancho, S.; Gabrielson, K.; et al. Interleukin-13 protects against experimental autoimmune myocarditis by regulating macrophage differentiation. Am. J. Pathol. 2008, 172, 1195–1208. [Google Scholar] [CrossRef] [Green Version]
- Ng, T.H.; Britton, G.J.; Hill, E.V.; Verhagen, J.; Burton, B.R.; Wraith, D.C. Regulation of adaptive immunity; the role of interleukin-10. Front. Immunol. 2013, 4, 129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gunther, S.; Fagone, P.; Jalce, G.; Atanasov, A.G.; Guignabert, C.; Nicoletti, F. Role of MIF and D-DT in immune-inflammatory, autoimmune, and chronic respiratory diseases: From pathogenic factors to therapeutic targets. Drug Discov. Today 2019, 24, 428–439. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.S.; Bai, M.H.; Zhang, T.; Li, G.D.; Liu, M. Ellagic acid induces cell cycle arrest and apoptosis through TGF-beta/Smad3 signaling pathway in human breast cancer MCF-7 cells. Int. J. Oncol. 2015, 46, 1730–1738. [Google Scholar] [CrossRef] [PubMed]
- El-Shitany, N.A.; El-Bastawissy, E.A.; El-desoky, K. Ellagic acid protects against carrageenan-induced acute inflammation through inhibition of nuclear factor kappa B, inducible cyclooxygenase and proinflammatory cytokines and enhancement of interleukin-10 via an antioxidant mechanism. Int. Immunopharmacol. 2014, 19, 290–299. [Google Scholar] [CrossRef]
- Su, L.C.; Liu, X.Y.; Huang, A.F.; Xu, W.D. Emerging role of IL-35 in inflammatory autoimmune diseases. Autoimmun. Rev. 2018, 17, 665–673. [Google Scholar] [CrossRef]
- Su, Z.; Tao, X. Current Understanding of IL-37 in Human Health and Disease. Front. Immunol. 2021, 12, 696605. [Google Scholar] [CrossRef]
Gene Name | Primer Sequence 5′–3′ |
---|---|
GAPDH_F | GTGAAGGTCGGAGTCAACG |
GAPDH_R | TGAGGTCAATGAAGGGGTC |
ATG5_F | CACAAGCAACTCTGGATGGGATTG |
ATG5_R | GCAGCCAC GGACGAAACAG |
MAP1LC3B_F | TTCAGGTTCACAAAACCCGC |
MAP1LC3B_R | TCTCACACAGCCCGTTTACC |
BECN1_F | CTGGGACAACAAGTTTGACCAT |
BECN1_R | GCTCCTCAGAGTTAAACTGGGTT |
SQSTM1_F | GCCAGAGGAACAGATGGAGT |
SQSTM1_R | TCCGATTCTG GCATCTGTAG |
UVRAG_F | AGGAAGGAGTGCACTGCAAA |
UVRAG_R | AGGCAACTTGACACCGCATA |
ULK1_F | TTTTGTTTCTCCGTTGGGGC |
ULK1_R | ACTCTTCCCGGGCTGCTAAT |
AMBRA1_F | GGTGGGAGGAGAGGGGATAG |
AMBRA1_R | CGAGGGGCATGTCATCATTT |
GABARAP_F | CCCTCGTCCCGCTGATTTTA |
GABARAP_R | ATCCCTCCAGCTTGTACCCA |
MT-ND1_F | CCTCCTACTCCTCATTGTACCCATTC |
MT-ND1_R | GAGTGTGCCTGCAAAGATGGTAGAG |
MT-ND5_F | GTTTCATCCTCGCCTTAGCATGA |
MT-ND5_R | AGTCAGGGGTGGAGACCTAATTGG |
TXN_F | GAAGCAGATCGAGAGCAAGACTG |
TXN_R | GCTCCAGAAAATTCACCCACCT |
CAT_F | AGTGATCGGGGGATTCCAGA |
CAT_R | AAGTCTCGCCGCATCTTCAA |
NFE2L2 _F | AGGTTGCCCACATTCCCAAA |
NFE2L2 _R | AGTGACTGAAACGTAGCCGA |
HMOX1_F | CTCCCAGGGCCATGAACTTT |
HMOX1_R | GGGAAGATGCCATAGGCTCC |
SOD1_F | ACAAAGATGGTGTGGCCGAT |
SOD1_R | AACGACTTCCAGCGTTTCCT |
BCL2_F | TCGCCCTGTGGATGACTGA |
BCL2_R | CAGAGACAGCCAGGAGAAATC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Čolić, M.; Bekić, M.; Tomić, S.; Đokić, J.; Radojević, D.; Šavikin, K.; Miljuš, N.; Marković, M.; Škrbić, R. Immunomodulatory Properties of Pomegranate Peel Extract in a Model of Human Peripheral Blood Mononuclear Cell Culture. Pharmaceutics 2022, 14, 1140. https://doi.org/10.3390/pharmaceutics14061140
Čolić M, Bekić M, Tomić S, Đokić J, Radojević D, Šavikin K, Miljuš N, Marković M, Škrbić R. Immunomodulatory Properties of Pomegranate Peel Extract in a Model of Human Peripheral Blood Mononuclear Cell Culture. Pharmaceutics. 2022; 14(6):1140. https://doi.org/10.3390/pharmaceutics14061140
Chicago/Turabian StyleČolić, Miodrag, Marina Bekić, Sergej Tomić, Jelena Đokić, Dušan Radojević, Katarina Šavikin, Nataša Miljuš, Milan Marković, and Ranko Škrbić. 2022. "Immunomodulatory Properties of Pomegranate Peel Extract in a Model of Human Peripheral Blood Mononuclear Cell Culture" Pharmaceutics 14, no. 6: 1140. https://doi.org/10.3390/pharmaceutics14061140