3D Porous Scaffold-Based High-Throughput Platform for Cancer Drug Screening
Abstract
:1. Introduction
2. Method
2.1. Scaffold Fabrication
2.2. Scaffold Characterization
2.3. Cell Proliferation Analysis
2.4. Cell Morphology Analysis
2.5. PCR Analysis
2.6. TMZ Dose–Response Study
2.7. Z′ Factor and CV Calculation
2.8. Statistical Analysis
3. Results and Discussion
3.1. CHA Scaffold Characterizations
3.1.1. Fabrication of 3D Porous CHA Scaffolds as HTS Platform
3.1.2. Physical Properties of CHA Scaffolds
3.2. The Effect of Scaffold Pore Size on GBM Cell Proliferation and Morphology
3.3. The Effect of Scaffold Pore Size on Gene Expression of GBM Cells
3.4. Drug Response of GBM Cells Grown in Scaffolds of Different Pore Sizes
3.5. Quality of 3D CHA Scaffold as an HTS Platform
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Alexander, B.M.; Cloughesy, T.F. Adult Glioblastoma. J. Clin. Oncol. 2017, 35, 2402–2409. [Google Scholar] [CrossRef]
- Prasad, V.; Mailankody, S. Research and Development Spending to Bring a Single Cancer Drug to Market and Revenues after Approval. JAMA Intern. Med. 2017, 177, 1569–1575. [Google Scholar] [CrossRef] [PubMed]
- Antoni, D.; Burckel, H.; Josset, E.; Noel, G. Three-Dimensional Cell Culture: A Breakthrough in Vivo. Int. J. Mol. Sci. 2015, 16, 5517–5527. [Google Scholar] [CrossRef] [PubMed]
- Sant, S.; Johnston, P.A. The production of 3D tumor spheroids for cancer drug discovery. Drug Discov. Today Technol. 2017, 23, 27–36. [Google Scholar] [CrossRef] [Green Version]
- Pereira, D.A.; Williams, J.A. Origin and evolution of high throughput screening. Br. J. Pharm. 2007, 152, 53–61. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cukierman, E.; Pankov, R.; Stevens, D.R.; Yamada, K.M. Taking Cell-Matrix Adhesions to the Third Dimension. Science 2001, 294, 1708–1712. [Google Scholar] [CrossRef]
- Kievit, F.M.; Florczyk, S.J.; Leung, M.C.; Veiseh, O.; Park, J.O.; Disis, M.L.; Zhang, M. Chitosan–alginate 3D scaffolds as a mimic of the glioma tumor microenvironment. Biomaterials 2010, 31, 5903–5910. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Florczyk, S.J.; Kievit, F.M.; Wang, K.; Erickson, A.E.; Ellenbogen, R.G.; Zhang, M. 3D Porous Chitosan-Alginate Scaffolds Promote Proliferation and Enrichment of Cancer Stem-Like Cells. J. Mater. Chem. B 2016, 4, 6326–6334. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Erickson, A.E.; Lan Levengood, S.K.; Sun, J.; Chang, F.-C.; Zhang, M. Fabrication and Characterization of Chitosan–Hyaluronic Acid Scaffolds with Varying Stiffness for Glioblastoma Cell Culture. Adv. Healthc. Mater. 2018, 7, 1800295. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Dai, X.; Zhang, X.; Li, X.; Xu, T.; Lan, Q. Enrichment of glioma stem cell-like cells on 3D porous scaffolds composed of different extracellular matrix. Biochem. Biophys. Res. Commun. 2018, 498, 1052–1057. [Google Scholar] [CrossRef]
- Wang, K.; Kievit, F.M.; Erickson, A.E.; Silber, J.R.; Ellenbogen, R.G.; Zhang, M. Culture on 3D Chitosan-Hyaluronic Acid Scaffolds Enhances Stem Cell Marker Expression and Drug Resistance in Human Glioblastoma Cancer Stem Cells. Adv. Healthc. Mater. 2016, 5, 3173–3181. [Google Scholar] [CrossRef] [PubMed]
- Verjans, E.-T.; Doijen, J.; Luyten, W.; Landuyt, B.; Schoofs, L. Three-dimensional cell culture models for anticancer drug screening: Worth the effort? J. Cell. Physiol. 2018, 233, 2993–3003. [Google Scholar] [CrossRef] [PubMed]
- Florczyk, S.J.; Wang, K.; Jana, S.; Wood, D.L.; Sytsma, S.K.; Sham, J.G.; Kievit, F.M.; Zhang, M. Porous chitosan-hyaluronic acid scaffolds as a mimic of glioblastoma microenvironment ECM. Biomaterials 2013, 34, 10143–10150. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kozlowski, M.T.; Crook, C.J.; Ku, H.T. Towards organoid culture without Matrigel. Commun. Biol. 2021, 4, 1387. [Google Scholar] [CrossRef]
- Jayakumar, R.; Menon, D.; Manzoor, K.; Nair, S.V.; Tamura, H. Biomedical applications of chitin and chitosan based nanomaterials—A short review. Carbohydr. Polym. 2010, 82, 227–232. [Google Scholar] [CrossRef]
- Lei, Y.; Gojgini, S.; Lam, J.; Segura, T. The spreading, migration and proliferation of mouse mesenchymal stem cells cultured inside hyaluronic acid hydrogels. Biomaterials 2011, 32, 39–47. [Google Scholar] [CrossRef] [Green Version]
- Toole, B.P. Hyaluronan: From extracellular glue to pericellular cue. Nat. Rev. Cancer 2004, 4, 528–539. [Google Scholar] [CrossRef]
- Revia, R.A.; Wagner, B.; James, M.; Zhang, M. High-Throughput Dispensing of Viscous Solutions for Biomedical Applications. Micromachines 2022, 13, 1730. [Google Scholar] [CrossRef]
- Safa, A.R.; Saadatzadeh, M.R.; Cohen-Gadol, A.A.; Pollok, K.E.; Bijangi-Vishehsaraei, K. Emerging targets for glioblastoma stem cell therapy. J. Biomed. Res. 2016, 30, 19–31. [Google Scholar] [CrossRef] [Green Version]
- Fereshteh, Z. 7—Freeze-drying technologies for 3D scaffold engineering. In Functional 3D Tissue Engineering Scaffolds; Deng, Y., Kuiper, J., Eds.; Woodhead Publishing: Sawston, UK, 2018; pp. 151–174. [Google Scholar]
- Scaffold Mean Pore Size Influences Mesenchymal Stem Cell Chondrogenic Differentiation and Matrix Deposition. Tissue Eng. Part A 2015, 21, 486–497. [CrossRef]
- Loh, Q.L.; Choong, C. Three-Dimensional Scaffolds for Tissue Engineering Applications: Role of Porosity and Pore Size. Tissue Eng. Part B Rev. 2013, 19, 485–502. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huri, P.Y.; Ozilgen, B.A.; Hutton, D.L.; Grayson, W.L. Scaffold pore size modulates in vitro osteogenesis of human adipose-derived stem/stromal cells. Biomed. Mater. 2014, 9, 045003. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Feng, Q.; Cui, F. In vitro degradation of porous nano-hydroxyapatite/collagen/PLLA scaffold reinforced by chitin fibres. Mater. Sci. Eng. C 2006, 26, 716–720. [Google Scholar] [CrossRef]
- Li, X.; Feng, Q.; Jiao, Y.; Cui, F. Collagen-based scaffolds reinforced by chitosan fibres for bone tissue engineering. Polym. Int. 2005, 54, 1034–1040. [Google Scholar] [CrossRef]
- Modulation of 3D Fibrin Matrix Stiffness by Intrinsic Fibrinogen–Thrombin Compositions and by Extrinsic Cellular Activity. Tissue Eng. Part A 2009, 15, 1865–1876. [CrossRef] [PubMed]
- Mandal, B.B.; Kundu, S.C. Cell proliferation and migration in silk fibroin 3D scaffolds. Biomaterials 2009, 30, 2956–2965. [Google Scholar] [CrossRef]
- Ajdary, R.; Huan, S.; Zanjanizadeh Ezazi, N.; Xiang, W.; Grande, R.; Santos, H.A.; Rojas, O.J. Acetylated Nanocellulose for Single-Component Bioinks and Cell Proliferation on 3D-Printed Scaffolds. Biomacromolecules 2019, 20, 2770–2778. [Google Scholar] [CrossRef] [Green Version]
- O’Brien, F.J.; Harley, B.A.; Yannas, I.V.; Gibson, L. Influence of freezing rate on pore structure in freeze-dried collagen-GAG scaffolds. Biomaterials 2004, 25, 1077–1086. [Google Scholar] [CrossRef]
- Yeung, T.; Georges, P.C.; Flanagan, L.A.; Marg, B.; Ortiz, M.; Funaki, M.; Zahir, N.; Ming, W.; Weaver, V.; Janmey, P.A. Effects of substrate stiffness on cell morphology, cytoskeletal structure, and adhesion. Cell Motil. 2005, 60, 24–34. [Google Scholar] [CrossRef]
- Baker, B.M.; Chen, C.S. Deconstructing the third dimension—How 3D culture microenvironments alter cellular cues. J. Cell Sci. 2012, 125, 3015–3024. [Google Scholar] [CrossRef] [Green Version]
- Xu, K.; Ganapathy, K.; Andl, T.; Wang, Z.; Copland, J.A.; Chakrabarti, R.; Florczyk, S.J. 3D porous chitosan-alginate scaffold stiffness promotes differential responses in prostate cancer cell lines. Biomaterials 2019, 217, 119311. [Google Scholar] [CrossRef] [PubMed]
- Offeddu, G.S.; Ashworth, J.C.; Cameron, R.E.; Oyen, M.L. Multi-scale mechanical response of freeze-dried collagen scaffolds for tissue engineering applications. J. Mech. Behav. Biomed. Mater. 2015, 42, 19–25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Norman, M.D.A.; Ferreira, S.A.; Jowett, G.M.; Bozec, L.; Gentleman, E. Measuring the elastic modulus of soft culture surfaces and three-dimensional hydrogels using atomic force microscopy. Nat. Protoc. 2021, 16, 2418–2449. [Google Scholar] [CrossRef] [PubMed]
- Krieg, M.; Fläschner, G.; Alsteens, D.; Gaub, B.M.; Roos, W.H.; Wuite, G.J.L.; Gaub, H.E.; Gerber, C.; Dufrêne, Y.F.; Müller, D.J. Atomic force microscopy-based mechanobiology. Nat. Rev. Phys. 2019, 1, 41–57. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Meng, L.; Lu, Q. Cell Behaviors on Polysaccharide-Wrapped Single-Wall Carbon Nanotubes: A Quantitative Study of the Surface Properties of Biomimetic Nanofibrous Scaffolds. ACS Nano 2009, 3, 3200–3206. [Google Scholar] [CrossRef]
- Karageorgiou, V.; Kaplan, D. Porosity of 3D biomaterial scaffolds and osteogenesis. Biomaterials 2005, 26, 5474–5491. [Google Scholar] [CrossRef]
- Lombardo, M.E.; Carfì Pavia, F.; Vitrano, I.; Ghersi, G.; Brucato, V.; Rosei, F.; La Carrubba, V. PLLA scaffolds with controlled architecture as potential microenvironment for in vitro tumor model. Tissue Cell 2019, 58, 33–41. [Google Scholar] [CrossRef]
- Tricinci, O.; De Pasquale, D.; Marino, A.; Battaglini, M.; Pucci, C.; Ciofani, G. A 3D Biohybrid Real-Scale Model of the Brain Cancer Microenvironment for Advanced In Vitro Testing. Adv. Mater. Technol. 2020, 5, 2000540. [Google Scholar] [CrossRef]
- Pedron, S.; Wolter, G.L.; Chen, J.-W.E.; Laken, S.E.; Sarkaria, J.N.; Harley, B.A.C. Hyaluronic acid-functionalized gelatin hydrogels reveal extracellular matrix signals temper the efficacy of erlotinib against patient-derived glioblastoma specimens. Biomaterials 2019, 219, 119371. [Google Scholar] [CrossRef]
- Wang, X.; Li, X.; Ding, J.; Long, X.; Zhang, H.; Zhang, X.; Jiang, X.; Xu, T. 3D bioprinted glioma microenvironment for glioma vascularization. J. Biomed. Mater. Res. Part A 2021, 109, 915–925. [Google Scholar] [CrossRef]
- Lien, S.-M.; Ko, L.-Y.; Huang, T.-J. Effect of pore size on ECM secretion and cell growth in gelatin scaffold for articular cartilage tissue engineering. Acta Biomater. 2009, 5, 670–679. [Google Scholar] [CrossRef] [PubMed]
- Murphy, C.M.; Haugh, M.G.; O'Brien, F.J. The effect of mean pore size on cell attachment, proliferation and migration in collagen–glycosaminoglycan scaffolds for bone tissue engineering. Biomaterials 2010, 31, 461–466. [Google Scholar] [CrossRef] [PubMed]
- Dean, M.; Fojo, T.; Bates, S. Tumour stem cells and drug resistance. Nat. Rev. Cancer 2005, 5, 275–284. [Google Scholar] [CrossRef] [PubMed]
- Gerson, S.L. MGMT: Its role in cancer aetiology and cancer therapeutics. Nat. Rev. Cancer 2004, 4, 296–307. [Google Scholar] [CrossRef]
- Okamoto, I.; Kawano, Y.; Tsuiki, H.; Sasaki, J.-i.; Nakao, M.; Matsumoto, M.; Suga, M.; Ando, M.; Nakajima, M.; Saya, H. CD44 cleavage induced by a membrane-associated metalloprotease plays a critical role in tumor cell migration. Oncogene 1999, 18, 1435–1446. [Google Scholar] [CrossRef] [Green Version]
- Inda, M.-d.-M.; Bonavia, R.; Seoane, J. Glioblastoma Multiforme: A Look Inside Its Heterogeneous Nature. Cancers 2014, 6, 226–239. [Google Scholar] [CrossRef] [Green Version]
- Alizadeh, A.A.; Aranda, V.; Bardelli, A.; Blanpain, C.; Bock, C.; Borowski, C.; Caldas, C.; Califano, A.; Doherty, M.; Elsner, M.; et al. Toward understanding and exploiting tumor heterogeneity. Nat. Med. 2015, 21, 846–853. [Google Scholar] [CrossRef]
- Kunz-Schughart, L.A.; Freyer, J.P.; Hofstaedter, F.; Ebner, R. The Use of 3-D Cultures for High-Throughput Screening: The Multicellular Spheroid Model. SLAS Discov. 2004, 9, 273–285. [Google Scholar] [CrossRef] [Green Version]
- Singh, A.; Brito, I.; Lammerding, J. Beyond Tissue Stiffness and Bioadhesivity: Advanced Biomaterials to Model Tumor Microenvironments and Drug Resistance. Trends Cancer 2018, 4, 281–291. [Google Scholar] [CrossRef] [Green Version]
- Quartararo, C.E.; Reznik, E.; deCarvalho, A.C.; Mikkelsen, T.; Stockwell, B.R. High-Throughput Screening of Patient-Derived Cultures Reveals Potential for Precision Medicine in Glioblastoma. ACS Med. Chem. Lett. 2015, 6, 948–952. [Google Scholar] [CrossRef] [Green Version]
- Cunha, P.P.; Costa, P.M.; Morais, C.M.; Lopes, I.R.; Cardoso, A.M.; Cardoso, A.L.; Mano, M.; Jurado, A.S.; Pedroso de Lima, M.C. High-throughput screening uncovers miRNAs enhancing glioblastoma cell susceptibility to tyrosine kinase inhibitors. Hum. Mol. Genet. 2017, 26, 4375–4387. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, J.-H.; Chung, T.D.Y.; Oldenburg, K.R. A Simple Statistical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays. J. Biomol. Screen. 1999, 4, 67–73. [Google Scholar] [CrossRef] [PubMed]
- Yan, X.; Zhou, L.; Wu, Z.; Wang, X.; Chen, X.; Yang, F.; Guo, Y.; Wu, M.; Chen, Y.; Li, W.; et al. High throughput scaffold-based 3D micro-tumor array for efficient drug screening and chemosensitivity testing. Biomaterials 2019, 198, 167–179. [Google Scholar] [CrossRef] [PubMed]
Target | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|
GAPDH | ACCACAGTCCATGCCATCAC | TCCACCACCCTGTTGCTGTA |
CD44 | CCAGAAGGAACAGTGGTTTGGC | ACTGTCCTCTGGGCTTGGTGTT |
ABCG2 | GTTCTCAGCAGCTCTTCGGCTT | TCCTCCAGACACACCACGGATA |
MGMT | CCTGGCTGAATGCCTATTTCCAC | GCAGCTTCCATAACACCTGTCTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Y.; Pereira, G.; Tang, Y.; James, M.; Zhang, M. 3D Porous Scaffold-Based High-Throughput Platform for Cancer Drug Screening. Pharmaceutics 2023, 15, 1691. https://doi.org/10.3390/pharmaceutics15061691
Zhou Y, Pereira G, Tang Y, James M, Zhang M. 3D Porous Scaffold-Based High-Throughput Platform for Cancer Drug Screening. Pharmaceutics. 2023; 15(6):1691. https://doi.org/10.3390/pharmaceutics15061691
Chicago/Turabian StyleZhou, Yang, Gillian Pereira, Yuanzhang Tang, Matthew James, and Miqin Zhang. 2023. "3D Porous Scaffold-Based High-Throughput Platform for Cancer Drug Screening" Pharmaceutics 15, no. 6: 1691. https://doi.org/10.3390/pharmaceutics15061691
APA StyleZhou, Y., Pereira, G., Tang, Y., James, M., & Zhang, M. (2023). 3D Porous Scaffold-Based High-Throughput Platform for Cancer Drug Screening. Pharmaceutics, 15(6), 1691. https://doi.org/10.3390/pharmaceutics15061691