Water Extract of Desalted Salicornia europaea Inhibits RANKL-Induced Osteoclast Differentiation and Prevents Bone Loss in Ovariectomized Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Preparation and Isolation of Three DCQAs
2.2. Osteoclast Differentiation
2.3. TRAP Staining
2.4. F-Actin Ring Formation Staining
2.5. Bone Resorption Assay
2.6. Quantitative Reverse Transciption PCR (RT-qPCR)
2.7. Western Blot
2.8. Intracellular ROS Detection
2.9. Animal Experiments
2.10. Micro-CT Analysis
2.11. Statistical Analysis
3. Result
3.1. WSE Inhibited RANKL-Induced Osteoclast Differentiation and Bone Resorption
3.2. WSE Suppressed the Gene Expression Associated with RANKL-Induced Osteoclastogenesis in BMDMs
3.3. Oral Administration of WSE Attenuated OVX-Induced Bone Loss in Mice
3.4. Identification of Three DCQAs in WSE
3.5. DCQAs Extracted from WSE Inhibited RANKL-Induced Osteoclast Differentiation
3.6. WSE and DCQAs Reduced ROS Production Induced by RANKL
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Feng, X.; McDonald, J.M. Disorders of bone remodeling. Annu. Rev. Pathol. 2011, 6, 121–145. [Google Scholar] [CrossRef] [PubMed]
- Eastell, R.; O’Neill, T.W.; Hofbauer, L.C.; Langdahl, B.; Reid, I.R.; Gold, D.T.; Cummings, S.R. Postmenopausal osteoporosis. Nat. Rev. Dis. Primers 2016, 2, 16069. [Google Scholar] [CrossRef] [PubMed]
- Riggs, B.L. The mechanisms of estrogen regulation of bone resorption. J. Clin. Investig. 2000, 106, 1203–1204. [Google Scholar] [CrossRef] [PubMed]
- Amarasekara, D.S.; Yun, H.; Kim, S.; Lee, N.; Kim, H.; Rho, J. Regulation of Osteoclast Differentiation by Cytokine Networks. Immune Netw. 2018, 18, e8. [Google Scholar] [CrossRef] [PubMed]
- Park, J.H.; Lee, N.K.; Lee, S.Y. Current Understanding of RANK Signaling in Osteoclast Differentiation and Maturation. Mol. Cells 2017, 40, 706–713. [Google Scholar] [CrossRef] [PubMed]
- Patel, S. Salicornia: Evaluating the halophytic extremophile as a food and a pharmaceutical candidate. 3 Biotech 2016, 6, 104. [Google Scholar] [CrossRef] [PubMed]
- Isca, V.; Seca, A.; Pinto, D.; Silva, A. An overview of Salicornia genus: The phytochemical and pharmacological profile. In Natural Products: Research Reviews; Daya Publishing House: New Delhi, India, 2014; Volume 2, pp. 145–176. [Google Scholar]
- Ha, B.J.; Lee, S.H.; Kim, H.J.; Lee, J.Y. The role of Salicornia herbacea in ovariectomy-induced oxidative stress. Biol. Pharm. Bull. 2006, 29, 1305–1309. [Google Scholar] [CrossRef]
- Karthivashan, G.; Park, S.Y.; Kweon, M.H.; Kim, J.; Haque, M.E.; Cho, D.Y.; Kim, I.S.; Cho, E.A.; Ganesan, P.; Choi, D.K. Ameliorative potential of desalted Salicornia europaea L. extract in multifaceted Alzheimer’s-like scopolamine-induced amnesic mice model. Sci. Rep. 2018, 8, 7174. [Google Scholar] [CrossRef]
- Park, S.H.; Ko, S.K.; Choi, J.G.; Chung, S.H. Salicornia herbacea prevents high fat diet-induced hyperglycemia and hyperlipidemia in ICR mice. Arch. Pharm. Res. 2006, 29, 256–264. [Google Scholar] [CrossRef]
- Karadeniz, F.; Kim, J.-A.; Ahn, B.-N.; Kwon, M.S.; Kong, C.-S. Effect of Salicornia herbacea on Osteoblastogenesis and Adipogenesis in Vitro. Mar. Drugs 2014, 12, 5132–5147. [Google Scholar] [CrossRef]
- Giordano, R.; Saii, Z.; Fredsgaard, M.; Hulkko, L.S.S.; Poulsen, T.B.G.; Thomsen, M.E.; Henneberg, N.; Zucolotto, S.M.; Arendt-Nielsen, L.; Papenbrock, J.; et al. Pharmacological Insights into Halophyte Bioactive Extract Action on Anti-Inflammatory, Pain Relief and Antibiotics-Type Mechanisms. Molecules 2021, 26, 3140. [Google Scholar] [CrossRef] [PubMed]
- Hwang, Y.P.; Yun, H.J.; Choi, J.H.; Chun, H.K.; Chung, Y.C.; Kim, S.K.; Kim, B.H.; Kwon, K.I.; Jeong, T.C.; Lee, K.Y.; et al. 3-Caffeoyl, 4-dihydrocaffeoylquinic acid from Salicornia herbacea inhibits tumor cell invasion by regulating protein kinase C-delta-dependent matrix metalloproteinase-9 expression. Toxicol. Lett. 2010, 198, 200–209. [Google Scholar] [CrossRef] [PubMed]
- Awad, A.M.; Kumar, P.; Ismail-Fitry, M.R.; Jusoh, S.; Ab Aziz, M.F.; Sazili, A.Q. Green Extraction of Bioactive Compounds from Plant Biomass and Their Application in Meat as Natural Antioxidant. Antioxidants 2021, 10, 1465. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Hu, D.; Chen, Q.; Shi, C.; Ye, J.; Dai, Z.; Lu, Y. Water-based green and sustainable extraction protocols for value-added compounds from natural resources. Curr. Opin. Green Sustain. Chem. 2023, 40, 100757. [Google Scholar] [CrossRef]
- Kiok, K.; Choi, J.-H.; Oh, J.; Park, J.-Y.; Kim, Y.-M.; Moon, J.-H.; Park, J.-H.; Cho, J.-Y. New 8-C-p-Hydroxylbenzylflavonol Glycosides from Pumpkin (Cucurbita moschata Duch.) Tendril and Their Osteoclast Differentiation Inhibitory Activities. Molecules 2020, 25, 2077. [Google Scholar] [CrossRef]
- Wang, Q.; Xie, Y.; Du, Q.S.; Wu, X.J.; Feng, X.; Mei, L.; McDonald, J.M.; Xiong, W.C. Regulation of the formation of osteoclastic actin rings by proline-rich tyrosine kinase 2 interacting with gelsolin. J. Cell Biol. 2003, 160, 565–575. [Google Scholar] [CrossRef] [PubMed]
- Cho, J.Y.; Kim, J.Y.; Lee, Y.G.; Lee, H.J.; Shim, H.J.; Lee, J.H.; Kim, S.J.; Ham, K.S.; Moon, J.H. Four New Dicaffeoylquinic Acid Derivatives from Glasswort (Salicornia herbacea L.) and Their Antioxidative Activity. Molecules 2016, 21, 1097. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Cho, J.-Y.; Ma, Y.-K.; Park, K.; Lee, S.-H.; Ham, K.-S.; Lee, H.; Park, K.-H.; Moon, J.-H. Dicaffeoylquinic acid derivatives and flavonoid glucosides from glasswort (Salicornia herbacea L.) and their antioxidative activity. Food Chem. 2011, 125, 55–62. [Google Scholar] [CrossRef]
- Kim, Y.A.; Kong, C.S.; Lee, J.I.; Kim, H.; Park, H.Y.; Lee, H.S.; Lee, C.; Seo, Y. Evaluation of novel antioxidant triterpenoid saponins from the halophyte Salicornia herbacea. Bioorganic Med. Chem. Lett. 2012, 22, 4318–4322. [Google Scholar] [CrossRef]
- Ge, L.; Wan, H.; Tang, S.; Chen, H.; Li, J.; Zhang, K.; Zhou, B.; Fei, J.; Wu, S.; Zeng, X. Novel caffeoylquinic acid derivatives from Lonicera japonica Thunb. flower buds exert pronounced anti-HBV activities. RSC Adv. 2018, 8, 35374–35385. [Google Scholar] [CrossRef]
- Kim, A.R.; Kim, H.S.; Kim, D.K.; Lee, J.H.; Yoo, Y.H.; Kim, J.Y.; Park, S.K.; Nam, S.T.; Kim, H.W.; Park, Y.H.; et al. The Extract of Chrysanthemum zawadskii var. latilobum Ameliorates Collagen-Induced Arthritis in Mice. Evid. Based Complement. Altern. Med. 2016, 2016, 3915013. [Google Scholar] [CrossRef] [PubMed]
- Ha, H.; Kwak, H.B.; Lee, S.W.; Jin, H.M.; Kim, H.M.; Kim, H.H.; Lee, Z.H. Reactive oxygen species mediate RANK signaling in osteoclasts. Exp. Cell Res. 2004, 301, 119–127. [Google Scholar] [CrossRef] [PubMed]
- Lee, N.K.; Choi, Y.G.; Baik, J.Y.; Han, S.Y.; Jeong, D.-w.; Bae, Y.S.; Kim, N.; Lee, S.Y. A crucial role for reactive oxygen species in RANKL-induced osteoclast differentiation. Blood 2005, 106, 852–859. [Google Scholar] [CrossRef] [PubMed]
- Meirow, Y.; Jovanovic, M.; Zur, Y.; Habib, J.; Colombo, D.F.; Twaik, N.; Ashkenazi-Preiser, H.; Ben-Meir, K.; Mikula, I.; Reuven, O.; et al. Specific inflammatory osteoclast precursors induced during chronic inflammation give rise to highly active osteoclasts associated with inflammatory bone loss. Bone Res. 2022, 10, 36. [Google Scholar] [CrossRef] [PubMed]
- Teitelbaum, S.L. Bone resorption by osteoclasts. Science 2000, 289, 1504–1508. [Google Scholar] [CrossRef] [PubMed]
- Cho, E.; Chen, Z.; Lee, J.; Lee, S.; Lee, T.-H. PSTP-3,5-Me Inhibits Osteoclast Differentiation and Bone Resorption. Molecules 2019, 24, 3346. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zhang, M.; Zhao, Y.; Wang, H.; Liu, T.; Xin, Z. Pentadecyl ferulate, a potent antioxidant and antiproliferative agent from the halophyte Salicornia herbacea. Food Chem. 2013, 141, 2066–2074. [Google Scholar] [CrossRef]
- Ramesh, P.; Jagadeesan, R.; Sekaran, S.; Dhanasekaran, A.; Vimalraj, S. Flavonoids: Classification, Function, and Molecular Mechanisms Involved in Bone Remodelling. Front. Endocrinol. 2021, 12, 779638. [Google Scholar] [CrossRef]
- Brent, M.B. Pharmaceutical treatment of bone loss: From animal models and drug development to future treatment strategies. Pharmacol. Ther. 2023, 244, 108383. [Google Scholar] [CrossRef]
- Nair, A.B.; Jacob, S. A simple practice guide for dose conversion between animals and human. J. Basic Clin. Pharm. 2016, 7, 27–31. [Google Scholar] [CrossRef]
Gene | Sequence (5′ to 3′) |
---|---|
ACP5 | F: CTGGAGTGCACGATGCCAGCGACA |
R: TCCGTGCTCGGCGATGGACCAGA | |
DCSTAMP | F: CCAAGGAGTCGTCCATGATT |
R: GGCTGCTTTGATCGTTTCTC | |
NFATc1 | F: GGGTCAGTGTGACCGAAGAT |
R: GGAAGTCAGAAGTGGGTGGA | |
Ctsk | F: GGCCAACTCAAGAAGA AAAC |
R: GTGCTTGCTTCCCTTCTGG | |
β-actin | F: AGGCCCAGAGCAAGAGAG |
R: TCAACATGATCTGGGTCATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jang, A.-R.; Lee, Y.-J.; Kim, D.-Y.; Lee, T.-S.; Jung, D.-H.; Kim, Y.-J.; Seo, I.-S.; Ahn, J.-H.; Song, E.-J.; Oh, J.; et al. Water Extract of Desalted Salicornia europaea Inhibits RANKL-Induced Osteoclast Differentiation and Prevents Bone Loss in Ovariectomized Mice. Nutrients 2023, 15, 4968. https://doi.org/10.3390/nu15234968
Jang A-R, Lee Y-J, Kim D-Y, Lee T-S, Jung D-H, Kim Y-J, Seo I-S, Ahn J-H, Song E-J, Oh J, et al. Water Extract of Desalted Salicornia europaea Inhibits RANKL-Induced Osteoclast Differentiation and Prevents Bone Loss in Ovariectomized Mice. Nutrients. 2023; 15(23):4968. https://doi.org/10.3390/nu15234968
Chicago/Turabian StyleJang, Ah-Ra, Yun-Ji Lee, Dong-Yeon Kim, Tae-Sung Lee, Do-Hyeon Jung, Yeong-Jun Kim, In-Su Seo, Jae-Hun Ahn, Eun-Jung Song, Jisu Oh, and et al. 2023. "Water Extract of Desalted Salicornia europaea Inhibits RANKL-Induced Osteoclast Differentiation and Prevents Bone Loss in Ovariectomized Mice" Nutrients 15, no. 23: 4968. https://doi.org/10.3390/nu15234968