Next Article in Journal
Establishment of SV40 Large T-Antigen-Immortalized Yak Rumen Fibroblast Cell Line and the Fibroblast Responses to Lipopolysaccharide
Next Article in Special Issue
MazEF Homologs in Symbiobacterium thermophilum Exhibit Cross-Neutralization with Non-Cognate MazEFs
Previous Article in Journal
Antagonistic Activity of Oroxylin A against Fusarium graminearum and Its Inhibitory Effect on Zearalenone Production
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Toxins
Volume 15
Issue 9
10.3390/toxins15090536
toxins-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Unraveling the Role of the Zinc-Dependent Metalloproteinase/HTH-Xre Toxin/Antitoxin (TA) System of Brucella abortus in the Oxidative Stress Response: Insights into the Stress Response and Virulence

by
Leonardo A. Gómez
*,
Raúl E. Molina
,
Rodrigo I. Soto
,
Manuel R. Flores
,
Roberto F. Coloma-Rivero
,
David A. Montero
and
Ángel A. Oñate
*
Laboratory of Molecular Immunology, Department of Microbiology, Faculty of Biological Sciences, University of Concepción, Concepción 4030000, Chile
*
Authors to whom correspondence should be addressed.
Toxins 2023, 15(9), 536; https://doi.org/10.3390/toxins15090536
Submission received: 20 June 2023 / Revised: 24 August 2023 / Accepted: 28 August 2023 / Published: 31 August 2023
(This article belongs to the Special Issue Bacterial Toxin–Antitoxin Systems: Biological Functions and Mechanisms of Action)
Browse Figures
Review Reports Versions Notes

Abstract

:
Toxin/antitoxin (TA) systems have been scarcely studied in Brucella abortus, the causative agent of brucellosis, which is one of the most prevalent zoonotic diseases worldwide. In this study, the roles of a putative type II TA system composed by a Zinc-dependent metalloproteinase (ZnMP) and a transcriptional regulator HTH-Xre were evaluated. The deletion of the open reading frame (ORF) BAB1_0270, coding for ZnMP, used to produce a mutant strain, allowed us to evaluate the survival and gene expression of B. abortus 2308 under oxidative conditions. Our results showed that the B. abortus mutant strain exhibited a significantly reduced capacity to survive under hydrogen peroxide-induced oxidative stress. Furthermore, this mutant strain showed a decreased expression of genes coding for catalase (katE), alkyl hydroperoxide reductase (ahpC) and transcriptional regulators (oxyR and oxyR-like), as well as genes involved in the general stress response, phyR and rpoE1, when compared to the wild-type strain. These findings suggest that this type II ZnMP/HTH-Xre TA system is required by B. abortus to resist oxidative stress. Additionally, previous evidence has demonstrated that this ZnMP also participates in the acidic stress resistance and virulence of B. abortus 2308. Therefore, we propose a hypothetical regulatory function for this ZnMP/HTH-Xre TA system, providing insight into the stress response and its potential roles in the pathogenesis of B. abortus.
Keywords:
host-pathogen interaction; toxin-antitoxin (TA) systems; stress adaptation; virulence factors; transcriptional regulation
Key Contribution: This study was conducted to evaluate the roles of the ZnMP/HTH-Xre Toxin/Antitoxin (TA) system in B. abortus 2308 under oxidative stress conditions. By deleting ZnMP, a significant role of this TA system in the survival and expression of genes involved in the oxidative stress resistance was demonstrated.

1. Introduction

Toxin–Antitoxin (TA) systems are small genetic elements widely distributed among plasmids and chromosomes of procaryotes [1,2]. These TA systems are composed of a toxin (usually a protein, with the exception of type VIII toxin), which inhibits an essential cellular process and an antitoxin (can be either a protein or a RNA), which neutralizes the catalytic function of the toxin [2,3]. Based on the mechanisms by which the antitoxin inactivates the toxin, these TA systems have been classified into eight types (I–VIII) [2,3]. Their functions in bacterial physiology are diverse and include the stabilization of mobile genetic systems, the inhibition of phages, inducing programed cell death (PCD), promoting biofilm formation and providing resistance to antibiotics and stress conditions [3,4]. These functions are associated with the release of the toxin, which occurs when the antitoxin is degraded during stressful conditions, allowing it to act on several targets, such as transcription, protein translation, cell wall synthesis, and/or inducing metabolic stress [3,5,6]. These phenomena arrest bacterial growth and can generate a bacterial dormancy or persister state, which are phenotypes less susceptible to stressors, such as antibiotics, acidic conditions or oxidative compounds [5]. These phenotypes allow bacteria to persist inside the host cell for long periods of time despite antibiotic treatments or other stressors [5]. Furthermore, it was demonstrated that TA systems are involved in bacterial virulence, being required for colonization, intracellular survival, and infection processes of diverse bacterial pathogens [7,8,9,10,11,12,13,14,15].
Many intracellular bacteria possess diverse types of TA systems, which could be involved in the resistance against oxidative and acidic stress, and in the formation of dormant or persister phenotypes. Nevertheless, these systems have been scarcely studied in Brucella abortus, the causative agent of brucellosis, one of the most prevalent zoonotic diseases worldwide [16]. For instance, the BrnT/BrnA type II TA system was described in B. abortus by Heaton et al. [17], which is constituted by a ribonuclease toxin with a RelE-like fold and an antitoxin BrnA. This BrnT/BrnA complex is induced by different environmental stressors, such as oxidative and acidic pH stress, where the BrnT released causes the arrest of bacterial growth. The activity of BrnT can be neutralized by the expression of the antitoxin BrnA [17]. Furthermore, a recent report showed a high expression of several TA systems in clinical B. abortus and Brucella melitensis strains isolated from animals and humans, including RelE/RHH-like, Fic/Phd, Brnt/BrnA and cogT/cogAT [18,19]. The expression of all these TA systems was increased by the presence of gentamicin; and all, with the exception of cogT/cogAT, were also increased under acidic conditions [19]. Interestingly, B. abortus is exposed to these oxidative and acidic conditions during its intracellular trafficking through endosomes and lysosomes in macrophages and neutrophils. These phagocytic cells use several mechanisms to eliminate microorganisms, such as reactive oxygen or nitrogen species (O2−, H2O2 and NO) and acidic pH are produced by the respiratory burst and the activity of vacuolar proton ATPases, respectively [16,20,21]. However, B. abortus has evolved diverse mechanisms of immune evasion and the capacity to survive intracellularly in these cells, including a Brucella-containing vacuole (BCV) trafficking for early endosomes (EE), late endosomes (LE) and lysosomes (lys) [16,20,21]. Principio del formuary. Although this intracellular environment is highly microbicidal for multiple microorganisms, oxidative and acidic conditions induce in B. abortus the expression of superoxide dismutase (SodC), catalase (KatE) and alkyl hydroperoxide reductase (AhpC), enzymes that protect the bacterium from these oxidant compounds [22]. Moreover, the acidification of the BCV induces the expression of the virB operon, a group of genes coding for the type IV secretion system (T4SS) VirB, in B. abortus [23]. This T4SS VirB system allows B. abortus to translocate multiple effector proteins, such as Btp1/BtpA, RicA or BspB into the cytoplasm of infected cells to inhibit intracellular signaling pathways and vesicular transport in host cells [24,25]. These translocated effectors enable B. abortus to escape from endosome–phagolysosome compartments to vesicles derived from the endoplasmic reticulum (ER), where it develops its intracellular replicative niche [16,24,25].
Sophisticated regulatory mechanisms are required by B. abortus to survive intracellularly and to complete its lifecycle in diverse types of host cells during the infection. These mechanisms include the expression of BvrR/BvrS, VjbR/BlxR or HutC, which are activated by acidic pH conditions and, subsequently, trigger the expression of T4SS VirB and the translocation of several effector proteins involved in the virulence of this bacterium [26,27,28,29]. Furthermore, under acidic and oxidative stress, the General Stress Response (GSR) is activated through factors PhyR and sigma RpoE1 (σ) [30]. This response is required by B. abortus to survive under stress conditions, and to induce a chronic infection in mammalian hosts [30]. This evidence demonstrates that several regulatory factors participate in the adaptation of B. abortus during its intracellular lifecycle in professional and non-professional phagocytic cells. Interestingly, our group described the roles of a zinc-dependent metalloproteinase (ZnMP), which forms an operon with an HTH-Xre regulator, constituting a putative type II TA system in B. abortus [31]. Results showed that deletion of ORF BAB1_0270 (ZnMP) significantly affected the capacity of this pathogen to survive under acidic conditions, to escape from phagolysosomes to reach its replicative niche in ER-derived vesicles, to survive within phagocytic cells and to colonize mice tissues [31,32]. Notably, the deletion of BAB1_0270 (ZnMP) significantly reduced the expression of various genes coding for transcriptional regulators (e.g., vjbR, hutC, bvrR), T4SS VirB proteins (e.g., virB1, virb2, virB5) and their effectors (e.g., btpA, vceA and vceC) [31]. Therefore, considering that these TA systems have been scarcely studied in B. abortus, this work aimed to evaluate the roles of the type II ZnMP/HTH-Xre TA system in the survival of B. abortus 2308 subjected to oxidative conditions. Based on previous results, and those obtained in this study, we are proposing a regulatory mechanism for this TA system during the stress response and the virulence of B. abortus.

2. Results

2.1. Characterization of Type II TA System in B. abortus Strains

The TA systems in Brucella species have been poorly studied. In this study, a bioinformatic search was conducted to identify these systems in B. abortus 2308 and 9-941 strains. A search in the Toxin-Antitoxin Database TADB2.0 [33] allowed us to identify at least four potential type II TA systems present in the chromosome I of B. abortus biovar 1 strain 9-941 (https://www.ncbi.nlm.nih.gov/nuccore/NC_006932.1, accessed on 29 August 2023) and B. abortus strain 2308 (https://www.ncbi.nlm.nih.gov/nuccore/NC_007618, accessed on 29 August 2023) (Table 1). One of these TA systems is composed of the ZnMP (toxin) coded in the ORF BAB1_0270 (WP_002965518.1) present in a genomic island called “genomic island 3”, which is shared by some Brucella species, such as B. abortus 2308 and 9-941 strains [31,32,34]. This protein is homologous to the ImmA/IrrE metalloproteinases family, which is characterized by conserved domains COG2856 and motif HEXXH (pfam06114). Furthermore, this ZnMP forms an operon with a transcriptional-Helix-Turn-Helix (HTH)-Xre (Xenobiotic response element) regulator, which is constituted by a nucleotide sequence of 357 bp (WP_002967122.1) that translates a 118 amino acids (aa) protein (pfam13443) (Supplementary Data). Thus, both genes form an operon located in the region 270,612–271,513 of chromosome I in B. abortus 2308 (NC_007618.1) [31], similar to the operon coded by the ORFs BruAb1_0264 and BruAb1_0263 of B. abortus biovar 1 strain 9-941, which has been described by TADB2.0 as a type II TA system. Therefore, all evidence supports idea that ZnMP and HTH-Xre transcriptional regulator constitute a type II TA system, where ZnMP is the toxin and HTH-Xre is the antitoxin (Table 1).

2.2. ZnMP Is Required in the Resistance of B. abortus against Oxidative Conditions

Type II TA systems play significant roles in the bacterial adaptation to stress induced by acidic and/or oxidative conditions. The role of ZnMP protein in the stress resistance of B. abortus strains under oxidative conditions induced by various concentrations of H2O2 was measured. The results showed that the viability of the three strains was initially similar under low concentrations of H2O2 (from 0.1 to 0.2 mM) (p > 0.5); however, at concentrations of 0.4, 0.6 and 0.8 mM H2O2, the viability of B. abortus 270 strain (mutant for the ORF BAB1_0270) was significantly reduced when compared to the wild-type strain (p < 0.01) or the complemented strain B. abortus 270C (p < 0.01) (Figure 1). Moreover, H2O2 concentrations from 1.0 to 1.2 mM severely reduced the viability of B. abortus 270 strain when compared to the wild-type and complemented strains (Figure 1). These results indicate that type II TA system based on ZnMP/HTH-Xre is required for B. abortus to resist or tolerate oxidative conditions.

2.3. ZnMP (COG2856) in the Expression of Genes Coding for Antioxidant Components in B. abortus 2308

To survive inside phagocytic cells, B. abortus expresses diverse types of enzymes, such as catalase and alkyl hydroperoxide reductase C. The expression of these enzymes is mediated by OxyR transcriptional factors, as illustrated in the model described in Figure 2A,B. The expression of katE (ORF BAB2_0849), ahpC (ORF BAB2_0531), and the potential regulators oxyR (BAB2_0849) and oxyR-like (BAB2_0530) genes was measured by RT-qPCR. Results showed that B. abortus 2308 cultured under oxidative conditions upregulates the expression of katE (p < 0.05) and ahpC (p < 0.05) when compared to B. abortus 270 (Figure 2C,D). Furthermore, the expression of oxyR and oxyR-like lysR regulators was also significantly increased in B. abortus 2308 when compared to B. abortus 270 (Figure 2E,F) when these strains were subjected to oxidative conditions (p < 0.05 and p < 0.01, respectively). Nevertheless, although the expression of katE and ahpC genes in B. abortus 270 was significantly reduced when compared to wild-type strain, their expression was slightly less or similar, respectively, when it was compared to control group (Figure 2C,D). Similarly, the expression of the transcriptional regulators oxyR and OxyR-like lysR in B. abortus 270 was slightly less than the control group (Figure 2E,F). Complemented strain B. abortus 270C showed higher levels of expression for katE, ahpC, oxyR and oxyR-like lysR regulators when compared to B. abortus 270 (Supplementary Data). These results demonstrate that the deletion of ZnMP negatively affects the expression of several genes involved in the survival of B. abortus under oxidative stress conditions.

2.4. ZnMP in the Expression of phyR and rpoE1 of B. abortus

B. abortus requires the general stress response (GSR) to survive under acidic and oxidative conditions. This response is regulated by several components, such as PhyR and RpoE1, which are illustrated in the model shown in Figure 3A. The effects, by deleting ZnMP, in the expression of phyR (BAB1_1671) and rpoE1 (BAB1_1672) genes in B. abortus strains exposed under oxidative conditions was evaluated by RT-qPCR. The results showed that phyR and rpoE1 were significantly upregulated in B. abortus 2308 exposed to oxidative conditions (p < 0.01 and p < 0.05, respectively) compared to B. abortus 270 (Figure 3B,C). However, in B. abortus 270, the expression of phyR was slightly lower than control group, while the expression of rpoE1 was similar to the control group. Complemented strain B. abortus 270C showed higher levels of expression for phyR and rpoE1 when compared to B. abortus 270 (Supplementary Data). These genes coding for PhyR, a repressor of NepR, and for a RNA polymerase sigma factor (σ), respectively, are involved in the GSR of B. abortus. Therefore, these results suggest that type II ZnMP/HTH-Xre TA system contributes in the oxidative stress response of B. abortus.

3. Discussion

The type II TA systems are operons found in many bacterial and plasmid genomes that encode a toxin and an antitoxin protein [1,2,3]. These genetic module physically form a toxin–antitoxin complex, where the antitoxin inhibits the toxin’s activity on its cellular targets [1,2,3]. Toxins released can affect diverse bacterial functions, such as plasmid post-segregational killing, programmed cell death, defense against phages, biofilm formation, as well as antibiotic-induced persistence, or resistance to stress conditions [1,6]. These roles are associated with the inhibition of bacterial growth and/or induction of dormant or persister states, which are phenotypes less susceptible to stressors, such as antibiotics, acidic or oxidative compounds [5]. Recently, we demonstrated that ZnMP (BAB1_0270) of B. abortus strain 2308 forms an operon with a HTH-Xre transcriptional regulator, which may be a type II TA system [31]. By RT-PCR assays, it was confirmed that the messenger RNA (mRNA) of this B. abortus 2308 operon amplifies a PCR product of 906 pb containing the ORF BAB1_0270 of 549 bp (sequence for ZnMP) and the HTH-Xre transcriptional regulator of 357 bp [31]. In addition, this operon has a promoter in the regions -35 and -10 before HTH-Xre/ZnMP sequence, which is recognized by RpoD sigma factors of the RNA polymerase [31]. The deletion of ZnMP significantly reduced the growth of B. abortus lacking this protein under acidic conditions, the expression of several genes involved in the virulence and, consequently, reduced its ability to survive in macrophages and to colonize tissues in BALB/c mice [31,32]. Moreover, the deletion of ZnMP significantly reduced the ability of B. abortus to adapt intracellularly and to grow under acidic pH [31]. Interestingly, this deletion did not affect the growth of the mutant strain when compared to wild-type strain under physiological conditions (pH 7.2–7.4) [32]. Therefore, in this work, we studied the roles of this type II ZnMP/HTH-Xre TA system in the survival and gene expression of B. abortus 2308 cultured under oxidative conditions with the aim to understand whether this TA system exerts regulatory functions during the stress response of B. abortus 2308.
Our results revealed that B. abortus 2308 has four putative type II TA systems in chromosome I, including COG2856(ZnMP)/HTH XRE, RelE/RHH, Phd-Doc/AbrB, and BrnT/BrnA (Table 1). The ZnMP/HTH-Xre is an operon that consists of an Imma/IrrE family metallopeptidase (ZnMP) and a HTH-Xre transcriptional regulator [31]. It is a pair gene (Xre-COG2856) similar to those described in the related B. abortus biovar 1 strain 9-041 (Table 1) and also present in phylogenetically distant Gram-positive Streptococcus pneumoniae strains and Clostridioides difficile, as well as in bacterial thermophiles Geobacillus spp. [35,36,37]. These genes coding for COG2856/Xre are often found in mobile genetic elements, such as bacteriophages or transposons. Furthermore, COG2856 (ZnMP) proteins contain a conserved HEXXH motif, which is commonly associated with proteins that contain the HTH domain of the Xre family. In Bacillus subtilis, these proteins are involved in the genetic control of bacterial cell death, specifically in the induction of late genes of prophage PBSX, which largely depend on the xre gene [38]. This Xre protein regulates not only its own expression, but also the expression of other genes, including a downstream regulatory complex cascade [38]. On the other hand, ZnMP (COG2856) shares homology with proteins of the ImmA and IrrE families, which are present in B. subtilis and Deinococcus radiodurans and Deinococcus deserti, respectively [39,40,41]. ImmA and IrrE are proteases that cleave repressor proteins, such as ImmR and Ddro, respectively. Thus, ImmA cleaves ImmR, favoring the expression of genes involved in the transfer of mobile genetic elements, such as ICEBs1, and IrrE cleaves Ddro, favoring the transcription of several genes required for bacterial survival under conditions of ionizing radiation or ultraviolet radiation [39,40,41,42,43]. Moreover, IrrE is a key regulator of the recA gene [39,42,43,44], a protein strongly induced during irradiation, which orchestrates the cellular response to DNA damage via its multiple roles in the SOS response [45,46,47]. It is possible that the role played by IrrE in other bacteria may be performed by ZnMP in B. abortus, suggesting that this protein might exert pleiotropic effects that control large sets of genes encoding different metabolic and signaling pathways [42]. Additionally, some authors indicate that these COG2856/Xre proteins could be analogues of the well-characterized SOS response regulator LexA, a repressor of complex regulons [48,49,50]. These regulatory functions of IrrE have been demonstrated by transforming Escherichia coli and other bacteria with recombinant plasmids encoding the IrrE protein. This transformation has improved the tolerance of these bacteria to various abiotic stresses, such as irradiation, osmotic changes, heat, salt, and oxidative stress [51,52,53,54].
The roles of ZnMP under oxidative stress induced by H2O2 showed, by deleting ZnMP, a significant impact on the growth of B. abortus 270 (Figure 1). This effect was associated with a lower expression of genes coding for catalase (BAB2_0848) and AhpC (BAB2_0531), key enzymes in the survival of intracellular pathogens, such as Brucella species, Mycobacterium tuberculosis or Burkholderia spp. These enzymes detoxify peroxides, organic peroxides, and peroxynitrites into less toxic elements such as O2 and H2O2 [2,54,55,56,57,58,59]. Interestingly, the lower expression levels of antioxidant enzymes were directly associated with a lesser expression of oxyR (BAB1_0849) and oxyR-like (BAB2_0530), which are genes adjacent to katE (BAB2_0848) and ahpC (BAB2_0531), respectively, and that could be transcriptional regulators of these enzymes during bacterial exposition to H2O2 (Figure 2A,B) [60]. Recently, it was demonstrated that OxyR-like (BAB2_0530) is involved in the resistance of B. abortus to nitrosative stress, detergents, and also virulence, regulating diverse pathways, including nitrogen metabolism, siderophore biosynthesis and oligopeptide transport [61]. On the other hand, the expression of phyR and rpoE1 also was significantly reduced in B. abortus 270 when compared to the wild-type strain. These elements are involved in the GSR of B. abortus, which is a system consisting of a phospho-LovhK (LovhK~P) that transfers its phosphoryl group to PhyR (~P), which increases its affinity for NepR, a repressor of RpoE1 σ factor (Figure 3A) [31]. The binding between PhyR~P to NepR allows to release the σ-factor (RpoE1), which can associate the RNA polymerase (RNAP) to a specific genomic region regulating the transcription of genes required by the bacterium to survive under acute stress conditions [30,62,63]. Although the relationship between RpoE1, catalase, AhpC, OxyR and OxyR-like regulators is still unknown, it has been demonstrated in Azospirillum brasilense that RpoE1 can regulate the gene expression of OxyR and catalase [64,65]. These findings reporting the changes in gene expression could explain why a low expression of antioxidant response was observed in B. abortus 270 mutant strain.
Therefore, the evidence suggests that ZnMP plays critical roles in stress survival of B. abortus. Thus, the release of ZnMP from the toxin–antitoxin complex could allow it to exert its protease activity, leading to the development of dormant or persister phenotypes [5]. Nevertheless, considering the homology between ZnMP and IrrE protein, we hypothesize that ZnMP exerts a similar function in B. abortus, regulating pleiotropically diverse mechanisms involved in the stress response and virulence [31]. Thus, we propose a model to explain the complex roles that this type II ZnMP/HTH-Xre TA system could play in the physiology of B. abortus (Figure 4A,B). In this model, during the stress response, the type II toxin ZnMP is released from the antitoxin HTH-Xre by the activity of intracellular proteases, cleaving repressor proteins (e.g., HTH-Xre proteins) that inhibit the expression of genes involved in the stress response and virulence of B. abortus. These regulatory functions could represent a new pathway for type II TA systems, in which the released toxin does not induce toxic effects, such as cellular death, but rather controls the transcriptional expression of several genes involved in the stress response and/or virulence. Therefore, this hypothetical function challenges the historical conception about the functions of these TA systems, where they could accomplish more complex regulatory circuits than those currently described for type II TA systems. Additional experimental analyses are required to validate that the TA system here studied in silico accomplishes the specific regulatory functions to understand its contribution to the fitness of B. abortus during the infection. This understanding may help us to develop new strategies for the treatment of brucellosis.

4. Conclusions

In silico analysis demonstrated that Zinc-dependent metalloproteinase (ZnMP) (toxin) constitutes a type II TA system with a HTH-Xre transcriptional factor (antitoxin). ZnMP plays a crucial role in B. abortus´ adaptation to oxidative stress. Its deletion reduced the ability of B. abortus to survive when subjected to the presence of H2O2 and it also reduced the expression of antioxidant enzymes or regulatory factors involved in the response against oxidative stress when compared to the wild-type strain. Based on the evidence reported here, and previous reports demonstrating that ZnMP is required for B. abortus virulence, we can conclude that this postulated TA system is implicated in the regulation of the stress response and virulence of this bacterium. Therefore, this hypothetical function of ZnMP/Xre TA system could provide new insights into the regulatory mechanisms underlying the virulence and the stress response of B. abortus, thereby expanding our understanding on the roles of TA systems and how this pathogen adapts to its intracellular niche, a crucial adaptation in the progression of brucellosis in animals and humans.

5. Materials and Methods

5.1. Prediction of Type II TAs Loci in Chromosome I of B. abortus

Type II TA system present in the chromosome I of B. abortus biovar 1 strains 9-941 and B. abortus 2308 were analyzed using the Toxin–Antitoxin Database (TADB2) and TAfinder for type II TA system (http://bioinfo-mml.sjtu.edu.cn/TADB2/, accessed on 29 August 2023) [33]. Furthermore, comparative analysis for ImmA/IrrE family metallo-endopeptidase (WP_002965518.1) and HTH-Xre transcriptional regulator (WP_002967122.1) elements of type II Tas, were analyzed using Basic Local Alignment Search Tool (BLAST, https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 29 August 2023) from the GenBank database (https://www.ncbi.nlm.nih.gov/nuccore/NC_007618, accessed on 29 August 2023).

5.2. Bacterial Strains and Culture Conditions

B. abortus 2308 (wild type strain), B. abortus mutant strain for ORF BAB1_0270 (called B. abortus 270) and B. abortus complemented strain for BAB1_0270 (called B. abortus 270C strain) were used in this work [32]. All strains were cultured in Brucella broth (BD Difco, Thermo Fisher Scientific, Waltham, MA, USA) and incubated at 37 °C for 48–72 h. Additionally, B. abortus 270 and B. abortus 270C were cultured in Brucella broth with 50 μg/mL kanamycin and 30 μg/mL ampicillin, respectively, according to Ortiz-Román et al. [32]. All assays and experiments were performed following the procedure stablished by the Biosafety Committee of the University of Concepcion (Concepcion, Chile).

5.3. Viability of B. abortus under Oxidative Conditions

The role of ZnMP in the resistance of B. abortus to the stress when subjected to oxidative conditions was analyzed by exposing B. abortus 2308, B. abortus 270 and B. abortus 270C strains to 0, 0.2, 0.4, 0.6, 0.8, 1.0 or 1.2 mM hydrogen peroxide (H2O2) (Merk, Darmstadt, Germany) for 20 min. The viability of these bacterial strains was quantified by a colorimetric assay based on the use of the PrestoBlue reagent according to the manufacturer’s protocol (Thermo Fisher Scientific Inc., Waltham, MA, USA). Absorbance was measured on a VictorX3 microplate reader (PerkinElmer, Waltham, MA, USA) at 590 nm. Bacterial survival was analyzed in triplicate and results were expressed as the relative fluorescence units mean ± standard deviation.

5.4. Gene Expression of B. abortus Strains under Oxidative Conditions

Regulatory functions of ZnMP when this bacterium was subjected to oxidative stress was analyzed by gene expression of antioxidant components, such as catalase katE (ORF BAB2_0849), alkyl hydroperoxide reductase ahpC (ORF BAB2_0531), oxyR transcription factor (ORF BAB2_0848), oxyR-like LysR family transcription factor (ORF BAB2_0530), and components of the general stress response, such as phyR (BAB1_1671) and rpoE1 (BAB1_1672) through RT-qPCR. Briefly, B. abortus strains were cultured in the presence of 0.5 mM H2O2 during 24 h at 37 °C in Brucella broth. Later, total RNA was extracted from the pellets of each B. abortus strain, and centrifuged at 7500× g, using TRIzol (Thermo Fisher Scientific Inc., Waltham, MA, USA) following the instructions of the manufacturer. RNA was transformed to complementary DNA (cDNA) by reverse transcription using the Maxima First Strand cDNA Synthesis kit for RT-PCR (Thermo Fisher Scientific Inc., Waltham, MA, USA) and concentration of cDNA was adjusted using a Tecan Infinite M Nano equipment (Tecan Trading AG, Switzerland) to analyze the relative expression of the genes of interest (Table 2). The expression of each gene was quantified by the 2−ΔΔCT method using the Takyon q-PCR kit for SYBR assays by means of the AriaMx Real Time PCR system (Agilent Technologies, Santa Clara, CA, USA). The 16s housekeeping gene was used as reference gene for all assays. Additionally, total RNA from B. abortus 2308 wild-type strain cultured under normal conditions was used as a control group for gene expression (value 1). The gene expression was analyzed in triplicate and the results were expressed as the mean ± standard deviation.

5.5. Statistical Analysis

The statistical differences in the survival among strains cultured under oxidative conditions was determined by a two-way ANOVA. Gene expression was analyzed by non-parametric Mann–Whitney tests. All statistical analyses were performed using GraphPad Prism 9 software (GraphPad Software, San Diego, CA, USA). p values < 0.05 were considered as statistically significant.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/toxins15090536/s1.

Author Contributions

Conceptualization by L.A.G. and Á.A.O.; methodology by R.I.S. and L.A.G.; software analysis by R.E.M. and M.R.F.; validation by R.F.C.-R., D.A.M., Á.A.O. and L.A.G.; investigation by R.I.S. and L.A.G.; writing—original draft preparation by L.A.G.; writing—review and editing by Á.A.O., D.A.M. and L.A.G.; project administration and funding acquisition by L.A.G. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by projects VRID Nº2022000433-INI and FCB-I-2022-06, University de Concepción, Concepción-Chile.

Institutional Review Board Statement

The study was conducted in accordance with the Bioethics Committee of the University of Concepción, Concepción, Chile.

Informed Consent Statement

Not applicable.

Data Availability Statement

All experimental data that support the findings of this study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare do not have any conflicts of interest.

References

  1. Fraikin, N.; Goormaghtigh, F.; Van Melderen, L. Type II toxin-antitoxin systems: Evolution and revolutions. J. Bacteriol. 2020, 202, e00763-19. [Google Scholar] [CrossRef]
  2. Jurėnas, D.; Fraikin, N.; Goormaghtigh, F.; Van Melderen, L. Biology and evolution of bacterial toxin–antitoxin systems. Nat. Rev. Microbiol. 2022, 20, 335–350. [Google Scholar]
  3. Sonika, S.; Singh, S.; Mishra, S.; Verma, S. Toxin-antitoxin systems in bacterial pathogenesis. Heliyon 2023, 9, e14220. [Google Scholar]
  4. Kamruzzaman, M.; Wu, A.; Iredell, J. Biological functions of type II toxin-antitoxin systems in bacteria. Microorganisms 2021, 9, 1276. [Google Scholar] [CrossRef]
  5. Fisher, R.; Gollan, B.; Helaine, S. Persistent bacterial infections and persister cells. Nat. Rev. Microbiol. 2017, 15, 453–464. [Google Scholar] [CrossRef]
  6. Harms, A.; Brodersen, D.; Mitarai, N.; Gerdes, K. Toxins, targets, and triggers: An overview of toxin-antitoxin biology. Mol. Cell. 2018, 70, 768–784. [Google Scholar]
  7. Brown, J.S.; Gilliland, S.M.; Spratt, B.G.; Holden, D.W. A locus contained within a variable region of pneumococcal pathogenicity island 1 contributes to virulence in mice. Infect. Immun. 2004, 72, 1587–1593. [Google Scholar] [CrossRef]
  8. Ramage, H.R.; Connolly, L.E.; Cox, J.S. Comprehensive functional analysis of Mycobacterium tuberculosis toxin-antitoxin systems: Implications for pathogenesis, stress responses, and evolution. PLoS Genet. 2009, 5, e1000767. [Google Scholar] [CrossRef]
  9. Norton, J.P.; Mulvey, M.A. Toxin-antitoxin systems are important for niche-specific colonization and stress resistance of uropathogenic Escherichia coli. PLoS Pathog. 2012, 8, e1002954. [Google Scholar] [CrossRef]
  10. Ren, D.; Walker, A.N.; Daines, D.A. Toxin-antitoxin loci vapBC-1 and vapXD contribute to survival and virulence in nontypeable Haemophilus influenzae. BMC Microbiol. 2012, 12, 263. [Google Scholar] [CrossRef]
  11. Ren, D.; Kordis, A.A.; Sonenshine, D.E.; Daines, D.A. The ToxA-vapA toxin-antitoxin locus contributes to the survival of nontypeable Haemophilus influenzae during infection. PLoS ONE 2014, 9, e91523. [Google Scholar]
  12. Wood, T.L.; Wood, T.K. The HigB/HigA toxin/antitoxin system of Pseudomonas aeruginosa influences the virulence factors pyochelin, pyocyanin, and biofilm formation. Microbiol. Open 2016, 5, 499–511. [Google Scholar] [CrossRef]
  13. Wen, W.; Liu, B.; Xue, L.; Zhu, Z.; Niu, L.; Sun, B. Autoregulation and virulence control by the toxin-antitoxin system SavRS in Staphylococcus aureus. Infect. Immun. 2018, 86, e00032-18. [Google Scholar] [CrossRef] [PubMed]
  14. Tiwari, P.; Arora, G.; Singh, G.; Kidwai, S.; Narayan, O.P.; Singh, R. MazF ribonucleases promote Mycobacterium tuberculosis drug tolerance and virulence in guinea pigs. Nature Commun. 2015, 6, 6059. [Google Scholar] [CrossRef] [PubMed]
  15. Ma, D.; Mandell, J.B.; Donegan, N.P.; Cheung, A.L.; Ma, W.; Rothenberger, S.; Shanks, R.M.Q.; Richardson, A.R.; Urish, K.L. The toxin-antitoxin MazEF drives Staphylococcus aureus biofilm formation, antibiotic tolerance, and chronic infection. mBio 2019, 10, 1–15. [Google Scholar] [CrossRef] [PubMed]
  16. Celli, J. The intracellular lifecycle of Brucella spp. Microbiol. Spectr. 2019, 7, 1–17. [Google Scholar] [CrossRef]
  17. Heaton, B.; Herrou, J.; Blackwell, A.; Wysocki, V.; Crosson, S. Molecular structure, and function of the novel BrnT/BrnA toxin-antitoxin system of Brucella abortus. Biol. Chem. 2012, 287, 12098–12110. [Google Scholar] [CrossRef]
  18. Moradkasani, S.; Kouhsari, E.; Jazi, F.; Kalani, B.; Pakzad, I. Evaluation of putative toxin-antitoxins systems in clinical Brucella melitensis in Iran. Infect. Disord. Drug Targets. 2021, 21, 38–42. [Google Scholar] [CrossRef]
  19. Amraei, F.; Narimisa, N.; Kalani, B.; Mohammadzadeh, R.; Lohrasbi, V.; Jazi, F. The expression of type II TA system genes following exposure to the sub-inhibitory concentration of gentamicin and acid stress in Brucella spp. Microb. Pathog. 2020, 144, 104194. [Google Scholar] [CrossRef]
  20. Starr, T.; Ng, T.W.; Wehrly, T.D.; Knodler, L.A.; Celli, J. Brucella intracellular replication requires trafficking through the late endosomal/lysosomal compartment. Traffic. 2008, 9, 678–694. [Google Scholar] [CrossRef]
  21. Celli, J. The changing nature of the Brucella-containing vacuole. Cell. Microbiol. 2015, 17, 951–958. [Google Scholar] [CrossRef]
  22. Gee, J.M.; Valderas, M.W.; Kovach, M.E.; Grippe, V.K.; Robertson, G.T.; Ng, W.L.; Richardson, J.M.; Winkler, M.E.; Roop, R.M., II. The Brucella abortus Cu,Zn superoxide dismutase is required for optimal resistance to oxidative killing by murine macrophages and wild-type virulence in experimentally infected mice. Infect. Immun. 2005, 73, 2873–2880. [Google Scholar] [CrossRef]
  23. Boschiroli, M.L.; Ouahrani-Bettache, S.; Foulongne, V.; Michaux-Charachon, S.; Bourg, G.; Allardet-Servent, A.; Cazevieille, C.; Liautard, J.P.; Ramuz, M.; O’Callaghan, D. The Brucella suis virB operon is induced intracellularly in macrophages. Proc. Natl. Acad. Sci. USA 2002, 99, 1544–1549. [Google Scholar] [CrossRef]
  24. von Bargen, K.; Gorvel, J.P.; Salcedo, S.P. Internal affairs: Investigating the Brucella intracellular lifestyle. FEMS Microbiol. Rev. 2012, 36, 533–562. [Google Scholar] [CrossRef]
  25. Ke, Y.; Wang, Y.; Li, W.; Chen, Z. Type IV secretion system of Brucella spp. and its effectors. Front. Cell. Infect. Microbiol. 2015, 5, 72. [Google Scholar] [CrossRef] [PubMed]
  26. Sieira, R.; Arocena, G.M.; Bukata, L.; Comerci, D.J.; Ugalde, R.A. Metabolic control of virulence genes in Brucella abortus: HutC coordinates virB expression and the histidine utilization pathway by direct binding to both promoters. J. Bacteriol. 2010, 192, 217–224. [Google Scholar] [CrossRef] [PubMed]
  27. Arocena, G.; Zorreguieta, A.; Sieira, R. Expression of VjbR under nutrient limitation conditions is regulated at the post-transcriptional level by specific acidic pH values and urocanic acid. PLoS ONE 2012, 7, e35394. [Google Scholar] [CrossRef]
  28. Martínez-Núñez, C.; Altamirano-Silva, P.; Alvarado-Guillén, F.; Moreno, E.; Guzmán-Verri, C.; Chaves-Olarte, E. The two-component system BvrR/BvrS regulates the expression of the type IV secretion system VirB in Brucella abortus. J. Bacteriol. 2010, 192, 5603–5608. [Google Scholar] [CrossRef]
  29. Altamirano-Silva, P.; Meza-Torres, J.; Castillo-Zeledón, A.; Ruiz-Villalobos, N.; Zuñiga-Pereira, A.; Chacón-Díaz, C. Brucella abortus senses the intracellular environment through the BvrR/BvrS two-component system, which allows B. abortus to adapt to its replicative niche. Infect. Immun. 2018, 86, 1–15. [Google Scholar] [CrossRef]
  30. Kim, H.; Caswell, C.; Foreman, R.; Roop, R.M.; Crosson, S. The Brucella abortus general stress response system regulates chronic mammalian infection and is controlled by phosphorylation and proteolysis. J. Biol. Chem. 2013, 288, 13906–13916. [Google Scholar] [CrossRef] [PubMed]
  31. Gómez, L.A.; Alvarez, F.I.; Molina, R.E.; Soto-Shara, R.; Daza-Castro, C.; Flores, M.R.; León, Y.; Oñate, A. A zinc-dependent metalloproteinase of Brucella abortus is required in the intracellular adaptation of macrophages. Front. Microbiol. 2020, 11, 1586. [Google Scholar] [CrossRef] [PubMed]
  32. Ortiz-Román, L.; Riquelme-Neira, R.; Vidal, R.; Oñate, A. Roles of genomic island 3 (GI-3) BAB1_0267 and BAB1_0270 open reading frames (ORFs) in the virulence of Brucella abortus 2308. Vet. Microbiol. 2014, 172, 279–284. [Google Scholar] [CrossRef] [PubMed]
  33. Xie, Y.; Wei, Y.; Shen, Y.; Li, X.; Zhou, H.; Tai, C.; Deng, Z.; Ou, H. TADB 2.0: An updated database of bacterial type II toxin–antitoxin loci. Nucleic Acids Res. 2018, 46, 749–753. [Google Scholar] [CrossRef] [PubMed]
  34. Céspedes, S.; Salgado, P.; Retamal-Díaz, A.; Vidal, R.; Oñate, A. Roles of genomic island 3 (GI-3) BAB1_0278 and BAB1_0263 open reading frames (ORFs) in the virulence of Brucella abortus in BALB/c mice. Vet. Microbiol. 2012, 156, 1–7. [Google Scholar] [CrossRef]
  35. Chan, W.; Moreno-Córdoba, I.; Yeo, C.; Espinosa, M. Toxin-antitoxin genes of the Gram-positive pathogen Streptococcus pneumoniae: So few and yet so many. Microbiol. Mol. Biol. Rev. 2012, 76, 773–791. [Google Scholar] [CrossRef] [PubMed]
  36. Alkhalili, R.; Wallenius, J.; Canbäck, B. Towards exploring toxin-antitoxin systems in Geobacillus: A screen for type II toxin-antitoxin system families in a thermophilic genus. Int. J. Mol. Sci. 2019, 20, 5869. [Google Scholar] [CrossRef]
  37. Álvarez, R.; Ortega-Fuentes, C.; Queraltó, C.; Inostroza, O.; Díaz-Yáñez, F.; González, R.; Calderón, I.; Fuentes, J.A.; Paredes-Sabja, D.; Gil, F. Evaluation of functionality of type II toxin-antitoxin systems of Clostridioides difficile R20291. Microbiol. Res. 2020, 239, 126539. [Google Scholar] [CrossRef]
  38. McDonnell, G.; Wood, H.; Devine, K.; McConnell, D. Genetic control of bacterial suicide: Regulation of the induction of PBSX in Bacillus subtilis. J. Bacteriol. 1994, 176, 5820–5830. [Google Scholar] [CrossRef]
  39. Earl, A.; Mohundro, M.; Mian, I.; Battista, J. The IrrE protein of Deinococcus radiodurans R1 is a novel regulator of recA expression. J. Bacteriol. 2002, 184, 6216–6224. [Google Scholar] [CrossRef]
  40. Bose, B.; Auchtung, J.M.; Lee, C.A.; Grossman, A.D. A conserved anti-repressor controls horizontal gene transfers by proteolysis. Mol. Microbiol. 2008, 70, 570–582. [Google Scholar] [CrossRef]
  41. Ludanyi, M.; Blanchard, L.; Dulermo, R.; Brandelet, G.; Bellanger, L.; Pignol, D.; Lemaire, D.; de Groot, A. Radiation response in Deinococcus deserti: IrrE is a metalloprotease that cleaves repressor protein DdrO. Mol. Microbiol. 2014, 94, 434–449. [Google Scholar] [CrossRef] [PubMed]
  42. Zhou, Z.; Zhang, W.; Chen, M.; Pan, J.; Lu, W.; Ping, S.; Yan, Y.; Hou, X.; Yuan, M.; Zhan, Y.; et al. Genome-wide transcriptome and proteome analysis of Escherichia coli expressing IrrE, a global regulator of Deinococcus radiodurans. Mol. BioSyst. 2011, 7, 1613–1620. [Google Scholar] [CrossRef] [PubMed]
  43. Lim, S.; Jung, J.H.; Blanchard, L.; de Groot, A. Conservation and diversity of radiation and oxidative stress resistance mechanisms in Deinococcus species. FEMS Microbiol. Rev. 2019, 43, 19–52. [Google Scholar] [CrossRef] [PubMed]
  44. Hua, Y.; Narumi, I.; Gao, G.; Tian, B.; Satoh, K.; Kitayama, S.; Shen, B. PprI: A general switch responsible for extreme radioresistance of Deinococcus radiodurans. Biochem. Biophys. Res. Commun. 2003, 306, 354–360. [Google Scholar] [CrossRef] [PubMed]
  45. Liu, Y.; Zhou, J.; Omelchenko, M.V.; Beliaev, A.S.; Venkateswaran, A.; Stair, J.; Wu, L.; Thompson, D.K.; Xu, D.; Rogozin, I.B.; et al. Transcriptome dynamics of Deinococcus radiodurans recovering from ionizing radiation. Proc. Natl. Acad. Sci. USA 2003, 100, 4191–4196. [Google Scholar] [CrossRef]
  46. Tanaka, M.; Earl, A.M.; Howell, H.A.; Park, M.J.; Eisen, J.A.; Peterson, S.N.; Battista, J.R. Analysis of Deinococcus radiodurans’s transcriptional response to ionizing radiation and desiccation reveals novel proteins that contribute to extreme radioresistance. Genetics 2004, 168, 21–33. [Google Scholar] [CrossRef]
  47. Ohba, H.; Satoh, K.; Yanagisawa, T.; Narumi, I. The radiation responsive promoter of the Deinococcus radiodurans pprA gene. Gene 2005, 363, 133–141. [Google Scholar] [CrossRef]
  48. Fernandez De Henestrosa, A.R.; Ogi, T.; Aoyagi, S.; Chafin, D.; Hayes, J.J.; Ohmori, H.; Woodgate, R. Identification of additional genes belonging to the LexA regulon in Escherichia coli. Mol. Microbiol. 2000, 35, 1560–1572. [Google Scholar] [CrossRef]
  49. Kawano, M.; Aravind, L.; Storz, G. An antisense RNA controls synthesis of an SOS-induced toxin evolved from an antitoxin. Mol. Microbiol. 2007, 64, 738–754. [Google Scholar] [CrossRef]
  50. Weel-Sneve, R.; Bjoras, M.; Kristiansen, K. Overexpression of the LexA-regulated tisAB RNA in E. coli inhibits SOS functions; implications for regulation of the SOS response. Nucleic Acids Res. 2008, 36, 6249–6259. [Google Scholar] [CrossRef]
  51. Pan, J.; Wang, J.; Zhou, Z.; Yan, Y.; Zhang, W.; Lu, W. IrrE, a global regulator of extreme radiation resistance in Deinococcus radiodurans, enhances salt tolerance in Escherichia coli and Brassica napus. PLoS ONE 2009, 4, e4422. [Google Scholar] [CrossRef] [PubMed]
  52. Ma, R.; Zhang, Y.; Hong, H.; Lu, W.; Lin, M.; Chen, M.; Zhang, W. Improved osmotic tolerance and ethanol production of ethanologenic Escherichia coli by IrrE, a global regulator of radiation-resistance of Deinococcus radiodurans. Curr. Microbiol. 2010, 62, 659–664. [Google Scholar] [CrossRef] [PubMed]
  53. Zhang, Y.; Ma, R.; Zhao, Z.; Zhou, Z.; Lu, W.; Zhang, W.; Chen, M. IrrE, an exogenous gene from Deinococcus Radiodurans, improves the growth of and ethanol production by a Zymomonas Mobilis strain under ethanol and acid stress. J. Microbiol. Biotechnol. 2010, 20, 1156–1162. [Google Scholar]
  54. Zhao, P.; Zhou, Z.; Zhang, W.; Lin, M.; Chen, M.; Wei, G. Global transcriptional analysis of Escherichia coli expressing IrrE, a regulator from Deinococcus radiodurans, in response to NaCl shock. Mol. Biosyst. 2015, 11, 1165–1171. [Google Scholar] [CrossRef] [PubMed]
  55. Master, S.; Springer, B.; Sander, P.; Boettger, E.; Deretic, V.; Timmins, G. Oxidative stress response genes in Mycobacterium tuberculosis: Role of ahpC in resistance to peroxynitrite and stage-specific survival in macrophages. Microbiology 2002, 148, 3139–3144. [Google Scholar] [CrossRef]
  56. Kim, J.; Sha, Z.; Mayfield, J. Regulation of Brucella abortus catalase. Infect. Immun. 2000, 68, 3861–3866. [Google Scholar] [CrossRef]
  57. Poole, L. Bacterial defenses against oxidants: Mechanistic features of cysteine-based peroxidases and their flavoprotein reductases. Arch. Biochem. Biophy. 2005, 433, 240–254. [Google Scholar] [CrossRef]
  58. Steele, K.; Baumgartner, J.; Valderas, M.; Roop, R.M., II. Comparative study of the roles of AhpC and KatE as respiratory antioxidants in Brucella abortus 2308. J. Bacteriol. 2010, 192, 4912–4922. [Google Scholar] [CrossRef]
  59. Zhang, B.; Gu, H.; Yang, Y.; Bai, H.; Zhao, C.; Si, M.; Su, T.; Shen, X. Molecular mechanisms of AhpC in resistance to oxidative stress in Burkholderia thailandensis. Front. Microbiol. 2019, 10, 1483. [Google Scholar] [CrossRef]
  60. Christman, M.; Storz, G.; Ames, B. OxyR, a positive regulator of hydrogen peroxide-inducible genes in Escherichia coli and Salmonella typhimurium, is homologous to a family of bacterial regulatory proteins. Proc. Natl. Acad. Sci. USA 1989, 86, 3484–3488. [Google Scholar] [CrossRef]
  61. Tian, M.; Li, Z.; Qu, J.; Fang, T.; Yin, Y.; Zuo, D.; Abdelgawad, H.; Hu, H.; Wang, S.; Qi, J.; et al. The novel LysR-family transcriptional regulator BvtR is involved in the resistance of Brucella abortus to nitrosative stress, detergents and virulence through the genetic regulation of diverse pathways. Vet. Microbiol. 2022, 67, 109393. [Google Scholar] [CrossRef]
  62. Kim, H.S.; Willett, J.W.; Jain-Gupta, N.; Fiebig, A.; Crosson, S. The Brucella abortus virulence regulator, LovhK, is a sensor kinase in the general stress response signalling pathway. Mol. Microbiol. 2014, 94, 913–925. [Google Scholar] [CrossRef]
  63. Sycz, G.; Carrica, M.C.; Tseng, T.S.; Bogomolni, R.A.; Briggs, W.R.; Goldbaum, F.A.; Paris, G. LOV histidine kinase modulates the general stress response system and affects the virB operon expression in Brucella abortus. PLoS ONE 2015, 10, e0124058. [Google Scholar] [CrossRef] [PubMed]
  64. Willet, J.; Herrou, J.; Czyz, D.; Cheng, J.; Crosson, S. Brucella abortus ΔrpoE1 confers protective immunity against wild type challenge in a mouse model of brucellosis. Vaccine 2016, 34, 5073–5081. [Google Scholar] [CrossRef] [PubMed]
  65. Rai, A.; Singh, S.; Dwivedi, S.; Srivastava, A.; Pandey, P.; Kumar, S.; Singh, B.; Tripathi, A. Catalase expression in Azospirillum brasilense Sp7 is regulated by a network consisting of OxyR and Two RpoH paralogs and including an RpoE1→RpoH5 regulatory cascade. Appl. Environ. Microbiol. 2018, 84, e01787-18. [Google Scholar] [CrossRef] [PubMed]
Toxins 15 00536 g001
Figure 1. Role of ZnMP in the resistance of B. abortus under oxidative conditions. B. abortus 2308, B. abortus 270 and complemented B. abortus 270C strains were subjected to 0, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2 mM hydrogen peroxide for 20 min. The bacterial viability of each strain was quantified by a colorimetric assay measuring the relative fluorescence units (RFU) at 590 nm using PrestoBlue reagent (resazurin). Results are shown as the mean ± standard deviation. p values < 0.05 were considered statistically significant, ** denotes p values < 0.01. All tests were performed in triplicate.
Figure 1. Role of ZnMP in the resistance of B. abortus under oxidative conditions. B. abortus 2308, B. abortus 270 and complemented B. abortus 270C strains were subjected to 0, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2 mM hydrogen peroxide for 20 min. The bacterial viability of each strain was quantified by a colorimetric assay measuring the relative fluorescence units (RFU) at 590 nm using PrestoBlue reagent (resazurin). Results are shown as the mean ± standard deviation. p values < 0.05 were considered statistically significant, ** denotes p values < 0.01. All tests were performed in triplicate.
Toxins 15 00536 g001
Toxins 15 00536 g002
Figure 2. Deletion of ZnMP in the expression of genes coding for enzymes and regulators involved in the resistance of B. abortus under oxidative conditions. Model for transcriptional regulation of (A) catalase katE (ORF BAB2_0849) by OxyR transcription factors (ORF BAB2_0848) and (B) alkyl hydroperoxide reductase ahpC (ORF BAB2_0531) by OxyR-like LysR family transcription factors (ORF BAB2_0530) in B. abortus 2308. Gene expression of (C) katE, (D) ahpC, (E) oxyR and (F) oxyR-like. The expression of these genes was analyzed in B. abortus 2308 and in B. abortus 270 mutant for ZnMP cultured for 24 h under oxidative stress induced by H2O2. B. abortus 2308 grown in culture medium without H2O2 was used as a control group for gene expression (no induction, value 1). The expression of these genes was calculated by the 2−ΔΔCT method using RT-qPCR. The 16s housekeeping gene was used as reference. Results were expressed as the mean ± standard deviation. * denotes p value < 0.05 was considered statistically significant. ? indicates a possible role of OxyR-like in the transcriptional regulation of AhpC. All tests were performed in triplicate. Abbrev. RNAP: RNA polymerase, MCO: Multi cooper oxidase.
Figure 2. Deletion of ZnMP in the expression of genes coding for enzymes and regulators involved in the resistance of B. abortus under oxidative conditions. Model for transcriptional regulation of (A) catalase katE (ORF BAB2_0849) by OxyR transcription factors (ORF BAB2_0848) and (B) alkyl hydroperoxide reductase ahpC (ORF BAB2_0531) by OxyR-like LysR family transcription factors (ORF BAB2_0530) in B. abortus 2308. Gene expression of (C) katE, (D) ahpC, (E) oxyR and (F) oxyR-like. The expression of these genes was analyzed in B. abortus 2308 and in B. abortus 270 mutant for ZnMP cultured for 24 h under oxidative stress induced by H2O2. B. abortus 2308 grown in culture medium without H2O2 was used as a control group for gene expression (no induction, value 1). The expression of these genes was calculated by the 2−ΔΔCT method using RT-qPCR. The 16s housekeeping gene was used as reference. Results were expressed as the mean ± standard deviation. * denotes p value < 0.05 was considered statistically significant. ? indicates a possible role of OxyR-like in the transcriptional regulation of AhpC. All tests were performed in triplicate. Abbrev. RNAP: RNA polymerase, MCO: Multi cooper oxidase.
Toxins 15 00536 g002
Toxins 15 00536 g003
Figure 3. Deletion of ZnMP in the general stress response of B. abortus. (A) Model for activation of general stress response and its components. (B) Expression of phyR gene (ORF BAB1_1671) coding for anti-anti-repressor nepR. (C) Expression of rpoE1 gene (ORF BAB1_1672) coding for sigma factor (σ). The expression of these genes in B. abortus 2308 and B. abortus 270 mutant for ZnMP cultured for 24 h under oxidative stress induced by H2O2. B. abortus 2308 grown in culture medium without H2O2 was used as a control group for gene expression (no induction, value 1). The expression of these genes was calculated by the 2−ΔΔCT method using RT-qPCR. The 16s housekeeping gene was used as reference. Results were expressed as the mean ± standard deviation. A p value < 0.05 was considered statistically significant. All tests were performed in triplicate. * and ** denotes p values < 0.05 and 0.01, respectively.
Figure 3. Deletion of ZnMP in the general stress response of B. abortus. (A) Model for activation of general stress response and its components. (B) Expression of phyR gene (ORF BAB1_1671) coding for anti-anti-repressor nepR. (C) Expression of rpoE1 gene (ORF BAB1_1672) coding for sigma factor (σ). The expression of these genes in B. abortus 2308 and B. abortus 270 mutant for ZnMP cultured for 24 h under oxidative stress induced by H2O2. B. abortus 2308 grown in culture medium without H2O2 was used as a control group for gene expression (no induction, value 1). The expression of these genes was calculated by the 2−ΔΔCT method using RT-qPCR. The 16s housekeeping gene was used as reference. Results were expressed as the mean ± standard deviation. A p value < 0.05 was considered statistically significant. All tests were performed in triplicate. * and ** denotes p values < 0.05 and 0.01, respectively.
Toxins 15 00536 g003
Toxins 15 00536 g004
Figure 4. A hypothetical model for regulatory mechanisms mediated by anti-repressor activity of ZnMP during the stress response and virulence of B. abortus. (A) Expression of TA complex (ZnMP/HTH-Xre) in B. abortus 2308 under stress conditions leads the release of the ZnMP toxin by antitoxin proteolysis. The free ZnMP then exerts its proteolytic function against unknown repressors (possibly HTH-Xre repressor), enabling the transcription of several genes involved in the stress response, virulence and potentially in the DNA damage repair, such as the SOS-response; (B) The deletion of ZnMP in B. abortus 270 cultured under stress conditions prevents the cleavage of unknown repressors by ZnMP protease. As a result, RNA polymerase (RNAP) cannot bind to promoters, leading to a reduced transcription of several genes necessary for the survival of the bacterium under stress conditions. Dotted arrows and question marks (?) indicates that toxin may require various steps to reach its DNA target.
Figure 4. A hypothetical model for regulatory mechanisms mediated by anti-repressor activity of ZnMP during the stress response and virulence of B. abortus. (A) Expression of TA complex (ZnMP/HTH-Xre) in B. abortus 2308 under stress conditions leads the release of the ZnMP toxin by antitoxin proteolysis. The free ZnMP then exerts its proteolytic function against unknown repressors (possibly HTH-Xre repressor), enabling the transcription of several genes involved in the stress response, virulence and potentially in the DNA damage repair, such as the SOS-response; (B) The deletion of ZnMP in B. abortus 270 cultured under stress conditions prevents the cleavage of unknown repressors by ZnMP protease. As a result, RNA polymerase (RNAP) cannot bind to promoters, leading to a reduced transcription of several genes necessary for the survival of the bacterium under stress conditions. Dotted arrows and question marks (?) indicates that toxin may require various steps to reach its DNA target.
Toxins 15 00536 g004
Table 1. Putative type II TAs present in the chromosome I of B. abortus biovar 1 str. 9-941 and B. abortus 2308 analyzed by TADB2.
Table 1. Putative type II TAs present in the chromosome I of B. abortus biovar 1 str. 9-941 and B. abortus 2308 analyzed by TADB2.
BiovarTypeToxinAntitoxinLocation (Chr I)Classification (T/A)
1B. abortus bv. 1 str. 9-941IIBruAb1_0264BruAb1_0263274,246–275,147COG2856/HTH Xre
B. abortus 2308IIBAB1_0270*BAB_RS17200270,612–271,513COG2856 (ZnMP)/HTH Xre
2B. abortus bv. 1 str. 9-941IIBruAb1_0430BruAb1_0431435,226–435,800RelE/RHH-RelE
B. abortus 2308IIBAB1_0436BAB1_0437431,593–432,167ParE/RHH-RelE
3B. abortus bv. 1 str. 9-941IIBruAb1_0579BruAb1_0580574,332–574,948phd-doc/AbrB-Fic
B. abortus 2308IIBAB1_0581BAB1_0582570,627–571,243Phd-doc/AbrB:SpoVT
4B. abortus bv. 1 str. 9-941IIBruAb1_0981BruAb1_0980962,125–962,759BrnT/BrnA
B. abortus 2308IIBAB1_0994BAB1_0993962,125–962,759BrnT/BrnA
*BAB_RS17200 is a new locus not previously described in the genome of B. abortus biovar 2308, which is similar to BruAb1_0263 from B. abortus biovar 1 str. 9-941. It codifies a transcriptional regulator present in Brucella and Ochrobactrum groups (WP_002967122.1).
Table 2. Primers for genes expression measured by RT-qPCR in B. abortus strains exposed to hydrogen peroxide.
Table 2. Primers for genes expression measured by RT-qPCR in B. abortus strains exposed to hydrogen peroxide.
FunctionORF/Gene Sequence from 5′ to 3′
Housekeeping16sForwardagctagttggtggggtaaagg
Reversegctgatcatcctctcagacca
Antioxidant enzymeskatE
(BAB2_0848)		Forwardaccatgggtgacgttcctc
Reversegatgagcttcaggttcagca
ahpC
(BAB2_0531)		Forwardcgatctggtcgtttgctgata
Reversecaacgaaggtgtagcgatagg
Transcriptional factorsoxyR
(BAB2_0849)		Forwardcttttcgacgaccgttttct
Reversecgaggcgagaaccgtatg
oxyR-like
(BAB2_0530)		Forwardtactcgaaaccgggcatt
Reversectcatttgcgcaggcttt
General stress responsephyR
(BAB1_1671)		Forwardattttcatcaccgcatttcc
Reversecggcttggtgacgagaaa
rpoE1
(BAB1_1672)		Forwardgcttggctcttcaccattct
Reverseagctgttcgctgaacatacc
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gómez, L.A.; Molina, R.E.; Soto, R.I.; Flores, M.R.; Coloma-Rivero, R.F.; Montero, D.A.; Oñate, Á.A. Unraveling the Role of the Zinc-Dependent Metalloproteinase/HTH-Xre Toxin/Antitoxin (TA) System of Brucella abortus in the Oxidative Stress Response: Insights into the Stress Response and Virulence. Toxins 2023, 15, 536. https://doi.org/10.3390/toxins15090536

AMA Style

Gómez LA, Molina RE, Soto RI, Flores MR, Coloma-Rivero RF, Montero DA, Oñate ÁA. Unraveling the Role of the Zinc-Dependent Metalloproteinase/HTH-Xre Toxin/Antitoxin (TA) System of Brucella abortus in the Oxidative Stress Response: Insights into the Stress Response and Virulence. Toxins. 2023; 15(9):536. https://doi.org/10.3390/toxins15090536

Chicago/Turabian Style

Gómez, Leonardo A., Raúl E. Molina, Rodrigo I. Soto, Manuel R. Flores, Roberto F. Coloma-Rivero, David A. Montero, and Ángel A. Oñate. 2023. "Unraveling the Role of the Zinc-Dependent Metalloproteinase/HTH-Xre Toxin/Antitoxin (TA) System of Brucella abortus in the Oxidative Stress Response: Insights into the Stress Response and Virulence" Toxins 15, no. 9: 536. https://doi.org/10.3390/toxins15090536

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop