Functional Link between miR-200a and ELK3 Regulates the Metastatic Nature of Breast Cancer
Abstract
:1. Introduction
2. Results
2.1. Stability of the ELK3 mRNA Differs between Breast Cancer Subtypes
2.2. 3’UTR Is Responsible for Destabilization of the ELK3 mRNA
2.3. miR-200a Promotes Destabilization of the ELK3 mRNA by Targeting Its 3’UTR
2.4. miR-200a Expression Negatively Correlates with that of the ELK3 mRNA Level in Breast Cancer Cells
2.5. miR-200a/ELK3 Axis Regulates Cell Invasion and Extravasation in Breast Cancer
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Transfection
4.2. Plasmids and miR-200a
4.3. Quantitative RT-PCR
4.4. Luciferase Reporter Assays
4.5. Bisulfite Sequencing
4.6. Prediction of Candidate miRNAs
4.7. Cell Migration and Invasion Assay
4.8. Mouse Lung Extravasation Assays
4.9. RNA-Seq Analysis
4.10. Genomic Analyses of Human Breast Cancer Patient Samples and Breast Cancer Cells
4.11. Western Blot Analysis
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Audic, Y.; Hartley, R.S. Post-transcriptional regulation in cancer. Biol. Cell 2004, 96, 479–498. [Google Scholar] [CrossRef] [PubMed]
- Schwanhausser, B.; Busse, D.; Li, N.; Dittmar, G.; Schuchhardt, J.; Wolf, J.; Chen, W.; Selbach, M. Global quantification of mammalian gene expression control. Nature 2011, 473, 337–342. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Derrigo, M.; Cestelli, A.; Savettieri, G.; Di Leigro, I. RNA-protein interactions in the control of stability and localization of messenger RNA. Int. J. Mol. Med. 2000, 5, 111–123. [Google Scholar] [CrossRef] [PubMed]
- Fabian, M.R.; Sonenberg, N.; Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Ann. Rev. Biochem. 2010, 79, 351–379. [Google Scholar] [CrossRef] [Green Version]
- Oliveto, S.; Mancino, M.; Manfrini, N.; Biffo, S. Role of microRNAs in translation regulation and cancer. World J. Biol. Chem. 2017, 8, 45–56. [Google Scholar] [CrossRef]
- Ha, T.Y. MicroRNAs in Human Diseases: From Cancer to Cardiovascular Disease. Immune Netw. 2011, 11, 135–154. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.; Zhang, L. Members of the microRNA-200 family are promising therapeutic targets in cancer. Exp. Ther. Med. 2017, 14, 10–17. [Google Scholar] [CrossRef] [Green Version]
- Gibbons, D.L.; Lin, W.; Creighton, C.J.; Rizvi, Z.H.; Gregory, P.A.; Goodall, G.J.; Thilaganathan, N.; Du, L.; Zhang, Y.; Pertsemlidis, A.; et al. Contextual extracellular cues promote tumor cell EMT and metastasis by regulating miR-200 family expression. Genes Dev. 2009, 23, 2140–2151. [Google Scholar] [CrossRef] [Green Version]
- O’Brien, S.J.; Carter, J.V.; Burton, J.F.; Oxford, B.G.; Schmidt, M.N.; Hallion, J.C.; Galandiuk, S. The role of the miR-200 family in epithelial-mesenchymal transition in colorectal cancer: A systematic review. Int. J. Cancer 2018, 142, 2501–2511. [Google Scholar] [CrossRef]
- Gregory, P.A.; Bert, A.G.; Paterson, E.L.; Barry, S.C.; Tsykin, A.; Farshid, G.; Vadas, M.A.; Khew-Goodall, Y.; Goodall, G.J. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat. Cell Biol. 2008, 10, 593–601. [Google Scholar] [CrossRef]
- Title, A.C.; Hong, S.J.; Pires, N.D.; Hasenohrl, L.; Godbersen, S.; Stokar-Regenscheit, N.; Bartel, D.P.; Stoffel, M. Genetic dissection of the miR-200-Zeb1 axis reveals its importance in tumor differentiation and invasion. Nat. Commun. 2018, 9, 4671. [Google Scholar] [CrossRef] [PubMed]
- Humphries, B.; Yang, C. The microRNA-200 family: Small molecules with novel roles in cancer development, progression and therapy. Oncotarget 2015, 6, 6472–6498. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Buchwalter, G.; Gross, C.; Wasylyk, B. Ets ternary complex transcription factors. Gene 2004, 324, 1–14. [Google Scholar] [CrossRef]
- Giovane, A.; Pintzas, A.; Maira, S.M.; Sobieszczuk, P.; Wasylyk, B. Net, a new ets transcription factor that is activated by Ras. Genes Dev. 1994, 8, 1502–1513. [Google Scholar] [CrossRef] [Green Version]
- Heo, S.H.; Lee, J.Y.; Yang, K.M.; Park, K.S. ELK3 Expression Correlates With Cell Migration, Invasion, and Membrane Type 1-Matrix Metalloproteinase Expression in MDA-MB-231 Breast Cancer Cells. Gene Expr. 2015, 16, 197–203. [Google Scholar] [CrossRef]
- Lee, J.H.; Hur, W.; Hong, S.W.; Kim, J.H.; Kim, S.M.; Lee, E.B.; Yoon, S.K. ELK3 promotes the migration and invasion of liver cancer stem cells by targeting HIF-1alpha. Oncol. Rep. 2017, 37, 813–822. [Google Scholar] [CrossRef]
- Semenchenko, K.; Wasylyk, C.; Cheung, H.; Tourrette, Y.; Maas, P.; Schalken, J.A.; van der Pluijm, G.; Wasylyk, B. XRP44X, an Inhibitor of Ras/Erk Activation of the Transcription Factor Elk3, Inhibits Tumour Growth and Metastasis in Mice. PLoS ONE 2016, 11, e0159531. [Google Scholar] [CrossRef] [Green Version]
- Kong, S.Y.; Kim, K.S.; Kim, J.; Kim, M.K.; Lee, K.H.; Lee, J.Y.; Oh, N.; Park, J.I.; Park, J.H.; Heo, S.H.; et al. The ELK3-GATA3 axis orchestrates invasion and metastasis of breast cancer cells in vitro and in vivo. Oncotarget 2016, 7, 65137–65146. [Google Scholar] [CrossRef] [Green Version]
- Cho, H.J.; Oh, N.; Park, J.H.; Kim, K.S.; Kim, H.K.; Lee, E.; Hwang, S.; Kim, S.J.; Park, K.S. ZEB1 Collaborates with ELK3 to Repress E-Cadherin Expression in Triple-Negative Breast Cancer Cells. Mol. Cancer Res. MCR 2019, 17, 2257–2266. [Google Scholar] [CrossRef] [Green Version]
- Ahmad, A.; Zhang, W.; Wu, M.; Tan, S.; Zhu, T. Tumor-suppressive miRNA-135a inhibits breast cancer cell proliferation by targeting ELK1 and ELK3 oncogenes. Genes Genom. 2018, 40, 243–251. [Google Scholar] [CrossRef]
- Robertson, E.D.; Wasylyk, C.; Ye, T.; Jung, A.C.; Wasylyk, B. The oncogenic MicroRNA Hsa-miR-155-5p targets the transcription factor ELK3 and links it to the hypoxia response. PLoS ONE 2014, 9, e113050. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheishvili, D.; Stefanska, B.; Yi, C.; Li, C.C.; Yu, P.; Arakelian, A.; Tanvir, I.; Khan, H.A.; Rabbani, S.; Szyf, M. A common promoter hypomethylation signature in invasive breast, liver and prostate cancer cell lines reveals novel targets involved in cancer invasiveness. Oncotarget 2015, 6, 33253–33268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matoulkova, E.; Michalova, E.; Vojtesek, B.; Hrstka, R. The role of the 3’ untranslated region in post-transcriptional regulation of protein expression in mammalian cells. RNA Biol. 2012, 9, 563–576. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Riaz, M.; van Jaarsveld, M.T.; Hollestelle, A.; Prager-van der Smissen, W.J.; Heine, A.A.; Boersma, A.W.; Liu, J.; Helmijr, J.; Ozturk, B.; Smid, M.; et al. miRNA expression profiling of 51 human breast cancer cell lines reveals subtype and driver mutation-specific miRNAs. Breast Cancer Res. 2013, 15, R33. [Google Scholar] [CrossRef] [Green Version]
- Li, T.Z.; Kim, S.M.; Hur, W.; Choi, J.E.; Kim, J.H.; Hong, S.W.; Lee, E.B.; Lee, J.H.; Yoon, S.K. Elk-3 Contributes to the Progression of Liver Fibrosis by Regulating the Epithelial-Mesenchymal Transition. Gut Liver 2017, 11, 102–111. [Google Scholar] [CrossRef] [Green Version]
- Yoo, S.M.; Lee, C.J.; An, H.J.; Lee, J.Y.; Lee, H.S.; Kang, H.C.; Cho, S.J.; Kim, S.M.; Park, J.; Kim, D.J.; et al. RSK2-Mediated ELK3 Activation Enhances Cell Transformation and Breast Cancer Cell Growth by Regulation of c-fos Promoter Activity. Int. J. Mol. Sci. 2019, 20, 1994. [Google Scholar] [CrossRef] [Green Version]
- Anastasiadi, D.; Esteve-Codina, A.; Piferrer, F. Consistent inverse correlation between DNA methylation of the first intron and gene expression across tissues and species. Epigenet. Chromatin 2018, 11, 37. [Google Scholar] [CrossRef]
- Kao, S.H.; Wu, K.J.; Lee, W.H. Hypoxia, epithelial-mesenchymal transition, and TET-mediated epigenetic changes. J. Clin. Med. 2016, 5, E24. [Google Scholar] [CrossRef] [Green Version]
- Koo, J.; Cabarcas-Petroski, S.; Petrie, J.L.; Diette, N.; White, R.J.; Schramm, L. Induction of proto-oncogene BRF2 in breast cancer cells by the dietary soybean isoflavone daidzein. BMC Cancer 2015, 15, 905. [Google Scholar] [CrossRef] [Green Version]
- Wei, J.; Zhang, Y.; Luo, Y.; Wang, Z.; Bi, S.; Song, D.; Dai, Y.; Wang, T.; Qiu, L.; Wen, L.; et al. Aldose reductase regulates miR-200a-3p/141-3p to coordinate Keap1-Nrf2, Tgfbeta1/2, and Zeb1/2 signaling in renal mesangial cells and the renal cortex of diabetic mice. Free Radic. Biol. Med. 2014, 67, 91–102. [Google Scholar] [CrossRef] [Green Version]
- Brabletz, S.; Brabletz, T. The ZEB/miR-200 feedback loop--a motor of cellular plasticity in development and cancer? Embo Rep. 2010, 11, 670–677. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Burk, U.; Schubert, J.; Wellner, U.; Schmalhofer, O.; Vincan, E.; Spaderna, S.; Brabletz, T. A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. Embo Rep. 2008, 9, 582–589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bracken, C.P.; Gregory, P.A.; Kolesnikoff, N.; Bert, A.G.; Wang, J.; Shannon, M.F.; Goodall, G.J. A double-negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transition. Cancer Res. 2008, 68, 7846–7854. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhan, Y.; Liang, X.; Li, L.; Wang, B.; Ding, F.; Li, Y.; Wang, X.; Zhan, Q.; Liu, Z. MicroRNA-548j functions as a metastasis promoter in human breast cancer by targeting Tensin1. Mol. Oncol. 2016, 10, 838–849. [Google Scholar] [CrossRef] [Green Version]
- Rutnam, Z.J.; Wight, T.N.; Yang, B.B. miRNAs regulate expression and function of extracellular matrix molecules. Matrix Biol. J. Int. Soc. Matrix Biol. 2013, 32, 74–85. [Google Scholar] [CrossRef] [Green Version]
- Yang, R.; Xu, J.; Hua, X.; Tian, Z.; Xie, Q.; Li, J.; Jiang, G.; Cohen, M.; Sun, H.; Huang, C. Overexpressed miR-200a promotes bladder cancer invasion through direct regulating Dicer/miR-16/JNK2/MMP-2 axis. Oncogene 2020, 39, 1983–1996. [Google Scholar] [CrossRef] [Green Version]
- Yu, S.J.; Hu, J.Y.; Kuang, X.Y.; Luo, J.M.; Hou, Y.F.; Di, G.H.; Wu, J.; Shen, Z.Z.; Song, H.Y.; Shao, Z.M. MicroRNA-200a promotes anoikis resistance and metastasis by targeting YAP1 in human breast cancer. Clin. Cancer Res. 2013, 19, 1389–1399. [Google Scholar] [CrossRef] [Green Version]
- Le, M.T.; Hamar, P.; Guo, C.; Basar, E.; Perdigao-Henriques, R.; Balaj, L.; Lieberman, J. miR-200-containing extracellular vesicles promote breast cancer cell metastasis. J. Clin. Investig. 2014, 124, 5109–5128. [Google Scholar] [CrossRef] [Green Version]
- Pichler, M.; Ress, A.L.; Winter, E.; Stiegelbauer, V.; Karbiener, M.; Schwarzenbacher, D.; Scheideler, M.; Ivan, C.; Jahn, S.W.; Kiesslich, T.; et al. MiR-200a regulates epithelial to mesenchymal transition-related gene expression and determines prognosis in colorectal cancer patients. Br. J. Cancer 2014, 110, 1614–1621. [Google Scholar] [CrossRef] [Green Version]
- Li, X.; Roslan, S.; Johnstone, C.N.; Wright, J.A.; Bracken, C.P.; Anderson, M.; Bert, A.G.; Selth, L.A.; Anderson, R.L.; Goodall, G.J.; et al. MiR-200 can repress breast cancer metastasis through ZEB1-independent but moesin-dependent pathways. Oncogene 2014, 33, 4077–4088. [Google Scholar] [CrossRef]
- Wang, J.; Song, W.; Shen, W.; Yang, X.; Sun, W.; Qu, S.; Shang, R.; Ma, B.; Pu, M.; Tao, K.; et al. MicroRNA-200a Suppresses Cell Invasion and Migration by Directly Targeting GAB1 in Hepatocellular Carcinoma. Oncol. Res. 2017, 25, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Tsouko, E.; Wang, J.; Frigo, D.E.; Aydogdu, E.; Williams, C. miR-200a inhibits migration of triple-negative breast cancer cells through direct repression of the EPHA2 oncogene. Carcinogenesis 2015, 36, 1051–1060. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang da, W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef] [PubMed]
- Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; Simonovic, M.; Doncheva, N.T.; Morris, J.H.; Bork, P.; et al. STRING v11: Protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019, 47, D607–D613. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Forward Primer (5’ to 3’) | Reverse Primer (5’ to 3’) |
---|---|---|
ELK3 | ACCCAAAGGCTTGGAAATCT | TGTATGCTGGAGAGCAGTGG |
ELK3_bisulfite | GAGTGGGTAAAGTGTATTGGTGTT | AATCATTTCTTACCTAATCCTTCTCC |
ELK3_5’UTR | TAGCTAGCAAAAGCCTGTTTACACAGACTGC | TAGCTAGCACCCAGATGTGGGGGAGT |
ELK3_3’UTR | CTCGAGTGACGTCTGGCCACAATTAAG | GTCGACTTGGTTGAGATTTTTGCACAT |
ELK3_3’UTR_Mut | TAAGAGTCATTAAGCAGACATAAAAGGGA | GACTCTTAAACTGCTATGGGAAAAGTTTTATAG |
BRF2 | CAGAAGTGGAGACCCGAGAG | CAGGGAGGGTTAGGGACACT |
Endo_ELK3_CDS_3’UTR | TGATGACGTCTGGCCACAAT | GGTAAACTAGCCCGTGGGG |
Exo_Flag_ELK3_CDS | TGATGTTCTTGTCATAATAGTATCGCAG | GATTACAAGGATGACGACGATAAGAA |
LAMA5_ | GGACTACATGGGTGTGTCTC | TTTCCTGGATCATCTGTCTC |
TNS1 | GGCTTAGAGCGAGAGAAGCA | CCCGTCCAGAGAAGAGAGTG |
CDH1 | ATGCAGAAACTGGCATCCTC | AGTCCTCGGACACTTCCACT |
ZEB1 | TGCACTGAGTGTGGAAAAGC | TGGTGATGCTGAAAGAGACG |
GAPDH | GGGTGTGAACCATGAGAA | GTCTTCTGGGTGGCAGTGAT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, H.-K.; Park, J.D.; Choi, S.H.; Shin, D.J.; Hwang, S.; Jung, H.-Y.; Park, K.-S. Functional Link between miR-200a and ELK3 Regulates the Metastatic Nature of Breast Cancer. Cancers 2020, 12, 1225. https://doi.org/10.3390/cancers12051225
Kim H-K, Park JD, Choi SH, Shin DJ, Hwang S, Jung H-Y, Park K-S. Functional Link between miR-200a and ELK3 Regulates the Metastatic Nature of Breast Cancer. Cancers. 2020; 12(5):1225. https://doi.org/10.3390/cancers12051225
Chicago/Turabian StyleKim, Hyung-Keun, Joo Dong Park, Seung Hee Choi, Dong Jun Shin, Sohyun Hwang, Hae-Yun Jung, and Kyung-Soon Park. 2020. "Functional Link between miR-200a and ELK3 Regulates the Metastatic Nature of Breast Cancer" Cancers 12, no. 5: 1225. https://doi.org/10.3390/cancers12051225