Caveolin-1-Mediated Tumor Suppression Is Linked to Reduced HIF1α S-Nitrosylation and Transcriptional Activity in Hypoxia
Abstract
:1. Introduction
2. Results
2.1. CAV1 Reduces HIF-Dependent Transcriptional Activity in Cancer Cells
2.2. Reduced HIF1-Activation by CAV1 Is Not Due to Altered HIF1α Stability or Sequestration by CAV1
2.3. CAV1-Mediated HIF1α Inhibition Involves NOS Activity and Reduced HIF1α S-Nitrosylation in Hypoxia
2.4. CAV1 Tumor Suppression Function Involves NO In Vivo
3. Discussion
3.1. CAV1 Does Not Alter HIF1α Protein Levels in Hypoxic Cancer Cells
3.2. CAV1 Inhibits HIF1α in Hypoxic Cancer Cells
3.3. CAV1 Modulates HIF1α-S-Nitrosylation in Hypoxia In Vitro
4. Materials and Methods
4.1. Materials
4.2. Cell Culture and Transfection
4.3. Plasmids
4.4. Hypoxia Treatment
4.5. HIF-Gene Reporter Assay
4.6. Western Blot
4.7. HIF1α Biotin Switch Assay
4.8. Analysis of mRNA by PCR
4.9. Indirect Immunofluorescence
4.10. Tumor Formation Assay
4.11. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Martinez-Outschoorn, U.; Sotgia, F.; Lisanti, M.P. Caveolae and signalling in cancer. Nat. Rev. Cancer 2015, 15, 225–237. [Google Scholar] [CrossRef]
- Quest, A.F.; Lobos-Gonzalez, L.; Nunez, S.; Sanhueza, C.; Fernandez, J.-G.; Aguirre, A.; Rodriguez, D.; Leyton, L.; Torres, V. The caveolin-1 connection to cell death and survival. Curr. Mol. Med. 2013, 13, 266–281. [Google Scholar] [CrossRef]
- Nunez-Wehinger, S.; Ortiz, R.; Diaz, N.; Diaz, J.; Lobos-Gonzalez, L.; Quest, A.F. Caveolin-1 in cell migration and metastasis. Curr. Mol. Med. 2014, 14, 255–274. [Google Scholar] [CrossRef]
- Quest, A.F.; Gutierrez-Pajares, J.L.; Torres, V.A. Caveolin-1: An ambiguous partner in cell signalling and cancer. J. Cell. Mol. Med. 2008, 12, 1130–1150. [Google Scholar] [CrossRef] [Green Version]
- Arpaia, E.; Blaser, H.; Quintela-Fandino, M.; Duncan, G.; Leong, H.; Ablack, A.; Nambiar, S.C.; Lind, E.F.; Silvester, J.; Fleming, C.K.; et al. The interaction between caveolin-1 and Rho-GTPases promotes metastasis by controlling the expression of alpha5-integrin and the activation of Src, Ras and Erk. Oncogene 2011, 31, 884–896. [Google Scholar] [CrossRef] [Green Version]
- Rodriguez, D.A.; Tapia, J.C.; Fernandez, J.G.; Torres, V.A.; Muñoz, N.; Galleguillos, D.; Leyton, L.; Quest, A.F. Caveolin-1–mediated Suppression of Cyclooxygenase-2 via a β-catenin-Tcf/Lef–dependent Transcriptional Mechanism Reduced Prostaglandin E2 Production and Survivin Expression. Mol. Biol. Cell 2009, 20, 2297–2310. [Google Scholar] [CrossRef] [Green Version]
- Torres, V.A.; Tapia, J.C.; Rodriguez, D.A.; Lladser, A.; Arredondo, C.; Leyton, L.; Quest, A.F. E-Cadherin Is Required for Caveolin-1-Mediated Down-Regulation of the Inhibitor of Apoptosis Protein Survivin via Reduced β-Catenin-Tcf/Lef-Dependent Transcription. Mol. Cell. Biol. 2007, 27, 7703–7717. [Google Scholar] [CrossRef] [Green Version]
- Torres, V.A.; Tapia, J.C.; Rodriguez, D.A.; Parraga, M.; Lisboa, P.; Montoya, M.; Leyton, L.; Quest, A.F. Caveolin-1 controls cell proliferation and cell death by suppressing expression of the inhibitor of apoptosis protein survivin. J. Cell Sci. 2006, 119, 1812–1823. [Google Scholar] [CrossRef] [Green Version]
- Lobos-González, L.; Aguilar, L.; Díaz, J.; Díaz, N.; Urra, H.; Torres, V.A.; Silva, V.; Fitzpatrick, C.; Lladser, A.; Hoek, K.S.; et al. E-cadherin determines Caveolin-1 tumor suppression or metastasis enhancing function in melanoma cells. Pigment. Cell Melanoma Res. 2013, 26, 555–570. [Google Scholar] [CrossRef] [Green Version]
- Bertout, J.A.; Patel, S.A.; Simon, M.C. The impact of O2 availability on human cancer. Nat. Rev. Cancer 2008, 8, 967–975. [Google Scholar] [CrossRef] [Green Version]
- Vaupel, P. Hypoxia and Aggressive Tumor Phenotype: Implications for Therapy and Prognosis. Oncologist 2008, 13 (Suppl. 3), 21–26. [Google Scholar] [CrossRef] [Green Version]
- Keith, B.; Johnson, R.S.; Simon, M.C. HIF1alpha and HIF2alpha: Sibling rivalry in hypoxic tumour growth and progression. Nat. Rev. Cancer 2011, 12, 9–22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilson, W.R.; Hay, M.P. Targeting hypoxia in cancer therapy. Nat. Rev. Cancer 2011, 11, 393–410. [Google Scholar] [CrossRef]
- Nobre, A.R.; Entenberg, D.; Wang, Y.; Condeelis, J.S.; Aguirre-Ghiso, J. The Different Routes to Metastasis via Hypoxia-Regulated Programs. Trends Cell Biol. 2018, 28, 941–956. [Google Scholar] [CrossRef]
- Evans, A.J.; Russell, R.C.; Roche, O.; Burry, T.N.; Fish, J.E.; Chow, V.W.K.; Kim, W.Y.; Saravanan, A.; Maynard, M.A.; Gervais, M.L.; et al. VHL Promotes E2 Box-Dependent E-Cadherin Transcription by HIF-Mediated Regulation of SIP1 and Snail. Mol. Cell. Biol. 2006, 27, 157–169. [Google Scholar] [CrossRef] [Green Version]
- Domingos, P.L.B.; Souza, M.G.; Guimarães, T.A.; Santos, E.S.C.; Farias, L.; De Souza, C.D.F.; Jones, K.M.; Santos, S.H.S.; De Paula, A.M.B.; Guimarães, A.L.S. Hypoxia reduces the E-cadherin expression and increases OSCC cell migration regardless of the E-cadherin methylation profile. Pathol. Res. Pract. 2017, 213, 496–501. [Google Scholar] [CrossRef]
- Semenza, G.L. Oxygen Sensing, Homeostasis, and Disease. N. Engl. J. Med. 2011, 365, 537–547. [Google Scholar] [CrossRef] [Green Version]
- Choudhry, H.; Harris, A.L. Advances in Hypoxia-Inducible Factor Biology. Cell Metab. 2018, 27, 281–298. [Google Scholar] [CrossRef]
- Wiesener, M.; Jürgensen, J.S.; Rosenberger, C.; Scholze, C.; Hörstrup, J.H.; Warnecke, C.; Mandriota, S.; Bechmann, I.; Frei, U.A.; Pugh, C.W.; et al. Widespread, hypoxia-inducible expression of HIF-2alpha in distinct cell populations of different organs. FASEB J. 2002, 17, 271–273. [Google Scholar] [CrossRef] [Green Version]
- Rankin, E.B.; Giaccia, A.J. The role of hypoxia-inducible factors in tumorigenesis. Cell Death Differ. 2008, 15, 678–685. [Google Scholar] [CrossRef] [Green Version]
- Tanaka, T.; Wiesener, M.; Bernhardt, W.; Eckardt, K.; Warnecke, C. The human HIF (hypoxia-inducible factor)-3alpha gene is a HIF-1 target gene and may modulate hypoxic gene induction. Biochem. J. 2009, 424, 143–151. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sanhueza, C.; Araos, J.; Naranjo, L.; Villalobos, R.; Westermeier, F.; Salomon, C.; Beltrán, A.R.; Ramírez, M.; Gutiérrez, J.; Pardo, F.; et al. Modulation of intracellular pH in human ovarian cancer. Curr. Mol. Med. 2016, 16, 23–32. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.E.; Gu, J.; Schau, M.; Bunn, H.F. Regulation of hypoxia-inducible factor 1 is mediated by an O2-dependent degradation domain via the ubiquitin-proteasome pathway. Proc. Natl. Acad. Sci. USA 1998, 95, 7987–7992. [Google Scholar] [CrossRef] [Green Version]
- Sutter, C.H.; Laughner, E.; Semenza, G.L. Hypoxia-inducible factor 1alpha protein expression is controlled by oxygen-regulated ubiquitination that is disrupted by deletions and missense mutations. Proc. Natl. Acad. Sci. USA 2000, 97, 4748–4753. [Google Scholar] [CrossRef] [Green Version]
- Paul, S.A.; Simons, J.W.; Mabjeesh, N.J. HIF at the crossroads between ischemia and carcinogenesis. J. Cell. Physiol. 2004, 200, 20–30. [Google Scholar] [CrossRef]
- Klimova, T.; Chandel, N.S. Mitochondrial complex III regulates hypoxic activation of HIF. Cell Death Differ. 2008, 15, 660–666. [Google Scholar] [CrossRef] [Green Version]
- Fernández, J.G.; Rodriguez, D.A.; Valenzuela, M.; Calderón, C.; Urzúa, U.; Munroe, D.; Rosas, C.; Lemus, D.; Valdivia, N.D.; Wright, M.C.; et al. Survivin expression promotes VEGF-induced tumor angiogenesis via PI3K/Akt enhanced beta-catenin/Tcf-Lef dependent transcription. Mol. Cancer 2014, 13, 209. [Google Scholar] [CrossRef] [Green Version]
- Witkiewicz, A.K.; Kline, J.; Queenan, M.; Brody, J.R.; Tsirigos, A.; Bilal, E.; Pavlides, S.; Ertel, A.; Sotgia, F.; Lisanti, M.P. Molecular profiling of a lethal tumor microenvironment, as defined by stromal caveolin-1 status in breast cancers. Cell Cycle 2011, 10, 1794–1809. [Google Scholar] [CrossRef] [Green Version]
- Martinez-Outschoorn, U.; Sotgia, F.; Lisanti, M.P. Tumor Microenvironment and Metabolic Synergy in Breast Cancers: Critical Importance of Mitochondrial Fuels and Function. Semin. Oncol. 2014, 41, 195–216. [Google Scholar] [CrossRef]
- Pavlides, S.; Tsirigos, A.; Vera, I.; Frank, P.G.; Casimiro, M.C.; Addya, S.; Sotgia, F.; Flomenberg, N.; Wang, C.; Fortina, P.; et al. Loss of stromal caveolin-1 leads to oxidative stress, mimics hypoxia and drives inflammation in the tumor microenvironment, conferring the “reverse Warburg effect”: A transcriptional informatics analysis with validation. Cell Cycle 2010, 9, 2201–2219. [Google Scholar] [CrossRef] [Green Version]
- Felley-Bosco, E.; Bender, F.; Quest, A.F. Caveolin-1-mediated post-transcriptional regulation of inducible nitric oxide synthase in human colon carcinoma cells. Biol. Res. 2002, 35, 169–176. [Google Scholar] [CrossRef] [PubMed]
- Sato, Y.; Sagami, I.; Shimizu, T. Identification of Caveolin-1-interacting Sites in Neuronal Nitric-oxide Synthase. J. Biol. Chem. 2003, 279, 8827–8836. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bernatchez, P.N.; Bauer, P.M.; Yu, J.; Prendergast, J.S.; He, P.; Sessa, W.C. Dissecting the molecular control of endothelial NO synthase by caveolin-1 using cell-permeable peptides. Proc. Natl. Acad. Sci. USA 2005, 102, 761–766. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oliveira, S.D.S.; Minshall, R.D.; Belvitch, P.; Dudek, S. Chapter Seven - Caveolin and Endothelial NO Signaling. In Current Topics in Membranes; Academic Press: Cambridge, MA, USA, 2018; Volume 82, pp. 257–279. [Google Scholar]
- Felley-Bosco, E.; Bender, F.C.; Courjault-Gautier, F.; Bron, C.; Quest, A.F.G. Caveolin-1 down-regulates inducible nitric oxide synthase via the proteasome pathway in human colon carcinoma cells. Proc. Natl. Acad. Sci. USA 2000, 97, 14334–14339. [Google Scholar] [CrossRef] [Green Version]
- Wu, G.; Morris, S.M., Jr. Arginine metabolism: Nitric oxide and beyond. Biochem. J. 1998, 336, 1–17. [Google Scholar] [CrossRef]
- Yasuda, H. Solid tumor physiology and hypoxia-induced chemo/radio-resistance: Novel strategy for cancer therapy: Nitric oxide donor as a therapeutic enhancer. Nitric Oxide 2008, 19, 205–216. [Google Scholar] [CrossRef]
- Granados-Principal, S.; Liu, Y.; Guevara, M.L.; Blanco, E.; Choi, D.S.; Qian, W.; Patel, T.; Rodriguez, A.A.; Cusimano, J.; Weiss, H.L.; et al. Inhibition of iNOS as a novel effective targeted therapy against triple-negative breast cancer. Breast Cancer Res. 2015, 17, 25. [Google Scholar] [CrossRef]
- Loibl, S.; Buck, A.; Strank, C.; Von Minckwitz, G.; Roller, M.; Sinn, H.-P.; Schini-Kerth, V.; Solbach, C.; Strebhardt, K.; Kaufmann, M. The role of early expression of inducible nitric oxide synthase in human breast cancer. Eur. J. Cancer 2005, 41, 265–271. [Google Scholar] [CrossRef]
- Fahey, J.M.; Girotti, A.W. Accelerated migration and invasion of prostate cancer cells after a photodynamic therapy-like challenge: Role of nitric oxide. Nitric Oxide 2015, 49, 47–55. [Google Scholar] [CrossRef] [Green Version]
- Liao, W.; Ye, T.; Liu, H. Prognostic Value of Inducible Nitric Oxide Synthase (iNOS) in Human Cancer: A Systematic Review and Meta-Analysis. BioMed. Res. Int. 2019, 2019, 6304851–6304859. [Google Scholar] [CrossRef] [Green Version]
- Mateo, J.; Garcia-Lecea, M.; Cadenas, S.; Hernandez, C.; Moncada, S. Regulation of hypoxia-inducible factor-1alpha by nitric oxide through mitochondria-dependent and -independent pathways. Biochem. J. 2003, 376, 537–544. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moncada, P.S.S. Nitric Oxide And Oxygen: Actions And Interactions In Health And Disease. Redox Biol. 2015, 5, 421. [Google Scholar] [CrossRef] [Green Version]
- Li, F.; Sonveaux, P.; Rabbani, Z.N.; Liu, S.; Yan, B.; Huang, Q.; Vujaskovic, Z.; Dewhirst, M.W.; Li, C.-Y. Regulation of HIF-1alpha Stability through S-Nitrosylation. Mol. Cell 2007, 26, 63–74. [Google Scholar] [CrossRef] [Green Version]
- Yasinska, I.M.; Sumbayev, V.V. S-nitrosation of Cys-800 of HIF-1alpha protein activates its interaction with p300 and stimulates its transcriptional activity. FEBS Lett. 2003, 549, 105–109. [Google Scholar] [CrossRef] [Green Version]
- Cho, H.; Ahn, D.-R.; Park, H.; Yang, E.G. Modulation of p300 binding by posttranslational modifications of the C-terminal activation domain of hypoxia-inducible factor-1alpha. FEBS Lett. 2007, 581, 1542–1548. [Google Scholar] [CrossRef] [Green Version]
- Sha, Y.; Marshall, H.E. S-nitrosylation in the regulation of gene transcription. Biochim. Biophys. Acta (BBA) Bioenerg. 2011, 1820, 701–711. [Google Scholar] [CrossRef] [Green Version]
- Khan, M.; Khan, H.; Singh, I.; Singh, A.K. Hypoxia inducible factor-1 alpha stabilization for regenerative therapy in traumatic brain injury. Neural Regen. Res. 2017, 12, 696–701. [Google Scholar] [CrossRef]
- Lobos-Gonzalez, L.; Aguilar-Guzmán, L.; Fernandez, J.G.; Muñoz, N.; Hossain, M.; Bieneck, S.; Silva, V.; Burzio, V.; Sviderskaya, E.V.; Bennett, D.C.; et al. Caveolin-1 is a risk factor for postsurgery metastasis in preclinical melanoma models. Melanoma Res. 2014, 24, 108–119. [Google Scholar] [CrossRef] [Green Version]
- Urra, H.; Torres, V.A.; Ortíz, R.J.; Lobos, L.; Díaz, M.I.; Díaz, N.; Härtel, S.; Leyton, L.; Quest, A.F. Caveolin-1-Enhanced Motility and Focal Adhesion Turnover Require Tyrosine-14 but Not Accumulation to the Rear in Metastatic Cancer Cells. PLoS ONE 2012, 7, e33085. [Google Scholar] [CrossRef] [Green Version]
- Brown, L.M.; Cowen, R.L.; Debray, C.; Eustace, A.; Erler, J.T.; Sheppard, F.C.D.; Parker, C.A.; Stratford, I.; Williams, K.J. Reversing Hypoxic Cell Chemoresistance in Vitro Using Genetic and Small Molecule Approaches Targeting Hypoxia Inducible Factor-1. Mol. Pharmacol. 2005, 69, 411–418. [Google Scholar] [CrossRef] [Green Version]
- Bender, F.C.; Reymond, M.A.; Bron, C.; Quest, A.F. Caveolin-1 levels are down-regulated in human colon tumors, and ectopic expression of caveolin-1 in colon carcinoma cell lines reduces cell tumorigenicity. Cancer Res. 2000, 60, 5870–5878. [Google Scholar]
- Wang, G.L.; Semenza, G.L. Desferrioxamine induces erythropoietin gene expression and hypoxia-inducible factor 1 DNA-binding activity: Implications for models of hypoxia signal transduction. Blood 1993, 82, 3610–3615. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Durante, W.; Johnson, F.K.; Johnson, R.A. Arginase: A Critical Regulator of Nitric Oxide Synthesis and Vascular Function. Clin. Exp. Pharmacol. Physiol. 2007, 34, 906–911. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Krotova, K.; Patel, J.M.; Block, E.R.; Zharikov, S. Hypoxic upregulation of arginase II in human lung endothelial cells. Am. J. Physiol. Physiol. 2010, 299, C1541–C1548. [Google Scholar] [CrossRef]
- Kim, N.; Cox, J.D.; Baggio, R.F.; Emig, F.A.; Mistry, S.K.; Harper, S.L.; Speicher, D.W.; Morris, S.M., Jr.; Ash, D.E.; Traish, A.M.; et al. Probing erectile function: S-(2-boronoethyl)-L-cysteine binds to arginase as a transition state analogue and enhances smooth muscle relaxation in human penile corpus cavernosum. Biochemistry 2001, 40, 2678–2688. [Google Scholar] [CrossRef]
- Poste, G.; Doll, J.; Hart, I.R.; Fidler, I.J. In vitro selection of murine B16 melanoma variants with enhanced tissue-invasive properties. Cancer Res. 1980, 40, 1636–1644. [Google Scholar]
- Lee, S.W.; Reimer, C.L.; Oh, P.; Campbell, D.B.; Schnitzer, J.E. Tumor cell growth inhibition by caveolin re-expression in human breast cancer cells. Oncogene 1998, 16, 1391–1397. [Google Scholar] [CrossRef] [Green Version]
- Volonte, D.; Vyas, A.R.; Chen, C.; Dacic, S.; Stabile, L.P.; Kurland, B.; Abberbock, S.R.; Burns, T.F.; Herman, J.G.; Di, Y.P.; et al. Caveolin-1 promotes the tumor suppressor properties of oncogene-induced cellular senescence. J. Biol. Chem. 2017, 293, 1794–1809. [Google Scholar] [CrossRef] [Green Version]
- Dings, R.; Loren, M.; Heun-Johnson, H.; McNiel, E.; Griffioen, A.W.; Mayo, K.H.; Griffin, R.J. Scheduling of radiation with angiogenesis inhibitors anginex and Avastin improves therapeutic outcome via vessel normalization. Clin. Cancer Res. 2007, 13, 3395–3402. [Google Scholar] [CrossRef] [Green Version]
- Li, X.-F.; Carlin, S.; Urano, M.; Russell, J.; Ling, C.C.; O’Donoghue, J.A. Visualization of Hypoxia in Microscopic Tumors by Immunofluorescent Microscopy. Cancer Res. 2007, 67, 7646–7653. [Google Scholar] [CrossRef] [Green Version]
- Semenza, G.L. Hypoxia-inducible factors: Mediators of cancer progression and targets for cancer therapy. Trends Pharmacol. Sci. 2012, 33, 207–214. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martinez-Outschoorn, U.; Trimmer, C.; Lin, Z.; Whitaker-Menezes, D.; Chiavarina, B.; Zhou, J.; Wang, C.; Pavlides, S.; Martinez-Cantarin, M.P.; Capozza, F.; et al. Autophagy in cancer associated fibroblasts promotes tumor cell survival: Role of hypoxia, HIF1 induction and NFκB activation in the tumor stromal microenvironment. Cell Cycle 2010, 9, 3515–3533. [Google Scholar] [CrossRef] [PubMed]
- Kannan, A.; Krishnan, A.; Ali, M.; Subramaniam, S.; Halagowder, D.; Devaraj, S.N. Caveolin-1 promotes gastric cancer progression by up-regulating epithelial to mesenchymal transition by crosstalk of signalling mechanisms under hypoxic condition. Eur. J. Cancer 2014, 50, 204–215. [Google Scholar] [CrossRef] [PubMed]
- Li, W.P.; Liu, P.; Pilcher, B.K.; Anderson, R.G. Cell-specific targeting of caveolin-1 to caveolae, secretory vesicles, cytoplasm or mitochondria. J. Cell Sci. 2001, 114, 1397–1408. [Google Scholar]
- Sanna, E.; Miotti, S.; Mazzi, M.; De Santis, G.; Canevari, S.; Tomassetti, A. Binding of nuclear caveolin-1 to promoter elements of growth-associated genes in ovarian carcinoma cells. Exp. Cell Res. 2007, 313, 1307–1317. [Google Scholar] [CrossRef]
- Masoud, G.N.; Li, W. HIF-1alpha pathway: Role, regulation and intervention for cancer therapy. Acta Pharm. Sin. B 2015, 5, 378–389. [Google Scholar] [CrossRef] [Green Version]
- Chowdhury, R.; Godoy, L.C.; Thiantanawat, A.; Trudel, L.J.; Deen, W.M.; Wogan, G.N. Nitric Oxide Produced Endogenously Is Responsible for Hypoxia-Induced HIF-1alpha Stabilization in Colon Carcinoma Cells. Chem. Res. Toxicol. 2012, 25, 2194–2202. [Google Scholar] [CrossRef] [Green Version]
- Park, Y.-K.; Ahn, D.-R.; Oh, M.; Lee, T.; Yang, E.G.; Son, M.; Park, H. Nitric Oxide Donor, (±)-S-Nitroso-N-acetylpenicillamine, Stabilizes Transactive Hypoxia-Inducible Factor-1alpha by Inhibiting von Hippel-Lindau Recruitment and Asparagine Hydroxylation. Mol. Pharmacol. 2008, 74, 236–245. [Google Scholar] [CrossRef] [Green Version]
- Quintero, M.; Brennan, P.A.; Thomas, G.J.; Moncada, S. Nitric Oxide Is a Factor in the Stabilization of Hypoxia-Inducible Factor-1alpha in Cancer: Role of Free Radical Formation. Cancer Res. 2006, 66, 770–774. [Google Scholar] [CrossRef] [Green Version]
- Ju, H.; Zou, R.; Venema, V.J.; Venema, R.C. Direct Interaction of Endothelial Nitric-oxide Synthase and Caveolin-1 Inhibits Synthase Activity. J. Biol. Chem. 1997, 272, 18522–18525. [Google Scholar] [CrossRef] [Green Version]
- Shen, J.; Lee, W.; Li, Y.; Lau, C.F.; Ng, K.M.; Fung, M.L.; Liu, K.J. Interaction of caveolin-1, nitric oxide, and nitric oxide synthases in hypoxic human SK-N-MC neuroblastoma cells. J. Neurochem. 2008, 107, 478–487. [Google Scholar] [CrossRef] [PubMed]
- Khong, S.; Andrews, K.L.; Huynh, N.; Venardos, K.; Aprico, A.; Michell, D.; Zarei, M.; Moe, K.; Dusting, G.; Kaye, D.; et al. Arginase II inhibition prevents nitrate tolerance. Br. J. Pharmacol. 2012, 166, 2015–2023. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koriyama, Y.; Furukawa, A. S-Nitrosylation Regulates Cell Survival and Death in the Central Nervous System. Neurochem. Res. 2018, 43, 50–58. [Google Scholar] [CrossRef] [PubMed]
- Chee, N.T.; Lohse, I.; Brothers, S.P. mRNA-to-protein translation in hypoxia. Mol. Cancer 2019, 18, 49. [Google Scholar] [CrossRef]
- Cherrington, J.M.; Mocarski, E.S. Human cytomegalovirus ie1 transactivates the alpha promoter-enhancer via an 18-base-pair repeat element. J. Virol. 1989, 63, 1435–1440. [Google Scholar] [CrossRef] [Green Version]
- Allen, C.B.; Schneider, B.K.; White, C.W. Limitations to oxygen diffusion and equilibration in in vitro cell exposure systems in hyperoxia and hypoxia. Am. J. Physiol. Cell. Mol. Physiol. 2001, 281, L1021–L1027. [Google Scholar] [CrossRef]
- Bennett, J.C.; Silva, P.; Martinez, S.; Torres, V.A.; Quest, A.F. Hypoxia-Induced Caveolin-1 Expression Promotes Migration and Invasion of Tumor Cells. Curr. Mol. Med. 2018, 18, 1. [Google Scholar] [CrossRef]
- Valenzuela, M.; Bravo, D.; Canales, J.; Sanhueza, C.; Díaz, N.; Almarza, O.; Toledo, H.; Quest, A.F. Helicobacter pylori–Induced Loss of Survivin and Gastric Cell Viability Is Attributable to Secreted Bacterial Gamma-Glutamyl Transpeptidase Activity. J. Infect. Dis. 2013, 208, 1131–1141. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)). Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Gene | Primer | Sequence 5′ → 3′ |
---|---|---|
VEGF-A | SN | ATCCGGGTTTTATCCCTCTTC |
AS | TCTCTCTGGAGCTCTTGCTA | |
LDH-1 | SN | ACGTCAGCAAGAGGGAGAA |
AS | TCTTCCAAGCCACGTAGGT | |
GLUT-1 | SN | AAGGAAGAGAGTCGGCAGAT |
AS | TCGAAGATGCTCGTGGAGTA | |
β Actin | SN | AAATCGTGCGTGACATTAAGC |
AS | CCGATCCACACGGAGTACTT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sanhueza, C.; Bennett, J.C.; Valenzuela-Valderrama, M.; Contreras, P.; Lobos-González, L.; Campos, A.; Wehinger, S.; Lladser, Á.; Kiessling, R.; Leyton, L.; et al. Caveolin-1-Mediated Tumor Suppression Is Linked to Reduced HIF1α S-Nitrosylation and Transcriptional Activity in Hypoxia. Cancers 2020, 12, 2349. https://doi.org/10.3390/cancers12092349
Sanhueza C, Bennett JC, Valenzuela-Valderrama M, Contreras P, Lobos-González L, Campos A, Wehinger S, Lladser Á, Kiessling R, Leyton L, et al. Caveolin-1-Mediated Tumor Suppression Is Linked to Reduced HIF1α S-Nitrosylation and Transcriptional Activity in Hypoxia. Cancers. 2020; 12(9):2349. https://doi.org/10.3390/cancers12092349
Chicago/Turabian StyleSanhueza, Carlos, Jimena Castillo Bennett, Manuel Valenzuela-Valderrama, Pamela Contreras, Lorena Lobos-González, América Campos, Sergio Wehinger, Álvaro Lladser, Rolf Kiessling, Lisette Leyton, and et al. 2020. "Caveolin-1-Mediated Tumor Suppression Is Linked to Reduced HIF1α S-Nitrosylation and Transcriptional Activity in Hypoxia" Cancers 12, no. 9: 2349. https://doi.org/10.3390/cancers12092349