Differential and Common Signatures of miRNA Expression and Methylation in Childhood Central Nervous System Malignancies: An Experimental and Computational Approach
Abstract
:Simple Summary
Abstract
1. Introduction
1.1. CNS Tumor Biomarkers
1.2. Gene Expression in CNS Tumors
1.3. Epigenetic Mechanisms in CNS Tumors
1.3.1. DNA Methylation and Cancer
1.3.2. DNA Methylation and CNS Tumors
1.4. Patient Administration and Stratification Based on New Biomarkers
1.5. Design and Aim of the Present Study
2. Materials and Methods
2.1. Patients and Tumor Samples
2.2. Diagnosis and Immunohistochemistry
2.2.1. Diagnosis and Clinical Evaluation
2.2.2. Immunohistochemistry
2.3. RNA Extraction
2.4. Microarray Profiling
2.4.1. miRNA Profiling
2.4.2. cRNA Profiling
2.5. DNA Extraction
2.6. Methylation
2.6.1. Methylation-Specific MLPA (MS-MLPA)
2.6.2. Methylation-Specific PCR
2.7. Data Analysis
2.7.1. Statistical Analysis
2.7.2. Microarray Data Analysis
Microarray Data Pre-Processing
Microarray Data Post-Processing
Microarray Data Normalization
Elimination of Duplicate Transcripts
Detection of Differentially Expressed Genes (DEGs)
Unsupervised Classification Methods
Unsupervised Classification Methods: Descriptive K-Means
Common Expression Patterns in DE miRNAs/mRNAs
Gene Ontology (GO) Enrichment Analysis
Pathway Analysis
miRNA Enrichment Analysis
2.7.3. Receiver Operating Characteristic (ROC) Analysis
2.8. Ethics Statements
3. Results
3.1. Patients and Tumor Samples
3.2. miRNA and mRNA Expression
3.3. miRNA Differential Expression with Respect to Clinical Parameters
3.3.1. miRNA Expression Profiling with Respect to Gender
3.3.2. miRNA Expression Profiling with Respect to Gender
3.3.3. miRNA Expression Profiling with Respect to Tumor Grade
3.3.4. miRNA Expression Profiling with Respect to Protein Markers
3.4. Methylation
3.4.1. Descriptive and Association Statistics of Tumors
Relations to Methylation
Relations to Methylation
3.4.2. Statistics of Total Number of Methylated Genes
3.4.3. Methylation-Specific PCR
3.4.4. miRNA Differential Expression with Respect to Methylated Genes
3.5. Hierarchical Clustering (HCL)
3.6. Chromosomal Distribution of DE miRNAs
3.7. K-Means Clustering
3.8. Functional Annotations of DE miRNAs
Gene Ontology of DE miRNAs
3.9. Descriptive K-Means
3.10. ROC Analysis
3.11. Naïve-Bayes Analysis
3.12. Common miRNA Signatures
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Louis, D.N.; Ohgaki, H.; Wiestler, O.D.; Cavenee, W.K.; Burger, P.C.; Jouvet, A.; Scheithauer, B.W.; Kleihues, P. The 2007 WHO classification of tumours of the central nervous system. Acta Neuropathol. 2007, 114, 97–109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Louis, D.N.; Perry, A.; Reifenberger, G.; Von Deimling, A.; Figarella-Branger, D.; Cavenee, W.K.; Ohgaki, H.; Wiestler, O.D.; Kleihues, P.; Ellison, D.W. The 2016 World Health Organization classification of tumors of the central nervous system: A summary. Acta Neuropathol. 2016, 131, 803–820. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Braoudaki, M.; Lambrou, G.I.; Giannikou, K.; Milionis, V.; Stefanaki, K.; Birks, D.K.; Prodromou, N.; Kolialexi, A.; Kattamis, A.; Spiliopoulou, C.A.; et al. Microrna expression signatures predict patient progression and disease outcome in pediatric embryonal central nervous system neoplasms. J. Hematol. Oncol. 2014, 7, 96. [Google Scholar] [CrossRef] [Green Version]
- Braoudaki, M.; Lambrou, G.I.; Giannikou, K.; Papadodima, S.A.; Lykoudi, A.; Stefanaki, K.; Sfakianos, G.; Kolialexi, A.; Tzortzatou-Stathopoulou, F.; Tzetis, M.; et al. Mir-15a and mir-24-1 as putative prognostic microrna signatures for pediatric pilocytic astrocytomas and ependymomas. Tumour Biol. J. Int. Soc. Oncodev. Biol. Med. 2016, 37, 9887–9897. [Google Scholar] [CrossRef] [PubMed]
- Braoudaki, M.; Lambrou, G.I.; Papadodima, S.A.; Stefanaki, K.; Prodromou, N.; Kanavakis, E. Microrna expression profiles in pediatric dysembryoplastic neuroepithelial tumors. Med. Oncol. 2016, 33, 5. [Google Scholar] [CrossRef] [PubMed]
- Takei, H.; Bhattacharjee, M.B.; Rivera, A.; Dancer, Y.; Powell, S.Z. New immunohistochemical markers in the evaluation of central nervous system tumors: A review of 7 selected adult and pediatric brain tumors. Arch. Pathol. Lab. Med. 2007, 131, 234–241. [Google Scholar] [CrossRef] [PubMed]
- Suri, V.S.; Tatke, M.; Singh, D.; Sharma, A. Histological spectrum of ependymomas and correlation of p53 and ki-67 expression with ependymoma grade and subtype. Indian J. Cancer 2004, 41, 66–71. [Google Scholar]
- Scholzen, T.; Gerdes, J. The ki-67 protein: From the known and the unknown. J. Cell. Physiol. 2000, 182, 311–322. [Google Scholar] [CrossRef]
- McDonald, M.W.; Wolanski, M.R.; Simmons, J.W.; Buchsbaum, J.C. Technique for sparing previously irradiated critical normal structures in salvage proton craniospinal irradiation. Radiat. Oncol. 2013, 8, 14. [Google Scholar] [CrossRef] [Green Version]
- Cohen, A.L.; Piccolo, S.R.; Cheng, L.; Soldi, R.; Han, B.; Johnson, W.E.; Bild, A.H. Genomic pathway analysis reveals that ezh2 and hdac4 represent mutually exclusive epigenetic pathways across human cancers. BMC Med. Genom. 2013, 6, 35. [Google Scholar] [CrossRef] [Green Version]
- Glass, C.; Wilson, M.; Gonzalez, R.; Zhang, Y.; Perkins, A.S. The role of evi1 in myeloid malignancies. Blood Cells Mol. Dis. 2014, 53, 67–76. [Google Scholar] [CrossRef]
- Larmonie, N.S.D.; Arentsen-Peters, T.; Obulkasim, A.; Valerio, D.; Sonneveld, E.; Danen-van Oorschot, A.A.; De Haas, V.; Reinhardt, D.; Zimmermann, M.; Trka, J.; et al. Mn1 overexpression is driven by loss of dnmt3b methylation activity in inv(16) pediatric aml. Oncogene 2018, 37, 107–115. [Google Scholar] [CrossRef] [PubMed]
- Mehdipour, P.; Murphy, T.; De Carvalho, D.D. The role of DNA-demethylating agents in cancer therapy. Pharmacol. Ther. 2020, 205, 107416. [Google Scholar] [CrossRef] [PubMed]
- Borchiellini, M.; Ummarino, S.; Di Ruscio, A. The bright and dark side of DNA methylation: A matter of balance. Cells 2019, 8, 1243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mishra, R.; Haldar, S.; Suchanti, S.; Bhowmick, N.A. Epigenetic changes in fibroblasts drive cancer metabolism and differentiation. Endocr. Relat. Cancer 2019, 26, R673–R688. [Google Scholar] [CrossRef] [Green Version]
- Baylin, S.B. Mechanisms underlying epigenetically mediated gene silencing in cancer. Semin. Cancer Biol. 2002, 12, 331–337. [Google Scholar] [CrossRef]
- Ianniello, Z.; Fatica, A. N6-methyladenosine role in acute myeloid leukaemia. Int. J. Mol. Sci. 2018, 19, 2345. [Google Scholar] [CrossRef] [Green Version]
- Rongrui, L.; Na, H.; Zongfang, L.; Fanpu, J.; Shiwen, J. Epigenetic mechanism involved in the hbv/hcv-related hepatocellular carcinoma tumorigenesis. Curr. Pharm. Des. 2014, 20, 1715–1725. [Google Scholar] [CrossRef]
- Tur, M.K.; Daramola, A.K.; Gattenlohner, S.; Herling, M.; Chetty, S.; Barth, S. Restoration of dap kinase tumor suppressor function: A therapeutic strategy to selectively induce apoptosis in cancer cells using immunokinase fusion proteins. Biomedicines 2017, 5, 59. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, S.Y.; Zhang, S.W.; Fan, X.N.; Zhang, T.; Meng, J.; Huang, Y. Fundmdeep-m6a: Identification and prioritization of functional differential m6a methylation genes. Bioinformatics 2019, 35, i90–i98. [Google Scholar] [CrossRef]
- Singh, N.; Rashid, S.; Rashid, S.; Dash, N.R.; Gupta, S.; Saraya, A. Clinical significance of promoter methylation status of tumor suppressor genes in circulating DNA of pancreatic cancer patients. J. Cancer Res. Clin. Oncol. 2020, 146, 897–907. [Google Scholar] [CrossRef]
- Liu, B.; Song, J.; Luan, J.; Sun, X.; Bai, J.; Wang, H.; Li, A.; Zhang, L.; Feng, X.; Du, Z. Promoter methylation status of tumor suppressor genes and inhibition of expression of DNA methyltransferase 1 in non-small cell lung cancer. Exp. Biol. Med. 2016, 241, 1531–1539. [Google Scholar] [CrossRef]
- Guzmán, L.; Depix, M.S.; Salinas, A.M.; Roldán, R.; Aguayo, F.; Silva, A.; Vinet, R. Analysis of aberrant methylation on promoter sequences of tumor suppressor genes and total DNA in sputum samples: A promising tool for early detection of copd and lung cancer in smokers. Diagn. Pathol. 2012, 7, 87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ooki, A.; Yamashita, K.; Yamaguchi, K.; Mondal, A.; Nishimiya, H.; Watanabe, M. DNA damage-inducible gene, reprimo functions as a tumor suppressor and is suppressed by promoter methylation in gastric cancer. Mol. Cancer Res. 2013, 11, 1362–1374. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sturgeon, S.R.; Balasubramanian, R.; Schairer, C.; Muss, H.B.; Ziegler, R.G.; Arcaro, K.F. Detection of promoter methylation of tumor suppressor genes in serum DNA of breast cancer cases and benign breast disease controls. Epigenetics 2012, 7, 1258–1267. [Google Scholar] [CrossRef] [Green Version]
- Aoki, K.; Natsume, A. Overview of DNA methylation in adult diffuse gliomas. Brain Tumor Pathol. 2019, 36, 84–91. [Google Scholar] [CrossRef] [PubMed]
- Teuber-Hanselmann, S.; Worm, K.; Macha, N.; Junker, A. Mgmt-methylation in non-neoplastic diseases of the central nervous system. Int. J. Mol. Sci. 2021, 22, 3845. [Google Scholar] [CrossRef] [PubMed]
- Kessler, T.; Sahm, F.; Sadik, A.; Stichel, D.; Hertenstein, A.; Reifenberger, G.; Zacher, A.; Sabel, M.; Tabatabai, G.; Steinbach, J.; et al. Molecular differences in idh wildtype glioblastoma according to mgmt promoter methylation. Neuro-Oncology 2018, 20, 367–379. [Google Scholar] [CrossRef]
- Michalowski, M.B.; De Fraipont, F.; Michelland, S.; Entz-Werle, N.; Grill, J.; Pasquier, B.; Favrot, M.C.; Plantaz, D. Methylation of rassf1a and trail pathway-related genes is frequent in childhood intracranial ependymomas and benign choroid plexus papilloma. Cancer Genet. Cytogenet. 2006, 166, 74–81. [Google Scholar] [CrossRef] [PubMed]
- Sromek, M.; Rymkiewicz, G.; Paziewska, A.; Szafron, L.M.; Kulecka, M.; Zajdel, M.; Kulinczak, M.; Dabrowska, M.; Balabas, A.; Bystydzienski, Z.; et al. A set of 17 micrornas common for brain and cerebrospinal fluid differentiates primary central nervous system lymphoma from non-malignant brain tumors. Biomolecules 2021, 11, 1395. [Google Scholar] [CrossRef] [PubMed]
- Jelski, W.; Mroczko, B. Molecular and circulating biomarkers of brain tumors. Int. J. Mol. Sci. 2021, 22, 7039. [Google Scholar] [CrossRef] [PubMed]
- Nadaradjane, A.; Briand, J.; Bougras-Cartron, G.; Disdero, V.; Vallette, F.M.; Frenel, J.S.; Cartron, P.F. Mir-370-3p is a therapeutic tool in anti-glioblastoma therapy but is not an intratumoral or cell-free circulating biomarker. Mol. Ther. Nucleic Acids 2018, 13, 642–650. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, S.; Wei, J.; Wang, F.; Kong, L.Y.; Ling, X.Y.; Nduom, E.; Gabrusiewicz, K.; Doucette, T.; Yang, Y.; Yaghi, N.K.; et al. Effect of mir-142-3p on the m2 macrophage and therapeutic efficacy against murine glioblastoma. J. Natl. Cancer Inst. 2014, 106, dju162. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Li, R.; Pan, M.; Shi, Z.; Yan, W.; Liu, N.; You, Y.; Zhang, J.; Wang, X. Mir-181b modulates chemosensitivity of glioblastoma multiforme cells to temozolomide by targeting the epidermal growth factor receptor. J. Neuro-Oncol. 2017, 133, 477–485. [Google Scholar] [CrossRef] [PubMed]
- Bhaskaran, V.; Nowicki, M.O.; Idriss, M.; Jimenez, M.A.; Lugli, G.; Hayes, J.L.; Mahmoud, A.B.; Zane, R.E.; Passaro, C.; Ligon, K.L.; et al. The functional synergism of microrna clustering provides therapeutically relevant epigenetic interference in glioblastoma. Nat. Commun. 2019, 10, 442. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brat, D.J.; Scheithauer, B.W.; Fuller, G.N.; Tihan, T. Newly codified glial neoplasms of the 2007 who classification of tumours of the central nervous system: Angiocentric glioma, pilomyxoid astrocytoma and pituicytoma. Brain Pathol. 2007, 17, 319–324. [Google Scholar] [CrossRef] [PubMed]
- Fuller, G.N.; Scheithauer, B.W. The 2007 revised world health organization (WHO) classification of tumours of the central nervous system: Newly codified entities. Brain Pathol. 2007, 17, 304–307. [Google Scholar] [CrossRef] [PubMed]
- Wu, W.; Dave, N.; Tseng, G.C.; Richards, T.; Xing, E.P.; Kaminski, N. Comparison of normalization methods for codelink bioarray data. BMC Bioinform. 2005, 6, 309. [Google Scholar] [CrossRef] [Green Version]
- Shi, L.; Reid, L.H.; Jones, W.D.; Shippy, R.; Warrington, J.A.; Baker, S.C.; Collins, P.J.; De Longueville, F.; Kawasaki, E.S.; Lee, K.Y.; et al. The microarray quality control (maqc) project shows inter- and intraplatform reproducibility of gene expression measurements. Nat. Biotechnol. 2006, 24, 1151–1161. [Google Scholar] [PubMed] [Green Version]
- Diez, D.; Alvarez, R.; Dopazo, A. Codelink: An r package for analysis of ge healthcare gene expression bioarrays. Bioinformatics 2007, 23, 1168–1169. [Google Scholar] [CrossRef] [Green Version]
- Altman, N.S.; Hua, J. Extending the loop design for two-channel microarray experiments. Genet. Res. 2006, 88, 153–163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Churchill, G.A. Fundamentals of experimental design for cdna microarrays. Nat. Genet. 2002, 32, 490–495. [Google Scholar] [CrossRef] [PubMed]
- Townsend, J.P. Multifactorial experimental design and the transitivity of ratios with spotted DNA microarrays. BMC Genom. 2003, 4, 41. [Google Scholar] [CrossRef] [Green Version]
- Furlan, D.; Sahnane, N.; Mazzoni, M.; Pastorino, R.; Carnevali, I.; Stefanoli, M.; Ferretti, A.; Chiaravalli, A.M.; La Rosa, S.; Capella, C. Diagnostic utility of ms-mlpa in DNA methylation profiling of adenocarcinomas and neuroendocrine carcinomas of the colon-rectum. Virchows Arch. Int. J. Pathol. 2013, 462, 47–56. [Google Scholar] [CrossRef]
- Herman, J.G.; Graff, J.R.; Myohanen, S.; Nelkin, B.D.; Baylin, S.B. Methylation-specific pcr: A novel pcr assay for methylation status of cpg islands. Proc. Natl. Acad. Sci. USA 1996, 93, 9821–9826. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, L.C.; Dahiya, R. Methprimer: Designing primers for methylation pcrs. Bioinformatics 2002, 18, 1427–1431. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, D.; Zhang, M.; Wells, M.T. Multiplicative background correction for spotted microarrays to improve reproducibility. Genet. Res. 2006, 87, 195–206. [Google Scholar] [CrossRef] [Green Version]
- Cleveland, W.S. Robust locally weighted regression and smoothing scatterplots. J. Am. Stat. Assoc. 1979, 74, 829–836. [Google Scholar] [CrossRef]
- Uzman, B.G.; Foley, G.E.; Farber, S.; Lazarus, H. Morphologic variations in human leukemic lymphoblasts (ccrf-cem cells) after long-term culture and exposure to chemotherapeutic agents. A study with the electron microscope. Cancer 1966, 19, 1725–1742. [Google Scholar] [CrossRef]
- Yang, I.V.; Chen, E.; Hasseman, J.P.; Liang, W.; Frank, B.C.; Wang, S.; Sharov, V.; Saeed, A.I.; White, J.; Li, J.; et al. Within the fold: Assessing differential expression measures and reproducibility in microarray assays. Genome Biol. 2002, 3, research0062. [Google Scholar]
- Klipper-Aurbach, Y.; Wasserman, M.; Braunspiegel-Weintrob, N.; Borstein, D.; Peleg, S.; Assa, S.; Karp, M.; Benjamini, Y.; Hochberg, Y.; Laron, Z. Mathematical formulae for the prediction of the residual beta cell function during the first two years of disease in children and adolescents with insulin-dependent diabetes mellitus. Med. Hypotheses 1995, 45, 486–490. [Google Scholar] [CrossRef]
- Storey, J.D.; Tibshirani, R. Statistical significance for genomewide studies. Proc. Natl. Acad. Sci. USA 2003, 100, 9440–9445. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Storey, J.D.; Tibshirani, R. Statistical methods for identifying differentially expressed genes in DNA microarrays. Methods Mol. Biol. 2003, 224, 149–157. [Google Scholar]
- Forgy, E.W. Cluster analysis of multivariate data: Efficiency vs. interpretability of classifications, 1965. Biometrics 1965, 21, 768769. [Google Scholar]
- Lloyd, S. Least squares quantization in pcm. IEEE Trans. Inf. Theory 1982, 28, 129–137. [Google Scholar] [CrossRef]
- Freyhult, E.; Landfors, M.; Onskog, J.; Hvidsten, T.R.; Ryden, P. Challenges in microarray class discovery: A comprehensive examination of normalization, gene selection and clustering. BMC Bioinform. 2010, 11, 503. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gibbons, F.D.; Roth, F.P. Judging the quality of gene expression-based clustering methods using gene annotation. Genome Res. 2002, 12, 1574–1581. [Google Scholar] [CrossRef] [Green Version]
- Lambrou, G.; Braoudaki, M. A novel method for the analysis of gene expression microarray data with k-means clustering: Sorted k-means. Int. J. Eng. Res. Sci. 2016, 2, 99–105. [Google Scholar]
- Raudvere, U.; Kolberg, L.; Kuzmin, I.; Arak, T.; Adler, P.; Peterson, H.; Vilo, J. G:Profiler: A web server for functional enrichment analysis and conversions of gene lists (2019 update). Nucleic Acids Res. 2019, 47, W191–W198. [Google Scholar] [CrossRef] [Green Version]
- Zhang, B.; Schmoyer, D.; Kirov, S.; Snoddy, J. Gotree machine (gotm): A web-based platform for interpreting sets of interesting genes using gene ontology hierarchies. BMC Bioinform. 2004, 5, 16. [Google Scholar]
- Steinfeld, I.; Navon, R.; Ach, R.; Yakhini, Z. Mirna target enrichment analysis reveals directly active mirnas in health and disease. Nucleic Acids Res. 2012, 41, e45. [Google Scholar] [CrossRef] [Green Version]
- Eden, E.; Navon, R.; Steinfeld, I.; Lipson, D.; Yakhini, Z. Gorilla: A tool for discovery and visualization of enriched go terms in ranked gene lists. BMC Bioinform. 2009, 10, 48. [Google Scholar] [CrossRef] [Green Version]
- Kern, F.; Fehlmann, T.; Solomon, J.; Schwed, L.; Grammes, N.; Backes, C.; Van Keuren-Jensen, K.; Craig, D.W.; Meese, E.; Keller, A. Mieaa 2.0: Integrating multi-species microrna enrichment analysis and workflow management systems. Nucleic Acids Res. 2020, 48, W521–W528. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Han, X.; Wan, Y.; Zhang, S.; Zhao, Y.; Fan, R.; Cui, Q.; Zhou, Y. Tam 2.0: Tool for microrna set analysis. Nucleic Acids Res. 2018, 46, W180–W185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, M.; Shi, B.; Wang, J.; Cao, Q.; Cui, Q. Tam: A method for enrichment and depletion analysis of a microrna category in a list of micrornas. BMC Bioinform. 2010, 11, 419. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Knight, J.R.; Allison, S.J.; Milner, J. Active regulator of sirt1 is required for cancer cell survival but not for sirt1 activity. Open Biol. 2013, 3, 130130. [Google Scholar] [CrossRef] [Green Version]
- Yamakuchi, M.; Ferlito, M.; Lowenstein, C.J. Mir-34a repression of sirt1 regulates apoptosis. Proc. Natl. Acad. Sci. USA 2008, 105, 13421–13426. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamakuchi, M. Microrna regulation of sirt1. Front. Physiol. 2012, 3, 68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Costa, F.F.; Bischof, J.M.; Vanin, E.F.; Lulla, R.R.; Wang, M.; Sredni, S.T.; Rajaram, V.; de Fátima Bonaldo, M.; Wang, D.; Goldman, S.; et al. Identification of micrornas as potential prognostic markers in ependymoma. PLoS ONE 2011, 6, e25114. [Google Scholar] [CrossRef]
- Birks, D.K.; Barton, V.N.; Donson, A.M.; Handler, M.H.; Vibhakar, R.; Foreman, N.K. Survey of microrna expression in pediatric brain tumors. Pediatric Blood Cancer 2011, 56, 211–216. [Google Scholar] [CrossRef]
- Ruiz Esparza-Garrido, R.; Velazquez-Flores, M.A.; Diegoperez-Ramirez, J.; Lopez-Aguilar, E.; Siordia-Reyes, G.; Hernandez-Ortiz, M.; Martinez-Batallar, A.G.; Encarnacion-Guevara, S.; Salamanca-Gomez, F.; Arenas-Aranda, D.J. A proteomic approach of pediatric astrocytomas: Mirnas and network insight. J. Proteom. 2013, 94, 162–175. [Google Scholar] [CrossRef]
- Appin, C.L.; Brat, D.J. Molecular genetics of gliomas. Cancer J. 2014, 20, 66–72. [Google Scholar] [CrossRef]
- López, G.Y.; Van Ziffle, J.; Onodera, C.; Grenert, J.P.; Yeh, I.; Bastian, B.C.; Clarke, J.; Oberheim Bush, N.A.; Taylor, J.; Chang, S.; et al. The genetic landscape of gliomas arising after therapeutic radiation. Acta Neuropathol. 2019, 137, 139–150. [Google Scholar] [CrossRef] [Green Version]
- Paugh, B.S.; Zhu, X.; Qu, C.; Endersby, R.; Diaz, A.K.; Zhang, J.; Bax, D.A.; Carvalho, D.; Reis, R.M.; Onar-Thomas, A.; et al. Novel oncogenic pdgfra mutations in pediatric high-grade gliomas. Cancer Res. 2013, 73, 6219–6229. [Google Scholar] [CrossRef] [Green Version]
- Fan, R. Pax immunoreactivity in poorly differentiated small round cell tumors of childhood. Fetal Pediatric Pathol. 2014, 33, 244–252. [Google Scholar] [CrossRef]
- Su, W.; Hopkins, S.; Nesser, N.K.; Sopher, B.; Silvestroni, A.; Ammanuel, S.; Jayadev, S.; Möller, T.; Weinstein, J.; Garden, G.A. The p53 transcription factor modulates microglia behavior through microrna-dependent regulation of c-maf. J. Immunol. 2014, 192, 358–366. [Google Scholar] [CrossRef] [PubMed]
- Morokoff, A.; Jones, J.; Nguyen, H.; Ma, C.; Lasocki, A.; Gaillard, F.; Bennett, I.; Luwor, R.; Stylli, S.; Paradiso, L.; et al. Serum microrna is a biomarker for post-operative monitoring in glioma. J. Neuro-Oncol. 2020, 149, 391–400. [Google Scholar] [CrossRef] [PubMed]
- Duan, J.; Zhou, K.; Tang, X.; Duan, J.; Zhao, L. MicroRNA-34a inhibits cell proliferation and induces cell apoptosis of glioma cells via targeting of bcl-2. Mol. Med. Rep. 2016, 14, 432–438. [Google Scholar] [CrossRef] [PubMed]
- Fan, Y.N.; Meley, D.; Pizer, B.; Sée, V. Mir-34a mimics are potential therapeutic agents for p53-mutated and chemo-resistant brain tumour cells. PLoS ONE 2014, 9, e108514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, H.; Zhao, H.; Xiang, W. Expression level of human mir-34a correlates with glioma grade and prognosis. J. Neuro-Oncol. 2013, 113, 221–228. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Wang, C.; Cai, L.; Lu, J.; Zhu, Z.; Wang, C.; Su, Z.; Lu, X. Mir-34a derived from mesenchymal stem cells stimulates senescence in glioma cells by inducing DNA damage. Mol. Med. Rep. 2019, 19, 1849–1857. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, S.Z.; Hu, Y.Y.; Zhao, J.; Zhao, Y.B.; Sun, J.D.; Yang, Y.F.; Ji, C.C.; Liu, Z.B.; Cao, W.D.; Qu, Y.; et al. Microrna-34a induces apoptosis in the human glioma cell line, a172, through enhanced ros production and nox2 expression. Biochem. Biophys. Res. Commun. 2014, 444, 6–12. [Google Scholar] [CrossRef] [PubMed]
- Mikkelsen, L.H.; Andersen, M.K.; Andreasen, S.; Larsen, A.C.; Tan, Q.; Toft, P.B.; Wadt, K.; Heegaard, S. Global microrna profiling of metastatic conjunctival melanoma. Melanoma Res. 2019, 29, 465–473. [Google Scholar] [CrossRef]
- Ofek, P.; Calderón, M.; Mehrabadi, F.S.; Krivitsky, A.; Ferber, S.; Tiram, G.; Yerushalmi, N.; Kredo-Russo, S.; Grossman, R.; Ram, Z.; et al. Restoring the oncosuppressor activity of microrna-34a in glioblastoma using a polyglycerol-based polyplex. Nanomed. Nanotechnol. Biol. Med. 2016, 12, 2201–2214. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rathod, S.S.; Rani, S.B.; Khan, M.; Muzumdar, D.; Shiras, A. Tumor suppressive mirna-34a suppresses cell proliferation and tumor growth of glioma stem cells by targeting akt and wnt signaling pathways. FEBS Open Bio 2014, 4, 485–495. [Google Scholar] [CrossRef] [Green Version]
- Sakata, J.; Sasayama, T.; Tanaka, K.; Nagashima, H.; Nakada, M.; Tanaka, H.; Hashimoto, N.; Kagawa, N.; Kinoshita, M.; Nakamizo, S.; et al. Microrna regulating stanniocalcin-1 is a metastasis and dissemination promoting factor in glioblastoma. J. Neuro-Oncol. 2019, 142, 241–251. [Google Scholar] [CrossRef]
- Thor, T.; Künkele, A.; Pajtler, K.W.; Wefers, A.K.; Stephan, H.; Mestdagh, P.; Heukamp, L.; Hartmann, W.; Vandesompele, J.; Sadowski, N.; et al. Mir-34a deficiency accelerates medulloblastoma formation in vivo. Int. J. Cancer 2015, 136, 2293–2303. [Google Scholar] [CrossRef]
- Toraih, E.A.; Aly, N.M.; Abdallah, H.Y.; Al-Qahtani, S.A.; Shaalan, A.A.; Hussein, M.H.; Fawzy, M.S. Microrna-target cross-talks: Key players in glioblastoma multiforme. Tumour Biol. 2017, 39, 1010428317726842. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Wang, L. Mir-34a attenuates glioma cells progression and chemoresistance via targeting pd-l1. Biotechnol. Lett. 2017, 39, 1485–1492. [Google Scholar] [CrossRef]
- Werner, T.V.; Hart, M.; Nickels, R.; Kim, Y.J.; Menger, M.D.; Bohle, R.M.; Keller, A.; Ludwig, N.; Meese, E. Mir-34a-3p alters proliferation and apoptosis of meningioma cells in vitro and is directly targeting smad4, frat1 and bcl2. Aging 2017, 9, 932–954. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, H.; Xing, F.; Yuan, J.; Li, Z.; Zhang, W. Sevoflurane inhibits migration and invasion of glioma cells via regulating mir-34a-5p/mmp-2 axis. Life Sci. 2020, 256, 117897. [Google Scholar] [CrossRef] [PubMed]
- Butz, H.; Likó, I.; Czirják, S.; Igaz, P.; Korbonits, M.; Rácz, K.; Patócs, A. Microrna profile indicates downregulation of the tgfβ pathway in sporadic non-functioning pituitary adenomas. Pituitary 2011, 14, 112–124. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Li, X.; Ning, S.; Ye, J.; Han, L.; Kang, C.; Li, X. Identification of a core mirna-pathway regulatory network in glioma by therapeutically targeting mir-181d, mir-21, mir-23b, β-catenin, cbp, and stat3. PLoS ONE 2014, 9, e101903. [Google Scholar] [CrossRef]
- Chen, L.; Zhang, K.; Shi, Z.; Zhang, A.; Jia, Z.; Wang, G.; Pu, P.; Kang, C.; Han, L. A lentivirus-mediated mir-23b sponge diminishes the malignant phenotype of glioma cells in vitro and in vivo. Oncol. Rep. 2014, 31, 1573–1580. [Google Scholar] [CrossRef] [Green Version]
- Kunder, R.; Jalali, R.; Sridhar, E.; Moiyadi, A.; Goel, N.; Goel, A.; Gupta, T.; Krishnatry, R.; Kannan, S.; Kurkure, P.; et al. Real-time pcr assay based on the differential expression of micrornas and protein-coding genes for molecular classification of formalin-fixed paraffin embedded medulloblastomas. Neuro-Oncology 2013, 15, 1644–1651. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, L.; Han, L.; Zhang, K.; Shi, Z.; Zhang, J.; Zhang, A.; Wang, Y.; Song, Y.; Li, Y.; Jiang, T.; et al. Vhl regulates the effects of mir-23b on glioma survival and invasion via suppression of hif-1α/vegf and β-catenin/tcf-4 signaling. Neuro-Oncology 2012, 14, 1026–1036. [Google Scholar] [CrossRef] [Green Version]
- Geng, J.; Luo, H.; Pu, Y.; Zhou, Z.; Wu, X.; Xu, W.; Yang, Z. Methylation mediated silencing of mir-23b expression and its role in glioma stem cells. Neurosci. Lett. 2012, 528, 185–189. [Google Scholar] [CrossRef] [PubMed]
- Jiang, J.; Yang, J.; Wang, Z.; Wu, G.; Liu, F. Tfam is directly regulated by mir-23b in glioma. Oncol. Rep. 2013, 30, 2105–2110. [Google Scholar] [CrossRef]
- Leone, V.; Langella, C.; D’Angelo, D.; Mussnich, P.; Wierinckx, A.; Terracciano, L.; Raverot, G.; Lachuer, J.; Rotondi, S.; Jaffrain-Rea, M.L.; et al. Mir-23b and mir-130b expression is downregulated in pituitary adenomas. Mol. Cell. Endocrinol. 2014, 390, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Cheng, W.; Ren, X.; Zhang, C.; Han, S.; Wu, A. Expression and prognostic value of micrornas in lower-grade glioma depends on idh1/2 status. J. Neuro-Oncol. 2017, 132, 207–218. [Google Scholar] [CrossRef]
- Hsieh, T.H.; Liu, Y.R.; Chang, T.Y.; Liang, M.L.; Chen, H.H.; Wang, H.W.; Yen, Y.; Wong, T.T. Global DNA methylation analysis reveals mir-214-3p contributes to cisplatin resistance in pediatric intracranial nongerminomatous malignant germ cell tumors. Neuro-Oncology 2018, 20, 519–530. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Che, F.; Zhang, J.; Zhang, M.; Xiao, S.; Liu, Y.; Zhou, L.; Su, Q.; You, C.; Lu, Y.; et al. Diagnostic and prognostic potential of serum cell-free microrna-214 in glioma. World Neurosurg. 2019, 125, e1217–e1225. [Google Scholar] [CrossRef]
- Wang, S.; Jiao, B.; Geng, S.; Ma, S.; Liang, Z.; Lu, S. Combined aberrant expression of microrna-214 and ubc9 is an independent unfavorable prognostic factor for patients with gliomas. Med. Oncol. 2014, 31, 767. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, M.; Wei, W.; Han, D.; Chen, X.; Hu, Q.; Yu, T.; Liu, N.; You, Y.; Zhang, J. Disruption of the ezh2/mirna/β-catenin signaling suppresses aerobic glycolysis in glioma. Oncotarget 2016, 7, 49450–49458. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, C.; He, T.; Li, Z.; Liu, H.; Ding, B. Regulation of hoxa11-as/mir-214-3p/ezh2 axis on the growth, migration and invasion of glioma cells. Biomed. Pharmacother.Biomed. Pharmacother. 2017, 95, 1504–1513. [Google Scholar] [CrossRef]
- Deshpande, R.P.; Panigrahi, M.; Chandrasekhar, Y.B.V.K.; Babu, P.P. Profiling of micrornas modulating cytomegalovirus infection in astrocytoma patients. Neurol. Sci. Off. J. Ital. Neurol. Soc. Ital. Soc. Clin. Neurophysiol. 2018, 39, 1895–1902. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Z.; Yao, L.; Ma, H.; Xu, P.; Li, Z.; Guo, M.; Chen, J.; Bao, H.; Qiao, S.; Zhao, Y.; et al. Mirna-214 inhibits cellular proliferation and migration in glioma cells targeting caspase 1 involved in pyroptosis. Oncol. Res. 2017, 25, 1009–1019. [Google Scholar] [CrossRef]
- Tang, S.L.; Gao, Y.L.; Chen, X.B. Microrna-214 targets pcbp2 to suppress the proliferation and growth of glioma cells. Int. J. Clin. Exp. Pathol. 2015, 8, 12571–12576. [Google Scholar] [PubMed]
- Yang, J.K.; Liu, H.J.; Wang, Y.; Li, C.; Yang, J.P.; Yang, L.; Qi, X.J.; Zhao, Y.L.; Shi, X.F.; Li, J.C.; et al. Exosomal mir-214-5p released from glioblastoma cells modulates inflammatory response of microglia after lipopolysaccharide stimulation through targeting cxcr5. CNS Neurol. Disord. Drug Targets 2019, 18, 78–87. [Google Scholar] [CrossRef] [PubMed]
- Zhao, C.; Xu, Y.; Zhang, Y.; Tan, W.; Xue, J.; Yang, Z.; Zhang, Y.; Lu, Y.; Hu, X. Downregulation of mir-145 contributes to lung adenocarcinoma cell growth to form brain metastases. Oncol. Rep. 2013, 30, 2027–2034. [Google Scholar] [CrossRef] [Green Version]
- Zhao, Z.; Tan, X.; Zhao, A.; Zhu, L.; Yin, B.; Yuan, J.; Qiang, B.; Peng, X. Microrna-214-mediated ubc9 expression in glioma. BMB Rep. 2012, 45, 641–646. [Google Scholar] [CrossRef] [Green Version]
- Gao, S.; Chen, J.; Wang, Y.; Zhong, Y.; Dai, Q.; Wang, Q.; Tu, J. Mir-592 suppresses the development of glioma by regulating rho-associated protein kinase. Neuroreport 2018, 29, 1391–1399. [Google Scholar] [CrossRef]
- Herman, A.; Gruden, K.; Blejec, A.; Podpečan, V.; Motaln, H.; Rožman, P.; Hren, M.; Zupančič, K.; Veber, M.; Verbovšek, U.; et al. Analysis of glioblastoma patients’ plasma revealed the presence of micrornas with a prognostic impact on survival and those of viral origin. PLoS ONE 2015, 10, e0125791. [Google Scholar] [CrossRef]
- Tűzesi, Á.; Kling, T.; Wenger, A.; Lunavat, T.R.; Jang, S.C.; Rydenhag, B.; Lötvall, J.; Pollard, S.M.; Danielsson, A.; Carén, H. Pediatric brain tumor cells release exosomes with a mirna repertoire that differs from exosomes secreted by normal cells. Oncotarget 2017, 8, 90164–90175. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ames, H.M.; Yuan, M.; Vizcaíno, M.A.; Yu, W.; Rodriguez, F.J. Microrna profiling of low-grade glial and glioneuronal tumors shows an independent role for cluster 14q32.31 member mir-487b. Mod. Pathol. 2017, 30, 204–216. [Google Scholar] [CrossRef]
- Abdelfattah, N.; Rajamanickam, S.; Panneerdoss, S.; Timilsina, S.; Yadav, P.; Onyeagucha, B.C.; Garcia, M.; Vadlamudi, R.; Chen, Y.; Brenner, A.; et al. Mir-584-5p potentiates vincristine and radiation response by inducing spindle defects and DNA damage in medulloblastoma. Nat. Commun. 2018, 9, 4541. [Google Scholar] [CrossRef] [Green Version]
- Song, Y.; Wang, G.; Zhuang, J.; Ni, J.; Zhang, S.; Ye, Y.; Xia, W. Microrna-584 prohibits hepatocellular carcinoma cell proliferation and invasion by directly targeting bdnf. Mol. Med. Rep. 2019, 20, 1994–2001. [Google Scholar] [CrossRef]
- Tantawy, M.; Elzayat, M.G.; Yehia, D.; Taha, H. Identification of microrna signature in different pediatric brain tumors. Genet. Mol. Biol. 2018, 41, 27–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, X.P.; Deng, X.L.; Li, L.Y. Microrna-584 functions as a tumor suppressor and targets pttg1ip in glioma. Int. J. Clin. Exp. Pathol. 2014, 7, 8573–8582. [Google Scholar] [PubMed]
- Xue, H.; Guo, X.; Han, X.; Yan, S.; Zhang, J.; Xu, S.; Li, T.; Guo, X.; Zhang, P.; Gao, X.; et al. Microrna-584-3p, a novel tumor suppressor and prognostic marker, reduces the migration and invasion of human glioma cells by targeting hypoxia-induced rock1. Oncotarget 2016, 7, 4785–4805. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yan, W.; Li, R.; Liu, Y.; Yang, P.; Wang, Z.; Zhang, C.; Bao, Z.; Zhang, W.; You, Y.; Jiang, T. Microrna expression patterns in the malignant progression of gliomas and a 5-microrna signature for prognosis. Oncotarget 2014, 5, 12908–12915. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, Q.; Liu, F.; Yan, T.; Wu, M.; Ye, M.; Shi, G.; Lv, S.; Zhu, X. Microrna-576-3p inhibits the migration and proangiogenic abilities of hypoxia-treated glioma cells through hypoxia-inducible factor-1α. Int. J. Mol. Med. 2019, 43, 2387–2397. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dong, L.; Li, Y.; Han, C.; Wang, X.; She, L.; Zhang, H. Mirna microarray reveals specific expression in the peripheral blood of glioblastoma patients. Int. J. Oncol. 2014, 45, 746–756. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiong, D.D.; Xu, W.Q.; He, R.Q.; Dang, Y.W.; Chen, G.; Luo, D.Z. In silico analysis identified mirna-based therapeutic agents against glioblastoma multiforme. Oncol. Rep. 2019, 41, 2194–2208. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Calsina, B.; Castro-Vega, L.J.; Torres-Pérez, R.; Inglada-Pérez, L.; Currás-Freixes, M.; Roldán-Romero, J.M.; Mancikova, V.; Letón, R.; Remacha, L.; Santos, M.; et al. Integrative multi-omics analysis identifies a prognostic mirna signature and a targetable mir-21-3p/tsc2/mtor axis in metastatic pheochromocytoma/paraganglioma. Theranostics 2019, 9, 4946–4958. [Google Scholar] [CrossRef]
- Feng, S.; Yao, J.; Zhang, Z.; Zhang, Y.; Zhang, Z.; Liu, J.; Tan, W.; Sun, C.; Chen, L.; Yu, X. Mir-96 inhibits emt by targeting aeg-1 in glioblastoma cancer cells. Mol. Med. Rep. 2018, 17, 2964–2972. [Google Scholar] [CrossRef] [Green Version]
- Gokhale, A.; Kunder, R.; Goel, A.; Sarin, R.; Moiyadi, A.; Shenoy, A.; Mamidipally, C.; Noronha, S.; Kannan, S.; Shirsat, N.V. Distinctive microrna signature of medulloblastomas associated with the wnt signaling pathway. J. Cancer Res. Ther. 2010, 6, 521–529. [Google Scholar]
- Guo, P.; Yu, Y.; Tian, Z.; Lin, Y.; Qiu, Y.; Yao, W.; Zhang, L. Upregulation of mir-96 promotes radioresistance in glioblastoma cells via targeting pdcd4. Int. J. Oncol. 2018, 53, 1591–1600. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, Y.W.; Kim, E.Y.; Jeon, D.; Liu, J.L.; Kim, H.S.; Choi, J.W.; Ahn, W.S. Differential microrna expression signatures and cell type-specific association with taxol resistance in ovarian cancer cells. Drug Des. Dev. Ther. 2014, 8, 293–314. [Google Scholar]
- Minchenko, D.O.; Tsymbal, D.O.; Riabovol, O.O.; Viletska, Y.M.; Lahanovska, Y.O.; Sliusar, M.Y.; Bezrodnyi, B.H.; Minchenko, O.H. Hypoxic regulation of edn1, ednra, ednrb, and ece1 gene expressions in ern1 knockdown u87 glioma cells. Endocr. Regul. 2019, 53, 250–262. [Google Scholar] [CrossRef] [Green Version]
- Sun, G.; Ding, X.; Bi, N.; Wang, Z.; Wu, L.; Zhou, W.; Zhao, Z.; Wang, J.; Zhang, W.; Fan, J.; et al. Molecular predictors of brain metastasis-related micrornas in lung adenocarcinoma. PLoS Genet. 2019, 15, e1007888. [Google Scholar] [CrossRef] [Green Version]
- Zhang, S.; Zhang, H.; Zhu, J.; Zhang, X.; Liu, Y. Mir-522 contributes to cell proliferation of human glioblastoma cells by suppressing phlpp1 expression. Biomed. Pharmacother. Biomed. Pharmacother. 2015, 70, 164–169. [Google Scholar] [CrossRef]
- Ma, Z. Downregulation of setd8 by mir-382 is involved in glioma progression. Pathol. Res. Pract. 2018, 214, 356–360. [Google Scholar] [CrossRef] [PubMed]
- Song, D.; Diao, J.; Yang, Y.; Chen, Y. Microrna-382 inhibits cell proliferation and invasion of retinoblastoma by targeting bdnf-mediated pi3k/akt signalling pathway. Mol. Med. Rep. 2017, 16, 6428–6436. [Google Scholar] [CrossRef] [Green Version]
- Baertsch, M.A.; Leber, M.F.; Bossow, S.; Singh, M.; Engeland, C.E.; Albert, J.; Grossardt, C.; Jäger, D.; von Kalle, C.; Ungerechts, G. Microrna-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Ther. 2014, 21, 373–380. [Google Scholar] [CrossRef] [PubMed]
- Ding, C.Q.; Deng, W.S.; Yin, X.F.; Ding, X.D. Mir-122 inhibits cell proliferation and induces apoptosis by targeting runt-related transcription factors 2 in human glioma. Eur. Rev. Med. Pharmacol. Sci. 2018, 22, 4925–4933. [Google Scholar]
- Fong, M.Y.; Zhou, W.; Liu, L.; Alontaga, A.Y.; Chandra, M.; Ashby, J.; Chow, A.; O’Connor, S.T.; Li, S.; Chin, A.R.; et al. Breast-cancer-secreted mir-122 reprograms glucose metabolism in premetastatic niche to promote metastasis. Nat. Cell Biol. 2015, 17, 183–194. [Google Scholar] [CrossRef] [Green Version]
- Su, R.; Cao, S.; Ma, J.; Liu, Y.; Liu, X.; Zheng, J.; Chen, J.; Liu, L.; Cai, H.; Li, Z.; et al. Knockdown of sox2ot inhibits the malignant biological behaviors of glioblastoma stem cells via up-regulating the expression of mir-194-5p and mir-122. Mol. Cancer 2017, 16, 171. [Google Scholar] [CrossRef]
- Sun, Y.; Jin, J.G.; Mi, W.Y.; Zhang, S.R.; Meng, Q.; Zhang, S.T. Long noncoding rna uca1 targets mir-122 to promote proliferation, migration, and invasion of glioma cells. Oncol. Res. 2018, 26, 103–110. [Google Scholar] [CrossRef]
- Tang, Y.; Zhao, S.; Wang, J.; Li, D.; Ren, Q.; Tang, Y. Plasma mir-122 as a potential diagnostic and prognostic indicator in human glioma. Neurol. Sci. Off. J. Ital. Neurol. Soc. Ital. Soc. Clin. Neurophysiol. 2017, 38, 1087–1092. [Google Scholar] [CrossRef]
- Yerukala Sathipati, S.; Huang, H.L.; Ho, S.Y. Estimating survival time of patients with glioblastoma multiforme and characterization of the identified microrna signatures. BMC Genom. 2016, 17, 1022. [Google Scholar] [CrossRef] [Green Version]
- Stjernfelt, K.J.; Von Stedingk, K.; Wiebe, T.; Hjorth, L.; Olsson, H.; Øra, I. Predominance of girls with cancer in families with multiple childhood cancer cases. BMC Cancer 2017, 17, 868. [Google Scholar] [CrossRef] [Green Version]
- Picardi, E.; Manzari, C.; Mastropasqua, F.; Aiello, I.; D’Erchia, A.M.; Pesole, G. Profiling rna editing in human tissues: Towards the inosinome atlas. Sci. Rep. 2015, 5, 14941. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Silvestris, D.A.; Picardi, E.; Cesarini, V.; Fosso, B.; Mangraviti, N.; Massimi, L.; Martini, M.; Pesole, G.; Locatelli, F.; Gallo, A. Dynamic inosinome profiles reveal novel patient stratification and gender-specific differences in glioblastoma. Genome Biol. 2019, 20, 33. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Tang, K.; Yan, W.; Wang, Y.; You, G.; Kang, C.; Jiang, T.; Zhang, W. Identifying ki-67 specific mirna-mrna interactions in malignant astrocytomas. Neurosci. Lett. 2013, 546, 36–41. [Google Scholar] [CrossRef]
- Kristensen, B.W.; Priesterbach-Ackley, L.P.; Petersen, J.K.; Wesseling, P. Molecular pathology of tumors of the central nervous system. Ann. Oncol. Off. J. Eur. Soc. Med. Oncol. 2019, 30, 1265–1278. [Google Scholar] [CrossRef]
- Muhlisch, J.; Schwering, A.; Grotzer, M.; Vince, G.H.; Roggendorf, W.; Hagemann, C.; Sorensen, N.; Rickert, C.H.; Osada, N.; Jurgens, H.; et al. Epigenetic repression of rassf1a but not casp8 in supratentorial pnet (spnet) and atypical teratoid/rhabdoid tumors (at/rt) of childhood. Oncogene 2006, 25, 1111–1117. [Google Scholar] [CrossRef] [Green Version]
- Fleming, A.J.; Hukin, J.; Rassekh, R.; Fryer, C.; Kim, J.; Stemmer-Rachamimov, A.; Birks, D.K.; Huang, A.; Yip, S.; Dunham, C. Atypical teratoid rhabdoid tumors (atrts): The british columbia’s children’s hospital’s experience, 1986–2006. Brain Pathol. 2012, 22, 625–635. [Google Scholar] [CrossRef] [PubMed]
- Ebinger, M.; Senf, L.; Wachowski, O.; Scheurlen, W. Promoter methylation pattern of caspase-8, p16ink4a, mgmt, timp-3, and e-cadherin in medulloblastoma. Pathol. Oncol. Res. 2004, 10, 17–21. [Google Scholar] [CrossRef]
- Feierabend, D.; Walter, J.; Grube, S.; Herbold, C.; Beetz, C.; Kalff, R.; Ewald, C. Methylation-specific multiplex ligation-dependent probe amplification and its impact on clinical findings in medulloblastoma. J. Neuro-Oncol. 2014, 116, 213–220. [Google Scholar] [CrossRef] [PubMed]
- Harada, K.; Toyooka, S.; Maitra, A.; Maruyama, R.; Toyooka, K.O.; Timmons, C.F.; Tomlinson, G.E.; Mastrangelo, D.; Hay, R.J.; Minna, J.D.; et al. Aberrant promoter methylation and silencing of the rassf1a gene in pediatric tumors and cell lines. Oncogene 2002, 21, 4345–4349. [Google Scholar] [CrossRef] [Green Version]
- Inda, M.M.; Castresana, J.S. Rassf1a promoter is highly methylated in primitive neuroectodermal tumors of the central nervous system. Neuropathol. Off. J. Jpn. Soc. Neuropathol. 2007, 27, 341–346. [Google Scholar] [CrossRef]
- Lindsey, J.C.; Lusher, M.E.; Anderton, J.A.; Bailey, S.; Gilbertson, R.J.; Pearson, A.D.; Ellison, D.W.; Clifford, S.C. Identification of tumour-specific epigenetic events in medulloblastoma development by hypermethylation profiling. Carcinogenesis 2004, 25, 661–668. [Google Scholar] [CrossRef] [Green Version]
Total Population (n = 62) | ||||||||
---|---|---|---|---|---|---|---|---|
Mean ± StDev | Median | Min | Max | |||||
Age at Diagnosis (years) | 6.20 ± 4.33 | 6.20 | 0.03 | 16.06 | ||||
Time of Curation | 1051.05 ± 5295.79 | 248.75 | 175.00 | 38,112.00 | ||||
Survival (years) | 8.48 ± 3.65 | 7.93 | 0.78 | 17.98 | ||||
With Respect to Gender | ||||||||
Males (n = 39) | Females (n = 25) | |||||||
Mean ± StDev | Median | Min | Max | Mean ± StDev | Median | Min | Max | |
Age at Diagnosis (years) | 6.59 ± 4.59 | 4.92 | 0.03 | 16.06 | 5.72 ± 4.04 | 6.69 | 0.26 | 13.52 |
Time of Curation (Days) | 321.64 ± 188.57 | 248.75 | 175.00 | 1051.05 | 1871.63 ± 7720.16 | 246.50 | 177.17 | 38,112.00 |
Survival (years) | 8.49 ± 3.38 | 7.94 | 1.39 | 17.98 | 8.46 ± 4.13 | 7.70 | 0.78 | 17.93 |
With Respect to Diagnosis | ||||||||
ASTROCYTOMA (n = 20) Mean ± StDev Median (Min-Max) | EPENDYMOMA (n = 7) Mean ± StDev Median (Min-Max) | MEDULLOBLASTOMA (n = 16) Mean ± StDev Median (Min-Max) | ATRT (n = 4) Mean ± StDev Median (Min-Max) | CORTICAL DYSPLASIA (n = 2) Mean ± StDev Median (Min-Max) | CONTROL (n = 13) Mean ± StDev Median (Min-Max) | |||
Age at Diagnosis (years) | 5.86 ± 3.42 3.42 (0.92–13.05) | 5.13 ± 5.40 5.40 (1.44–16.01) | 6.92 ± 4.70 4.70 (0.74–16.06) | 2.46 ± 3.54 3.54 (0.03–7.61) | 10.77 ± 3.87 10.77 (8.04, 13.51) | 6.20 ± 0.00 0.00 (6.20–6.20) | ||
Time of Curation (Days) | 2263.75 ± 8681.67 8681.67 (177.17–38,112.00) | 289.54 ± 133.32 133.32 (175.00–542.17) | 342.54 ± 143.61 143.61 (201.67–553.42) | 292.25 ± 121.79 121.79 (200.67–471.58) | 240.79 ± 19.97 240.79 (226.66, 254.91) | 1051.05 ± 0.00 0.00 (1051.05–1051.05) | ||
Survival (years) | 8.69 ± 2.74 2.74 (6.22–17.75) | 8.28 ± 2.72 2.72 (5.75–12.86) | 9.99 ± 5.74 5.74 (1.39–17.98) | 5.10 ± 3.80 3.80 (0.78–7.93) | 7.91 ± 0.65 7.91 (7.45, 8.38) | 8.48 ± 0.00 0.00 (8.48–8.48) | ||
With Respect to Tumor Grade | ||||||||
Grade I (n = 16) Mean ± StDev Median (Min-Max) | Grade II (n = 9) Mean ± StDev Median (Min-Max) | Grade III (n = 3) Mean ± StDev Median (Min-Max) | Grade IV (n = 18) Mean ± StDev Median (Min-Max) | CONTROL (n = 15) Mean ± StDev Median (Min-Max) | ||||
Age at Diagnosis (years) | 6.47 ± 3.37 6.62 (1.99–13.05) | 5.94 ± 5.31 4.47 (0.26–16.01) | 1.75 ± 0.33 1.72 (1.44–2.10) | 6.33 ± 4.70 7.06 (0.03–16.06) | 9.25 ± 3.80 8.04 (6.20–13.52) | |||
Time of Curation (Days) | 276.98 ± 111.93 241.46 (189.17–553.42) | 4041.37 ± 11,971.66 238.96 (177.17–38,112.00) | 281.33 ± 108.08 277.92 (175.00–391.08) | 337.28 ± 140.07 254.42 (200.67–553.42) | 501.93 ± 475.76 241.50 (213.25–1051.05) | |||
Survival (years) | 8.58 ± 2.79 7.94 (6.22–17.75) | 7.75 ± 1.31 7.93 (6.25–9.99) | 9.31 ± 5.02 9.31 (5.75–12.86) | 8.84 ± 5.88 7.04 (0.78–17.98) | 7.81 ± 0.74 7.94 (7.01–8.48) | |||
With Respect to Clinical Outcome | ||||||||
CR (n = 36) Mean ± StDev Median (Min-Max) | RELAPSE (n = 12) Mean ± StDev Median (Min-Max) | CONTROL (13) Mean ± StDev Median (Min-Max) | ||||||
Age at Diagnosis (years) | 6.33 ± 4.31 6.62 (0.03–16.01) | 6.22 ± 4.81 5.76 (0.74–16.06) | 6.20 ± 0.00 6.20 (6.20–6.20) | |||||
Time of Curation (Days) | 1350.27 ± 6397.47 241.25 (175.00–38,112.00) | 386.45 ± 140.85 407.71 (204.42–553.42) | 1051.05 ± 0.00 1051.05 (1051.05–1051.05) | |||||
Survival (years) | 8.60 ± 3.09 7.92 (5.75–17.98) | 7.68 ± 7.03 8.33 (0.78–17.93) | 8.48 ± 0.00 8.48 (8.48–8.48) |
Primers for MS-PCR for RASSF1 Promoter | |
---|---|
Primer | Sequence |
Methylated | |
Left RASSF1 F primer | GTAAAGTTGGTTTTTAGAAATACGG |
Right RASSF1 R primer | AAAAAAAACTAAAAAAAACCGCG |
Product size: 212, Tm: 69.30 | |
Unmethylated | |
Left RASSF1 F primer | GTAAAGTTGGTTTTTAGAAATATGG |
Right RASSF1 R primer | AAAAAAAACTAAAAAAAACCACACA |
Product size: 212, Tm: 69.30 | |
Primers for MS-PCR for CASP8 Promoter | |
Primer | Sequence |
Methylated | |
Left CASP8 F primer | TGGGAGTAAGGTAGAGTTAGAGGTC |
Right CASP8 R primer | AATTTCAAATCCCAAATTATTTCG |
Product size: 142, Tm: 66.90 | |
Unmethylated | |
Left CASP8 F primer | GGGAGTAAGGTAGAGTTAGAGGTTG |
Right CASP8 R primer | AAATTTCAAATCCCAAATTATTTCA |
Product size: 142, Tm: 66.90 |
Diagnosis vs. Methylated Genes | NONE | CASP8/RASSF1 (n) | MGMT (n) | CASP8/RASSF1/CD44 (n) | CASP8 (n) | MSH6 (n) | CASP8/GATA5/MGMT/ATM1/TP53 (n) | CASP8/RASSF1/CD44/CADM1/RB1 (n) | RASS1 (n) | SUM |
---|---|---|---|---|---|---|---|---|---|---|
NEOPLASMS (n) | 15 | 12 | 2 | 1 | 1 | 1 | 0 | 1 | 2 | 35 |
CONTROLS (n) | 7 | 0 | 0 | 0 | 3 | 0 | 1 | 0 | 0 | 11 |
SUM | 22 | 12 | 2 | 1 | 4 | 1 | 1 | 1 | 2 | 46 |
Chi-square | 16.19 | |||||||||
p-value | 0.040 | |||||||||
Diagnosis vs. Methylated Genes | NONE | CASP8/RASSF1 | MGMT | CASP8/RASSF1/CD44 | CASP8 | MSH6 | CASP8/GATA5/MGMT/ATM1/TP53 | CASP8/RASSF1/CD44/CADM1/RB1 | RASSF1 | SUM |
MALIGNANCY | 4 | 8 | 1 | 1 | 0 | 1 | 0 | 1 | 2 | 18 |
BENIGN | 11 | 4 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 17 |
CONTROL | 7 | 1 | 0 | 0 | 3 | 0 | 1 | 0 | 0 | 12 |
SUM | 22 | 13 | 2 | 1 | 4 | 1 | 1 | 1 | 2 | 47 |
Chi-square | 30.90 | |||||||||
p-value | 0.014 | |||||||||
Diagnosis vs. Methylated Genes | NONE | CASP8/RASSF1 | MGMT | CASP8/RASSF1/CD44 | CASP8 | MSH6 | CASP8/GATA5/MGMT/ATM1/TP53 | CASP8/RASSF1/CD44/CADM1/RB1 | RASSF1 | SUM |
MEDULLOBLASTOMA | 4 | 8 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 15 |
ASTROCYTOMA | 11 | 4 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 17 |
ATRT | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
CONTROL | 7 | 1 | 0 | 0 | 3 | 0 | 1 | 0 | 0 | 12 |
EPENDYMOMA | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 2 |
SUM | 22 | 13 | 2 | 1 | 4 | 1 | 1 | 1 | 2 | 47 |
Chi-square | 65.86 | |||||||||
p-value | 0.0004 | |||||||||
Grade vs. Methylated Genes | NONE | CASP8/RASSF1 | MGMT | CASP8/RASSF1/CD44 | CASP8 | MSH6 | CASP8/GATA5/MGMT/ATM1/TP53 | CASP8/RASSF1/CD44/CADM1/RB1 | RASSF1 | SUM |
IV | 4 | 7 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 15 |
I | 9 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 11 |
II | 2 | 3 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 7 |
CONTROL | 7 | 1 | 0 | 0 | 3 | 0 | 1 | 0 | 0 | 12 |
III | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 |
SUM | 22 | 12 | 2 | 1 | 4 | 1 | 1 | 1 | 2 | 46 |
Chi-square | 55.55 | |||||||||
p-value | 0.0061 |
Diagnosis vs. Aberrations | NONE | CD27 DUPLICATION (n) | CD6 DELETION (n) | CD6/CDKN2A/GATA5 DELETION (n) | CD44 DUPLICATION (n) | SUM |
---|---|---|---|---|---|---|
NEOPLASM (n) | 33 | 1 | 1 | 1 | 0 | 36 |
CONTROL (n) | 10 | 0 | 0 | 0 | 1 | 11 |
SUM | 43 | 1 | 1 | 1 | 1 | 47 |
Chi-square | 4.18 | |||||
p-value | 0.38 | |||||
Diagnosis vs. Aberrations | NONE | CD27 DUPLICATION | CD6 DELETION | CD6/CDKN2A/GATA5 DELETION | CD44 DUPLICATION | SUM |
MALIGNANCY | 18 | 0 | 0 | 0 | 0 | 18 |
BENIGN | 14 | 1 | 1 | 1 | 0 | 17 |
CONTROL | 11 | 0 | 0 | 0 | 1 | 12 |
SUM | 43 | 1 | 1 | 1 | 1 | 47 |
Chi-square | 7.97 | |||||
p-value | 0.44 | |||||
Diagnosis vs. Aberrations | NONE | CD27 DUPLICATION | CD6 DELETION | CD6/CDKN2A/GATA5 DELETION | CD44 DUPLICATION | SUM |
MEDULLOBLASTOMA | 15 | 0 | 0 | 0 | 0 | 15 |
ASTROCYTOMA | 14 | 1 | 1 | 1 | 0 | 17 |
ATRT | 1 | 0 | 0 | 0 | 0 | 1 |
CONTROL | 11 | 0 | 0 | 0 | 1 | 12 |
EPENDYMOMA | 2 | 0 | 0 | 0 | 0 | 2 |
SUM | 43 | 1 | 1 | 1 | 1 | 47 |
Chi-square | 8.51 | |||||
p-value | 0.93 | |||||
Diagnosis vs. Aberrations | NONE | CD27 DUPLICATION | CD6 DELETION | CD6/CDKN2A/GATA5 DELETION | CD44 DUPLICATION | SUM |
IV | 15 | 0 | 0 | 0 | 0 | 15 |
I | 8 | 1 | 1 | 1 | 0 | 11 |
II | 7 | 0 | 0 | 0 | 0 | 7 |
CONTROL | 11 | 0 | 0 | 0 | 1 | 12 |
III | 1 | 0 | 0 | 0 | 0 | 1 |
SUM | 42 | 1 | 1 | 1 | 1 | 46 |
Chi-square | 12.98 | |||||
p-value | 0.67 |
Inv. | miRNA | Expression (Present Study) | Suspected Function (Present Study) | Expression (in the Literature) | Reported Function (in the Literature) | Therapeutic Target? | References |
---|---|---|---|---|---|---|---|
1 | miR-34a | Up-regulated | Oncogene | Down-regulated | Tumor suppressor | Yes | [78,79,80,81,82,83,84,85,86,87,88,89,90,91] |
2 | miR-320e | Up-regulated | Oncogene | Up-regulated | Oncogene | Yes | [77] |
3 | miR-649 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
4 | miR-130B | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
5 | miR-4330 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
6 | miR-95 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
7 | miR-1226 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
8 | miR-3123 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
9 | miR-147 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
10 | miR-3942 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
11 | miR-3616 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
12 | miR-1234 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
13 | miR-1226 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
14 | mIR-4329 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
15 | miR-645 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
16 | miR-3202 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
17 | miR-4267 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
18 | miR-4317 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
19 | miR-3618 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
20 | miR-4251 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
21 | miR-4307 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
22 | miR-720 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
23 | miR-891a | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
24 | miR-518c | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
25 | miR-3665 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
26 | miR-3620 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
27 | miR-147 | Down-regulated | Tumor suppressor | Not known | Not known | Not known | None available |
28 | miR-582 | Down-regulated | Tumor suppressor | Up-regulated 1 | Oncogene | Not known | [92] |
29 | miR-23b | Down-regulated | Tumor suppressor | Up-regulated | Oncogene | Not known | [93,94,95,96] |
30 | miR-23b | Down-regulated | Tumor suppressor | Down-regulated | Tumor suppressor | Not known | [97,98,99] |
31 | miR-302b | Down-regulated | Tumor suppressor | Down-regulated | Tumor suppressor | Not known | [100] |
32 | miR-214 | Down-regulated | Tumor suppressor | Up-regulated | Oncogene | Not known | [101,102,103,104,105] |
33 | miR-214 | Down-regulated | Tumor suppressor | Down-regulated | Tumor suppressor | Not known | [106,107,108,109,110,111] |
34 | mIR-656 | Down-regulated | Tumor suppressor | Down-regulated | Tumor suppressor | Not known | [106,107,108,109,110,111] |
35 | miR-592 | Down-regulated | Tumor suppressor | Down-regulated | Tumor suppressor | Not known | [95,112,113] |
36 | miR-1246 | Down-regulated | Tumor suppressor | Up-regulated | Oncogene | Not known | [114] |
37 | miR-1246 | Down-regulated | Tumor suppressor | Down-regulated | Tumor suppressor | Not known | [115] |
38 | miR-584 | Down-regulated | Tumor suppressor | Down-regulated | Tumor suppressor | Not known | [116,117,118,119,120,121] |
39 | miR-576 | Down-regulated | Tumor suppressor | Down-regulated | Tumor suppressor | Not known | [122] |
40 | miR-576 | Down-regulated | Tumor suppressor | Up-regulated | Oncogene | Not known | [123] |
41 | miR-542 | Down-regulated | Tumor suppressor | Up-regulated | Oncogene | Yes | [124] |
42 | miR-96 | Down-regulated | Tumor suppressor | Down-regulated | Tumor suppressor | Yes | [125,126,127,128,129,130] |
43 | miR-4270 | Down-regulated | Tumor suppressor | Up-regulated | Oncogene | Not known | [131] |
44 | miR-522 | Down-regulated | Tumor suppressor | Up-regulated | Oncogene | Not known | [132] |
45 | miR-382 | Down-regulated | Tumor suppressor | Down-regulated | Tumor suppressor | Not known | [133,134] |
46 | miR-452 | Down-regulated | Tumor suppressor | Down-regulated | Tumor suppressor | Not known | [127] |
47 | miR-122 | Down-regulated | Tumor suppressor | Down-regulated | Tumor suppressor | Yes | [135,136,137,138,139,140,141] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lambrou, G.I.; Poulou, M.; Giannikou, K.; Themistocleous, M.; Zaravinos, A.; Braoudaki, M. Differential and Common Signatures of miRNA Expression and Methylation in Childhood Central Nervous System Malignancies: An Experimental and Computational Approach. Cancers 2021, 13, 5491. https://doi.org/10.3390/cancers13215491
Lambrou GI, Poulou M, Giannikou K, Themistocleous M, Zaravinos A, Braoudaki M. Differential and Common Signatures of miRNA Expression and Methylation in Childhood Central Nervous System Malignancies: An Experimental and Computational Approach. Cancers. 2021; 13(21):5491. https://doi.org/10.3390/cancers13215491
Chicago/Turabian StyleLambrou, George I., Myrto Poulou, Krinio Giannikou, Marios Themistocleous, Apostolos Zaravinos, and Maria Braoudaki. 2021. "Differential and Common Signatures of miRNA Expression and Methylation in Childhood Central Nervous System Malignancies: An Experimental and Computational Approach" Cancers 13, no. 21: 5491. https://doi.org/10.3390/cancers13215491