C1q–HA Matrix Regulates the Local Synthesis of Hyaluronan in Malignant Pleural Mesothelioma by Modulating HAS3 Expression
Abstract
:Simple Summary
Abstract
1. Introduction
2. Results
2.1. MPM Cells Are Able to Synthesize Endogenous HA by Themselves
2.2. Detection of Intracellular HA and HA Cables in MPM Cells
2.3. Intracellular Localization of HA in Cell Organelles
2.4. Basal Expression of HAS Enzymes in MPM Tissue Samples and MPM Cells
2.5. Modulation of HAS Enzyme Expression after HA and C1q Treatment of MPM Cells
2.6. Clinical Significance of HAS mRNA Expression in MPM
3. Discussion
4. Materials and Methods
4.1. Reagents and Antibodies
4.2. Patients and Specimens
4.3. Cell Isolation and Culture
4.4. Red Blood Cell Exclusion Assay
4.5. Alcian Blue Staining
4.6. Immunofluorescence Microscopy for the Detection of HA
4.7. Detection of Endocytosed HA
4.8. Immunohistochemical Analysis
4.9. Flow Cytometry
4.10. Coating Conditions
4.11. Gene Expression Analysis
4.12. Western Blot Analysis
4.13. Bioinformatical Analysis
4.14. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Røe, O.D.; Stella, G.M. Malignant pleural mesothelioma: History, controversy and future of a manmade epidemic. Eur Respir. Rev. 2015, 24, 115–131. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nicolini, F.; Bocchini, M.; Bronte, G.; Delmonte, A.; Guidoboni, M.; Crinò, L.; Mazza, M. Malignant Pleural Mesothelioma: State-of-the-Art on Current Therapies and Promises for the Future. Front. Oncol. 2019, 9, 1519. [Google Scholar] [CrossRef] [PubMed]
- Carbone, M.; Adusumilli, P.S.; Alexander, H.R.; Baas, P.; Bardelli, F.; Bononi, A.; Bueno, R.; Felley-Bosco, E.; Galateau-Salle, F.; Jablons, D.; et al. Mesothelioma: Scientific clues for prevention, diagnosis, and therapy. CA Cancer J. Clin. 2019, 69, 402–429. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mossman, B.T.; Shukla, A.; Heintz, N.H.; Verschraegen, C.F.; Thomas, A.; Hassan, R. New insights into understanding the mechanisms, pathogenesis, and management of malignant mesotheliomas. Am. J. Pathol. 2013, 182, 1065–1077. [Google Scholar] [CrossRef] [Green Version]
- Chu, G.J.; van Zandwijk, N.; Rasko, J.E.J. The Immune Microenvironment in Mesothelioma: Mechanisms of Resistance to Immunotherapy. Front. Oncol. 2019, 9, 1366. [Google Scholar] [CrossRef]
- Li, Y.; Heldin, P. Hyaluronan production increases the malignant properties of mesothelioma cells. Br. J. Cancer 2001, 85, 600–607. [Google Scholar] [CrossRef]
- Joy, R.A.; Vikkath, N.; Ariyannur, P.S. Metabolism and mechanisms of action of hyaluronan in human biology. Drug Metab. Pers. Ther. 2018, 33, 15–32. [Google Scholar] [CrossRef]
- Itano, N.; Kimata, K. Mammalian hyaluronan synthases. IUBMB Life 2002, 54, 195–199. [Google Scholar] [CrossRef]
- Itano, N.; Sawai, T.; Yoshida, M.; Lenas, P.; Yamada, Y.; Imagawa, M.; Shinomura, T.; Hamaguchi, M.; Yoshida, Y.; Ohnuki, Y.; et al. Three isoforms of mammalian hyaluronan synthases have distinct enzymatic properties. J. Biol. Chem. 1999, 274, 25085–25092. [Google Scholar] [CrossRef] [Green Version]
- Weigel, P.H. Hyaluronan Synthase: The Mechanism of Initiation at the Reducing End and a Pendulum Model for Polysaccharide Translocation to the Cell Exterior. Int. J. Cell Biol. 2015, 2015, 367579. [Google Scholar] [CrossRef] [Green Version]
- Nikitovic, D.; Tzardi, M.; Berdiaki, A.; Tsatsakis, A.; Tzanakakis, G.N. Cancer microenvironment and inflammation: Role of hyaluronan. Front. Immunol. 2015, 6, 169. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stern, R. Hyaluronan metabolism: A major paradox in cancer biology. Pathol. Biol. 2005, 53, 372–382. [Google Scholar] [CrossRef] [PubMed]
- Misra, S.; Hascall, V.C.; Markwald, R.R.; Ghatak, S. Interactions between Hyaluronan and Its Receptors (CD44, RHAMM) Regulate the Activities of Inflammation and Cancer. Front. Immunol. 2015, 6, 201. [Google Scholar] [CrossRef] [Green Version]
- Snetkov, P.; Zakharova, K.; Morozkina, S.; Olekhnovich, R.; Uspenskaya, M. Hyaluronic Acid: The Influence of Molecular Weight on Structural, Physical, Physico-Chemical, and Degradable Properties of Biopolymer. Polymers 2020, 12, 1800. [Google Scholar] [CrossRef] [PubMed]
- Fujimoto, N.; Gemba, K.; Asano, M.; Fuchimoto, Y.; Wada, S.; Ono, K.; Ozaki, S.; Kishimoto, T. Hyaluronic acid in the pleural fluid of patients with malignant pleural mesothelioma. Respir. Investig. 2013, 51, 92–97. [Google Scholar] [CrossRef]
- Thylén, A.; Wallin, J.; Martensson, G. Hyaluronan in serum as an indicator of progressive disease in hyaluronan-producing malignant mesothelioma. Cancer 1999, 86, 2000–2005. [Google Scholar] [CrossRef]
- Asplund, T.; Versnel, M.A.; Laurent, T.C.; Heldin, P. Human mesothelioma cells produce factors that stimulate the production of hyaluronan by mesothelial cells and fibroblasts. Cancer Res. 1993, 53, 388–392. [Google Scholar] [PubMed]
- Asplund, T.; Heldin, P. Hyaluronan receptors are expressed on human malignant mesothelioma cells but not on normal mesothelial cells. Cancer Res. 1994, 54, 4516–4523. [Google Scholar] [PubMed]
- Bulla, R.; Tripodo, C.; Rami, D.; Ling, G.S.; Agostinis, C.; Guarnotta, C.; Zorzet, S.; Durigutto, P.; Botto, M.; Tedesco, F. C1q acts in the tumour microenvironment as a cancer-promoting factor independently of complement activation. Nat. Commun. 2016, 7, 10346. [Google Scholar] [CrossRef] [Green Version]
- Agostinis, C.; Vidergar, R.; Belmonte, B.; Mangogna, A.; Amadio, L.; Geri, P.; Borelli, V.; Zanconati, F.; Tedesco, F.; Confalonieri, M.; et al. Complement Protein C1q Binds to Hyaluronic Acid in the Malignant Pleural Mesothelioma Microenvironment and Promotes Tumor Growth. Front. Immunol. 2017, 8, 1559. [Google Scholar] [CrossRef] [Green Version]
- Ripellino, J.A.; Klinger, M.M.; Margolis, R.U.; Margolis, R.K. The hyaluronic acid binding region as a specific probe for the localization of hyaluronic acid in tissue sections. Application to chick embryo and rat brain. J. Histochem. Cytochem. 1985, 33, 1060–1066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De la Motte, C.A.; Hascall, V.C.; Drazba, J.; Bandyopadhyay, S.K.; Strong, S.A. Mononuclear leukocytes bind to specific hyaluronan structures on colon mucosal smooth muscle cells treated with polyinosinic acid:polycytidylic acid: Inter-alpha-trypsin inhibitor is crucial to structure and function. Am. J. Pathol. 2003, 163, 121–133. [Google Scholar] [CrossRef]
- Knudson, W.; Biswas, C.; Li, X.Q.; Nemec, R.E.; Toole, B.P. The role and regulation of tumour-associated hyaluronan. Biol. Hyalurona 1989, 143, 150–159. [Google Scholar] [CrossRef]
- Walker, C.; Mojares, E.; Del Río Hernández, A. Role of Extracellular Matrix in Development and Cancer Progression. Int. J. Mol. Sci. 2018, 19, 3028. [Google Scholar] [CrossRef] [Green Version]
- Törrönen, K.; Soini, Y.; Pääkkö, P.; Parkkinen, J.; Sironen, R.; Rilla, K. Mesotheliomas show higher hyaluronan positivity around tumor cells than metastatic pulmonary adenocarcinomas. Histol. Histopathol. 2016, 31, 1113–1122. [Google Scholar] [CrossRef]
- Edward, M. Melanoma cell-derived factors stimulate glycosaminoglycan synthesis by fibroblasts cultured as monolayers and within contracted collagen lattices. Br. J. Dermatol. 2001, 144, 465–470. [Google Scholar] [CrossRef]
- Edward, M.; Gillan, C.; Micha, D.; Tammi, R.H. Tumour regulation of fibroblast hyaluronan expression: A mechanism to facilitate tumour growth and invasion. Carcinogenesis 2005, 26, 1215–1223. [Google Scholar] [CrossRef] [Green Version]
- Knudson, W.; Biswas, C.; Toole, B.P. Interactions between human tumor cells and fibroblasts stimulate hyaluronate synthesis. Proc. Natl. Acad. Sci. USA 1984, 81, 6767–6771. [Google Scholar] [CrossRef] [Green Version]
- Selbi, W.; de la Motte, C.A.; Hascall, V.C.; Day, A.J.; Bowen, T.; Phillips, A.O. Characterization of hyaluronan cable structure and function in renal proximal tubular epithelial cells. Kidney Int. 2006, 70, 1287–1295. [Google Scholar] [CrossRef]
- Evanko, S.P.; Wight, T.N. Intracellular localization of hyaluronan in proliferating cells. J. Histochem. Cytochem. 1999, 47, 1331–1342. [Google Scholar] [CrossRef]
- Brecht, M.; Mayer, U.; Schlosser, E.; Prehm, P. Increased hyaluronate synthesis is required for fibroblast detachment and mitosis. Biochem. J. 1986, 239, 445–450. [Google Scholar] [CrossRef] [PubMed]
- Tammi, R.; Tammi, M. Correlations between hyaluronan and epidermal proliferation as studied by [3H]glucosamine and [3H]thymidine incorporations and staining of hyaluronan on mitotic keratinocytes. Exp. Cell Res. 1991, 195, 524–527. [Google Scholar] [CrossRef]
- Kan, F.W. High-resolution localization of hyaluronic acid in the golden hamster oocyte-cumulus complex by use of a hyaluronidase-gold complex. Anat. Rec. 1990, 228, 370–382. [Google Scholar] [CrossRef] [PubMed]
- Furukawa, K.; Terayama, H. Isolation and identification of glycosaminoglycans associated with purified nuclei from rat liver. Biochim. Biophys. Acta 1977, 499, 278–289. [Google Scholar] [CrossRef]
- Eggli, P.S.; Graber, W. Association of hyaluronan with rat vascular endothelial and smooth muscle cells. J. Histochem. Cytochem. 1995, 43, 689–697. [Google Scholar] [CrossRef] [Green Version]
- Siiskonen, H.; Rilla, K.; Kärnä, R.; Bart, G.; Jing, W.; Haller, M.F.; DeAngelis, P.L.; Tammi, R.H.; Tammi, M.I. Hyaluronan in cytosol--microinjection-based probing of its existence and suggested functions. Glycobiology 2013, 23, 222–231. [Google Scholar] [CrossRef] [Green Version]
- Marcotti, S.; Maki, K.; Reilly, G.C.; Lacroix, D.; Adachi, T. Hyaluronic acid selective anchoring to the cytoskeleton: An atomic force microscopy study. PLoS ONE 2018, 13, e0206056. [Google Scholar] [CrossRef]
- Törrönen, K.; Nikunen, K.; Kärnä, R.; Tammi, M.; Tammi, R.; Rilla, K. Tissue distribution and subcellular localization of hyaluronan synthase isoenzymes. Histochem. Cell Biol. 2014, 141, 17–31. [Google Scholar] [CrossRef]
- Laurent, T.C.; Fraser, J.R. Hyaluronan. FASEB J. 1992, 6, 2397–2404. [Google Scholar] [CrossRef]
- Nagy, N.; Kuipers, H.F.; Frymoyer, A.R.; Ishak, H.D.; Bollyky, J.B.; Wight, T.N.; Bollyky, P.L. 4-methylumbelliferone treatment and hyaluronan inhibition as a therapeutic strategy in inflammation, autoimmunity, and cancer. Front. Immunol. 2015, 6, 123. [Google Scholar] [CrossRef] [Green Version]
- Kanomata, N.; Yokose, T.; Kamijo, T.; Yonou, H.; Hasebe, T.; Itano, N.; Kimata, K.; Ochiai, A. Hyaluronan synthase expression in pleural malignant mesotheliomas. Virchows Arch. 2005, 446, 246–250. [Google Scholar] [CrossRef] [PubMed]
- Maier, T.; Guell, M.; Serrano, L. Correlation of mRNA and protein in complex biological samples. FEBS Lett. 2009, 583, 3966–3973. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mangogna, A.; Agostinis, C.; Bonazza, D.; Belmonte, B.; Zacchi, P.; Zito, G.; Romano, A.; Zanconati, F.; Ricci, G.; Kishore, U.; et al. Is the Complement Protein C1q a Pro- or Anti-tumorigenic Factor? Bioinformatics Analysis Involving Human Carcinomas. Front. Immunol. 2019, 10, 865. [Google Scholar] [CrossRef] [PubMed]
- Tofuku, K.; Yokouchi, M.; Murayama, T.; Minami, S.; Komiya, S. HAS3-related hyaluronan enhances biological activities necessary for metastasis of osteosarcoma cells. Int. J. Oncol. 2006, 29, 175–183. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reiprich, S.; Hofbauer, E.; Kiderlen, S.; Clausen-Schaumann, H.; Bocker, W.; Aszodi, A.; Schonitzer, V. Adhesive Properties of the Hyaluronan Pericellular Coat in Hyaluronan Synthases Overexpressing Mesenchymal Stem Cells. Int. J. Mol. Sci. 2020, 21, 3827. [Google Scholar] [CrossRef] [PubMed]
- Goswami, C.P.; Nakshatri, H. PROGgene: Gene expression based survival analysis web application for multiple cancers. J. Clin. Bioinform. 2013, 3, 22. [Google Scholar] [CrossRef] [Green Version]
- Goswami, C.P.; Nakshatri, H. PROGgeneV2: Enhancements on the existing database. BMC Cancer 2014, 14, 970. [Google Scholar] [CrossRef] [Green Version]
Gene | Melting Temperature | Forward Sequence Reverse Sequence | Accession Number |
---|---|---|---|
HAS1 | 60 | GGAATAACCTCTTGCAGCAGTTC TCATCCCCAAAAG | NM_001523.3 |
HAS2 | 58 | TCGCAACACGTAACGCAAT ACTTCTCTTTTTCCACCCCATTT | NM_005328.2 |
HAS3 | 60 | CGCAGCAACTTCCATGAGG AGTCGCACACCTGGATGTAGT | NM_005329.2 |
TBP | 60 | GAGCCAAGAGTGAAGAACAGTC GCTCCCCACCATATTCTGAATCT | NM_003194.4 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vidergar, R.; Balduit, A.; Zacchi, P.; Agostinis, C.; Mangogna, A.; Belmonte, B.; Grandolfo, M.; Salton, F.; Biolo, M.; Zanconati, F.; et al. C1q–HA Matrix Regulates the Local Synthesis of Hyaluronan in Malignant Pleural Mesothelioma by Modulating HAS3 Expression. Cancers 2021, 13, 416. https://doi.org/10.3390/cancers13030416
Vidergar R, Balduit A, Zacchi P, Agostinis C, Mangogna A, Belmonte B, Grandolfo M, Salton F, Biolo M, Zanconati F, et al. C1q–HA Matrix Regulates the Local Synthesis of Hyaluronan in Malignant Pleural Mesothelioma by Modulating HAS3 Expression. Cancers. 2021; 13(3):416. https://doi.org/10.3390/cancers13030416
Chicago/Turabian StyleVidergar, Romana, Andrea Balduit, Paola Zacchi, Chiara Agostinis, Alessandro Mangogna, Beatrice Belmonte, Micaela Grandolfo, Francesco Salton, Marco Biolo, Fabrizio Zanconati, and et al. 2021. "C1q–HA Matrix Regulates the Local Synthesis of Hyaluronan in Malignant Pleural Mesothelioma by Modulating HAS3 Expression" Cancers 13, no. 3: 416. https://doi.org/10.3390/cancers13030416