Novel Long Noncoding RNA miR205HG Functions as an Esophageal Tumor-Suppressive Hedgehog Inhibitor
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Identification of a Novel Long Noncoding RNA Downregulated in Barrett’s Esophagus and Esophageal Adenocarcinoma
2.1.1. Cell Lines and Tissues
2.1.2. RNA Extraction, miRNA Extraction, and Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
2.1.3. Next-Generation RNA Sequencing
2.2. miR205HG Function in Esophageal Tumorigenesis
2.2.1. Generation of miR205HG-Stable Cell Lines and Transfection of miR205HG Plasmid and miRNA Mimics
2.2.2. Cell Proliferation Assays
2.2.3. Cell Cycle Analyses by Flow Cytometry
2.2.4. Clonogenic Assays
2.2.5. Invasion Assays
2.2.6. Injection of Tumor Cells into Nude Mice
2.3. Identifying miR205HG’s Function as an Esophageal Tumor-Suppressive Hedgehog Inhibitor
2.3.1. Transient Transfection of miR205HG Plasmid
2.3.2. Transfection of miR Mimics
2.3.3. miRNA Binding Site Prediction
2.3.4. Transfection and Reporter Assays
2.3.5. Three Prime Untranslated Region (3′UTR) PTCH1 Plasmid Construction
2.3.6. Western Blotting
2.3.7. Chromatin Immunoprecipitation Assay (ChIP)
2.4. Statistical Analysis
2.5. Data Availability
3. Results
3.1. Identification of miR205HG and Its Downregulation in Barrett’s Esophagus (BE) and Esophageal Adenocarcinoma (EAC) Cell Lines and Tissues
3.2. Part II
3.2.1. Overexpression of miR205HG Inhibits EAC Cell Proliferation, Colony Formation, Invasion/Migration, Induces EAC G0-G1 Cell Cycle Arrest
3.2.2. miR205HG Inhibits in vivo EAC Tumor Growth
3.3. Identifying miR205HG’s Function as an Esophageal Tumor-Suppressive Hedgehog Inhibitor
3.3.1. Key Sonic Hedgehog (SHH)-signaling Genes Are Upregulated in BE and EAC Cell Lines, and miR205HG and SHH Expression Levels Are Inversely Correlated in BE- and EAC-Matched Tissues
3.3.2. SHH Downregulation in miR205HG-Transfected EAC Clones
3.3.3. miR-205 Directly Binds to PTCH1 3′UTR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
3′UTR | 3′ untranslated region |
BE | Barrett’s esophagus |
BMP4 | Bone morphogenetic protein 4 |
EAC | Esophageal adenocarcinoma |
EC | Esophageal cancer |
ESCC | Esophageal squamous cell carcinoma |
GAPDH | Glyceraldehyde 3-phosphate dehydrogenase |
GERD | Gastroesophageal reflux disease |
HH | Hedgehog |
LncRNA | Long noncoding RNA |
miRNA | MicroRNA |
NcRNA | Noncoding RNA |
NE | Normal esophagus |
qRT-PCR | Quantitative real-time polymerase chain reaction |
RNA-seq | RNA sequencing |
SHH | Sonic hedgehog |
SOX9 | SRY (sex determining region Y)-box 9 |
References
- Simard, E.P.; Ward, E.M.; Siegel, R.; Jemal, A. Cancers with increasing incidence trends in the United States: 1999 through 2008. CA Cancer J. Clin. 2012, 62, 118–128. [Google Scholar] [CrossRef] [PubMed]
- Pohl, H.; Sirovich, B.; Welch, H.G. Esophageal adenocarcinoma incidence: Are we reaching the peak? Cancer Epidemiol. Biomark. Prev. 2010, 19, 1468–1470. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2015. CA Cancer J. Clin. 2015, 65, 5–29. [Google Scholar] [CrossRef] [PubMed]
- Brown, C.S.; Ujiki, M.B. Risk factors affecting the Barrett’s metaplasia-dysplasia-neoplasia sequence. World J. Gastrointest. Endosc. 2015, 7, 438–445. [Google Scholar] [CrossRef] [PubMed]
- Gilbert, E.W.; Luna, R.A.; Harrison, V.L.; Hunter, J.G. Barrett’s esophagus: A review of the literature. J. Gastrointest. Surg. 2011, 15, 708–718. [Google Scholar] [CrossRef] [PubMed]
- El-Serag, H.B.; Naik, A.D.; Duan, Z.; Shakhatreh, M.; Helm, A.; Pathak, A.; Hinojosa-Lindsey, M.; Hou, J.; Nguyen, T.; Chen, J.; et al. Surveillance endoscopy is associated with improved outcomes of oesophageal adenocarcinoma detected in patients with Barrett’s oesophagus. Gut 2016, 65, 1252–1260. [Google Scholar] [CrossRef] [Green Version]
- Cao, J. The functional role of long non-coding RNAs and epigenetics. Biol. Proced. Online 2014, 16, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gupta, R.A.; Shah, N.; Wang, K.C.; Kim, J.; Horlings, H.M.; Wong, D.J.; Tsai, M.C.; Hung, T.; Argani, P.; Rinn, J.L.; et al. Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature 2010, 464, 1071–1076. [Google Scholar] [CrossRef]
- Ji, P.; Diederichs, S.; Wang, W.; Boing, S.; Metzger, R.; Schneider, P.M.; Tidow, N.; Brandt, B.; Buerger, H.; Bulk, E.; et al. MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene 2003, 22, 8031–8041. [Google Scholar] [CrossRef] [Green Version]
- Panzitt, K.; Tschernatsch, M.M.; Guelly, C.; Moustafa, T.; Stradner, M.; Strohmaier, H.M.; Buck, C.R.; Denk, H.; Schroeder, R.; Trauner, M.; et al. Characterization of HULC, a novel gene with striking up-regulation in hepatocellular carcinoma, as noncoding RNA. Gastroenterology 2007, 132, 330–342. [Google Scholar] [CrossRef]
- Yang, F.; Zhang, L.; Huo, X.S.; Yuan, J.H.; Xu, D.; Yuan, S.X.; Zhu, N.; Zhou, W.P.; Yang, G.S.; Wang, Y.Z.; et al. Long noncoding RNA high expression in hepatocellular carcinoma facilitates tumor growth through enhancer of zeste homolog 2 in humans. Hepatology 2011, 54, 1679–1689. [Google Scholar] [CrossRef] [PubMed]
- Khaitan, D.; Dinger, M.E.; Mazar, J.; Crawford, J.; Smith, M.A.; Mattick, J.S.; Perera, R.J. The melanoma-upregulated long noncoding RNA SPRY4-IT1 modulates apoptosis and invasion. Cancer Res. 2011, 71, 3852–3862. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Petrovics, G.; Zhang, W.; Makarem, M.; Street, J.P.; Connelly, R.; Sun, L.; Sesterhenn, I.A.; Srikantan, V.; Moul, J.W.; Srivastava, S. Elevated expression of PCGEM1, a prostate-specific gene with cell growth-promoting function, is associated with high-risk prostate cancer patients. Oncogene 2004, 23, 605–611. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yap, K.L.; Li, S.; Munoz-Cabello, A.M.; Raguz, S.; Zeng, L.; Mujtaba, S.; Gil, J.; Walsh, M.J.; Zhou, M.M. Molecular interplay of the noncoding RNA ANRIL and methylated histone H3 lysine 27 by polycomb CBX7 in transcriptional silencing of INK4a. Mol. Cell 2010, 38, 662–674. [Google Scholar] [CrossRef] [Green Version]
- Yang, X.; Song, J.H.; Cheng, Y.; Wu, W.; Bhagat, T.; Yu, Y.; Abraham, J.M.; Ibrahim, S.; Ravich, W.; Roland, B.C.; et al. Long non-coding RNA HNF1A-AS1 regulates proliferation and migration in oesophageal adenocarcinoma cells. Gut 2014, 63, 881–890. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, W.; Bhagat, T.D.; Yang, X.; Song, J.H.; Cheng, Y.; Agarwal, R.; Abraham, J.M.; Ibrahim, S.; Bartenstein, M.; Hussain, Z.; et al. Hypomethylation of noncoding DNA regions and overexpression of the long noncoding RNA, AFAP1-AS1, in Barrett’s esophagus and esophageal adenocarcinoma. Gastroenterology 2013, 144, 956–966 e954. [Google Scholar] [CrossRef] [Green Version]
- Pavlov, K.; Meijer, C.; van den Berg, A.; Peters, F.T.; Kruyt, F.A.; Kleibeuker, J.H. Embryological signaling pathways in Barrett’s metaplasia development and malignant transformation; mechanisms and therapeutic opportunities. Crit. Rev. Oncol. Hematol. 2014, 92, 25–37. [Google Scholar] [CrossRef]
- Ingham, P.W.; Taylor, A.M.; Nakano, Y. Role of the Drosophila patched gene in positional signalling. Nature 1991, 353, 184–187. [Google Scholar] [CrossRef]
- Toftgard, R. Hedgehog signalling in cancer. Cell Mol. Life Sci. 2000, 57, 1720–1731. [Google Scholar] [CrossRef]
- Hooper, J.E.; Scott, M.P. Communicating with Hedgehogs. Nat. Rev. Mol. Cell Biol. 2005, 6, 306–317. [Google Scholar] [CrossRef]
- Nusslein-Volhard, C.; Wieschaus, E. Mutations affecting segment number and polarity in Drosophila. Nature 1980, 287, 795–801. [Google Scholar] [CrossRef] [PubMed]
- Rubin, L.L.; de Sauvage, F.J. Targeting the Hedgehog pathway in cancer. Nat. Rev. Drug Discov. 2006, 5, 1026–1033. [Google Scholar] [CrossRef] [PubMed]
- Thayer, S.P.; di Magliano, M.P.; Heiser, P.W.; Nielsen, C.M.; Roberts, D.J.; Lauwers, G.Y.; Qi, Y.P.; Gysin, S.; Fernandez-del Castillo, C.; Yajnik, V.; et al. Hedgehog is an early and late mediator of pancreatic cancer tumorigenesis. Nature 2003, 425, 851–856. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goodrich, L.V.; Johnson, R.L.; Milenkovic, L.; McMahon, J.A.; Scott, M.P. Conservation of the hedgehog/patched signaling pathway from flies to mice: Induction of a mouse patched gene by Hedgehog. Genes Dev. 1996, 10, 301–312. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marigo, V.; Scott, M.P.; Johnson, R.L.; Goodrich, L.V.; Tabin, C.J. Conservation in hedgehog signaling: Induction of a chicken patched homolog by Sonic hedgehog in the developing limb. Development 1996, 122, 1225–1233. [Google Scholar]
- Caro, I.; Low, J.A. The role of the hedgehog signaling pathway in the development of basal cell carcinoma and opportunities for treatment. Clin. Cancer Res. 2010, 16, 3335–3339. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, L.; Wang, L.S.; Chen, X.L.; Gatalica, Z.; Qiu, S.; Liu, Z.; Stoner, G.; Zhang, H.; Weiss, H.; Xie, J. Hedgehog signaling activation in the development of squamous cell carcinoma and adenocarcinoma of esophagus. Int. J. Biochem. Mol. Biol. 2012, 3, 46–57. [Google Scholar]
- Wang, D.H.; Clemons, N.J.; Miyashita, T.; Dupuy, A.J.; Zhang, W.; Szczepny, A.; Corcoran-Schwartz, I.M.; Wilburn, D.L.; Montgomery, E.A.; Wang, J.S.; et al. Aberrant epithelial-mesenchymal Hedgehog signaling characterizes Barrett’s metaplasia. Gastroenterology 2010, 138, 1810–1822. [Google Scholar] [CrossRef] [Green Version]
- Ma, X.; Sheng, T.; Zhang, Y.; Zhang, X.; He, J.; Huang, S.; Chen, K.; Sultz, J.; Adegboyega, P.A.; Zhang, H.; et al. Hedgehog signaling is activated in subsets of esophageal cancers. Int. J. Cancer 2006, 118, 139–148. [Google Scholar] [CrossRef]
- Kan, T.; Sato, F.; Ito, T.; Matsumura, N.; David, S.; Cheng, Y.; Agarwal, R.; Paun, B.C.; Jin, Z.; Olaru, A.V.; et al. The miR-106b-25 polycistron, activated by genomic amplification, functions as an oncogene by suppressing p21 and Bim. Gastroenterology 2009, 136, 1689–1700. [Google Scholar] [CrossRef] [Green Version]
- Sukocheva, O.A.; Wee, C.; Ansar, A.; Hussey, D.J.; Watson, D.I. Effect of estrogen on growth and apoptosis in esophageal adenocarcinoma cells. Dis. Esophagus 2013, 26, 628–635. [Google Scholar] [CrossRef] [PubMed]
- Palanca-Wessels, M.C.; Klingelhutz, A.; Reid, B.J.; Norwood, T.H.; Opheim, K.E.; Paulson, T.G.; Feng, Z.; Rabinovitch, P.S. Extended lifespan of Barrett’s esophagus epithelium transduced with the human telomerase catalytic subunit: A useful in vitro model. Carcinogenesis 2003, 24, 1183–1190. [Google Scholar] [CrossRef] [PubMed]
- Hanna, A.; Shevde, L.A. Hedgehog signaling: Modulation of cancer properies and tumor mircroenvironment. Mol. Cancer 2016, 15, 24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ryan, D.G.; Oliveira-Fernandes, M.; Lavker, R.M. MicroRNAs of the mammalian eye display distinct and overlapping tissue specificity. Mol. Vis. 2006, 12, 1175–1184. [Google Scholar] [PubMed]
Target Gene | Primer Direction | Sequence |
---|---|---|
miR205HG | Forward | GTGCTTTATATAGGAAAGGACCAAC |
Reverse | CCATGCCTCCTGAACTTCACT | |
SHH | Forward | GCTCGGTGAAAGCAGAGAAC |
Reverse | CCAGGAAAGTGAGGAAGTCG | |
PTCH1 | Forward | TCCCAGCGCTTTCTACATCT |
Reverse | CTTTGTCGTGGACCCATTCT | |
GLI1 | Forward | GTGCAAGTCAAGCCAGAACA |
Reverse | ATAGGGGCCTGACTGGAGAT | |
SMO | Forward | GTTCTCCATCAAGAGCAACCAC |
Reverse | CGATTCTTGATCTCACAGTCAGG |
Gene Information | Normalized Copy Numbers | Fold Change | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Name | NE1 | BE1 | EAC1 | NE2 | BE2 | EAC2 | NE3 | BE3 | NE4 | BE4 | NE/BE | NE/EAC | NE/BE | NE/EAC |
CTA-55I10.1 | 1120 | 11 | 0 | 49 | 0 | 0 | 749 | 157 | 548 | 94 | 101.82 | #DIV/0! | 4.77 | 5.83 |
AC079305.1 | 270 | 8 | 60 | 11 | 17 | 3 | 76 | 13 | 52 | 16 | 33.75 | 4.5 | 5.85 | 3.25 |
NEAT1 | 41741 | 3557 | 12330 | 11208 | 29426 | 8631 | 47273 | 12815 | 32335 | 8864 | 11.73 | 3.39 | 3.69 | 3.65 |
RP11-206L10.11 | 20 | 3 | 7 | 10 | 42 | 22 | 28 | 14 | 38 | 25 | 6.67 | 2.86 | 2 | 1.52 |
CTC-228N24.3 | 99 | 6 | 38 | 16 | 34 | 8 | 34 | 27 | 32 | 10 | 16.5 | 2.61 | 1.26 | 3.2 |
NCRNA00275 | 664 | 28 | 294 | 15 | 38 | 3 | 120 | 44 | 88 | 28 | 23.71 | 2.26 | 2.73 | 3.14 |
SNHG12 | 240 | 33 | 113 | 13 | 11 | 5 | 49 | 24 | 53 | 18 | 7.27 | 2.12 | 5.04 | 2.94 |
SNHG5 | 1294 | 116 | 668 | 19 | 107 | 22 | 218 | 69 | 137 | 36 | 11.16 | 1.94 | 3.16 | 3.81 |
SNHG1 | 4665 | 657 | 2426 | 22 | 37 | 15 | 126 | 29 | 96 | 25 | 7.1 | 1.92 | 4.61 | 3.84 |
NBPF1 | 128 | 14 | 70 | 22 | 45 | 18 | 60 | 22 | 37 | 22 | 9.14 | 1.83 | 2.73 | 1.68 |
CTC-358I24.1 | 70 | 4 | 41 | 10 | 49 | 15 | 54 | 25 | 55 | 26 | 17.5 | 1.71 | 2.16 | 2.12 |
GAS5 | 3907 | 459 | 2302 | 30 | 64 | 17 | 219 | 90 | 160 | 66 | 8.51 | 1.7 | 2.43 | 2.42 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, J.H.; Tieu, A.H.; Cheng, Y.; Ma, K.; Akshintala, V.S.; Simsek, C.; Prasath, V.; Shin, E.J.; Ngamruengphong, S.; Khashab, M.A.; et al. Novel Long Noncoding RNA miR205HG Functions as an Esophageal Tumor-Suppressive Hedgehog Inhibitor. Cancers 2021, 13, 1707. https://doi.org/10.3390/cancers13071707
Song JH, Tieu AH, Cheng Y, Ma K, Akshintala VS, Simsek C, Prasath V, Shin EJ, Ngamruengphong S, Khashab MA, et al. Novel Long Noncoding RNA miR205HG Functions as an Esophageal Tumor-Suppressive Hedgehog Inhibitor. Cancers. 2021; 13(7):1707. https://doi.org/10.3390/cancers13071707
Chicago/Turabian StyleSong, Jee Hoon, Alan H. Tieu, Yulan Cheng, Ke Ma, Venkata S. Akshintala, Cem Simsek, Vishnu Prasath, Eun Ji Shin, Saowanee Ngamruengphong, Mouen A. Khashab, and et al. 2021. "Novel Long Noncoding RNA miR205HG Functions as an Esophageal Tumor-Suppressive Hedgehog Inhibitor" Cancers 13, no. 7: 1707. https://doi.org/10.3390/cancers13071707