HER2-Targeted Immunotherapy and Combined Protocols Showed Promising Antiproliferative Effects in Feline Mammary Carcinoma Cell-Based Models
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Feline and Human Mammary Carcinoma Cell Lines
2.2. In Vitro Cytotoxicity Assays
2.3. Assessment of HER2 Expression Status by Immunocytochemistry (ICC)
2.4. Flow Cytometry Assay
2.5. Animal Population
2.6. DNA Extraction, Amplification and Sequence Analysis of Feline HER2 ECD
2.7. Statistical Analysis
3. Results
3.1. Trastuzumab, Pertuzumab and T-DM1 Presented Antiproliferative Effects in FMC Cell Lines
3.2. Apoptosis Is the Main Mechanism of Cell Death Caused by Anti-HER2 mAbs and ADC T-DM1
3.3. Combined Exposures of Two Anti-HER2 mAbs and Anti-HER2 mAbs with Lapatinib Showed Synergistic Antiproliferative Effects
3.4. In the FMC Clinical Samples, Mutations Found in the HER2 ECD, Subdomains II and IV Were Not Associated with Immunotherapy Resistance in Humans
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Soare, G.R.; Soare, C.A. Immunotherapy for Breast Cancer: First FDA Approved Regimen. Discoveries 2019, 7, e91. [Google Scholar] [CrossRef] [PubMed]
- Soares, M.; Ribeiro, R.; Najmudin, S.; Gameiro, A.; Rodrigues, R.; Cardoso, F.; Ferreira, F. Serum HER2 levels are increased in cats with mammary carcinomas and predict tissue HER2 status. Oncotarget 2016, 7, 17314–17326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soares, M.; Madeira, S.; Correia, J.; Peleteiro, M.; Cardoso, F.; Ferreira, F. Molecular based subtyping of feline mammary carcinomas and clinicopathological characterization. Breast 2016, 27, 44–51. [Google Scholar] [CrossRef]
- Soares, M.; Correia, J.; Rodrigues, P.; Simões, M.; Matos, A.; de Ferreira, F. Feline HER2 Protein Expression Levels and Gene Status in Feline Mammary Carcinoma: Optimization of Immunohistochemistry (IHC) and In Situ Hybridization (ISH) Techniques. Microsc. Microanal. 2013, 19, 876–882. [Google Scholar] [CrossRef] [PubMed]
- Maniscalco, L.; Iussich, S.; De Las Mulas, J.M.; Millán, Y.; Biolatti, B.; Sasaki, N.; Nakagawa, T.; De Maria, R. Activation of AKT in feline mammary carcinoma: A new prognostic factor for feline mammary tumours. Vet. J. 2012, 191, 65–71. [Google Scholar] [CrossRef]
- Millanta, F.; Calandrella, M.; Citi, S.; Della Santa, D.; Poli, A. Overexpression of HER-2 in feline invasive mammary carcinomas: An immunohistochemical survey and evaluation of its prognostic potential. Vet. Pathol. 2005, 42, 30–34. [Google Scholar] [CrossRef]
- Michishita, M.; Ohtsuka, A.; Nakahira, R.; Tajima, T.; Nakagawa, T.; Sasaki, N.; Arai, T.; Takahashi, K. Anti-tumor effect of bevacizumab on a xenograft model of feline mammary carcinoma. J. Vet. Med. Sci. 2016, 78, 685–689. [Google Scholar] [CrossRef] [Green Version]
- Appert-Collin, A.; Hubert, P.; Crémel, G.; Bennasroune, A. Role of ErbB receptors in cancer cell migration and invasion. Front. Pharmacol. 2015, 6, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Sun, Y.; Feng, X.; Qu, J.; Han, W.; Liu, Z.; Li, X.; Zou, M.; Zhen, Y.; Zhu, J. Expression and Characterization of the Extracellular Domain of Human HER2 from Escherichia Coli, and Production of Polyclonal Antibodies Against the Recombinant Proteins. Appl. Biochem. Biotechnol. 2015, 176, 1029–1043. [Google Scholar] [CrossRef]
- Witton, C.J.; Reeves, J.R.; Going, J.J.; Cooke, T.G.; Barlett, J.M.S. Expression of the HER1-4 family of receptor tyrosine kinases in breast cancer. J. Pathol. 2003, 200, 290–297. [Google Scholar] [CrossRef]
- Ferguson, K.M. Structure-based view of epidermal growth factor receptor regulation. Annu. Rev. Biophys. 2008, 37, 353–373. [Google Scholar] [CrossRef] [Green Version]
- De Maria, R.; Olivero, M.; Iussich, S.; Nakaichi, M.; Murata, T.; Biolatti, B.; Flavia, M.; Renzo, D. Spontaneous Feline Mammary Carcinoma Is a Model of HER2 Overexpressing Poor Prognosis Human Breast Cancer. Cancer Res. 2005, 65, 907–912. [Google Scholar]
- Santos, S.; Baptista, C.S.; Abreu, R.M.V.; Bastos, E.; Amorim, I.; Gut, I.G.; Gärtner, F.; Chaves, R. ERBB2 in cat mammary neoplasias disclosed a positive correlation between RNA and protein low expression levels: A model for erbB-2 negative human breast cancer. PLoS ONE 2013, 8, 1–17. [Google Scholar] [CrossRef]
- Jhanwar-Uniyal, M.; Wainwright, J.V.; Mohan, A.L.; Tobias, M.E.; Murali, R.; Gandhi, C.D.; Schmidt, M.H. Diverse signaling mechanisms of mTOR complexes: mTORC1 and mTORC2 in forming a formidable relationship. Adv. Biol. Regul. 2019, 72, 51–62. [Google Scholar] [CrossRef]
- Oh, D.Y.; Bang, Y.J. HER2-targeted therapies—A role beyond breast cancer. Nat. Rev. Clin. Oncol. 2020, 17, 33–48. [Google Scholar] [CrossRef] [PubMed]
- Slamon, D.; Eiermann, W.; Robert, N.; Pienkowski, T.; Martin, M.; Press, M.; Mackey, J.; Glaspy, J.; Chan, A.; Pawlicki, M.; et al. Adjuvant Trastuzumab in HER2-Positive Breast Cancer. N. Engl. J. Med. 2011, 364, 225–237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Piccart-Gebhart, M.J.; Procter, M.; Leyland-Jones, B.; Goldhirsch, A.; Untch, M.; Smith, I.; Gianni, L.; Baselga, J.; Bell, R.; Jackisch, C.; et al. Trastuzumab after Adjuvant Chemotherapy in HER2-Positive Breast Cancer. N. Engl. J. Med. 2005, 353, 599–609. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Richard, S.; Selle, F.; Lotz, J.P.; Khalil, A.; Gligorov, J.; Grazziotin-Soares, D. Pertuzumab and trastuzumab: The rationale way to synergy. An. Acad. Bras. Cienc. 2016, 88, 565–577. [Google Scholar] [CrossRef] [Green Version]
- Klapper, L.N.; Waterman, H.; Sela, M.; Yarden, Y. Tumor-inhibitory antibodies to HER-2/ErbB-2 may act by recruiting c-Cbl and enhancing ubiquitination of HER-2. Cancer Res. 2000, 60, 3384–3388. [Google Scholar] [PubMed]
- Valabrega, G.; Montemurro, F.; Aglietta, M. Trastuzumab: Mechanism of action, resistance and future perspectives in HER2-overexpressing breast cancer. Ann. Oncol. 2007, 18, 977–984. [Google Scholar] [CrossRef]
- Hudis, C.A. Trastuzumab—Mechanism of action and use in clinical practice. N. Engl. J. Med. 2007, 357, 39–51. [Google Scholar] [CrossRef] [Green Version]
- Menyhart, O.; Santarpia, L.; Gyorffy, B. A Comprehensive Outline of Trastuzumab Resistance Biomarkers in HER2 Overexpressing Breast Cancer. Curr. Cancer Drug Targets 2015, 15, 665–683. [Google Scholar] [CrossRef]
- Mittendorf, E.A.; Wu, Y.; Scaltriti, M.; Meric-Bernstam, F.; Hunt, K.K.; Dawood, S.; Esteva, F.J.; Buzdar, A.U.; Chen, H.; Eksambi, S.; et al. Loss of HER2 amplification following trastuzumab-based neoadjuvant systemic therapy and survival outcomes. Clin. Cancer Res. 2009, 15, 7381–7388. [Google Scholar] [CrossRef] [Green Version]
- Scaltriti, M.; Rojo, F.; Ocaña, A.; Anido, J.; Guzman, M.; Cortes, J.; Di Cosimo, S.; Matias-Guiu, X.; Ramon y Cajal, S.; Arribas, J.; et al. Expression of p95HER2, a truncated form of the HER2 receptor, and response to Anti-HER2 therapies in breast cancer. J. Natl. Cancer Inst. 2007, 99, 628–638. [Google Scholar] [CrossRef] [Green Version]
- Lipton, A.; Goodman, L.; Leitzel, K.; Cook, J.; Sperinde, J.; Haddad, M.; Köstler, W.J.; Huang, W.; Weidler, J.M.; Ali, S.; et al. HER3, p95HER2, and HER2 protein expression levels define multiple subtypes of HER2-positive metastatic breast cancer. Breast Cancer Res. Treat. 2013, 141, 43–53. [Google Scholar] [CrossRef] [Green Version]
- Kataoka, Y.; Mukohara, T.; Shimada, H.; Saijo, N.; Hirai, M.; Minami, H. Association between gain-of-function mutations in PIK3CA and resistance to HER2-targeted agents in HER2-amplified breast cancer cell lines. Ann. Oncol. 2010, 21, 255–262. [Google Scholar] [CrossRef]
- Jensen, J.D.; Knoop, A.; Laenkholm, A.V.; Grauslund, M.; Jensen, M.B.; Santoni-Rugiu, E.; Andersson, M.; Ewertz, M. PIK3CA mutations, PTEN, and pHER2 expression and impact on outcome in HER2-positive early-stage breast cancer patients treated with adjuvant chemotherapy and trastuzumab. Ann. Oncol. 2012, 23, 2034–2042. [Google Scholar] [CrossRef]
- Nami, B.; Maadi, H.; Wang, Z. Mechanisms underlying the action and synergism of trastuzumab and pertuzumab in targeting HER2-positive breast cancer. Cancers 2018, 10, 342. [Google Scholar] [CrossRef] [Green Version]
- Mullen, P.; Cameron, D.A.; Hasmann, M.; Smyth, J.F.; Langdon, S.P. Sensitivity to pertuzumab (2C4) in ovarian cancer models: Cross-talk with estrogen receptor signaling. Mol. Cancer Ther. 2007, 6, 93–100. [Google Scholar] [CrossRef] [Green Version]
- Von Minckwitz, G.; Procter, M.; De Azambuja, E.; Zardavas, D.; Benyunes, M.; Viale, G.; Suter, T.; Arahmani, A.; Rouchet, N.; Clark, E.; et al. Adjuvant pertuzumab and trastuzumab in early her2-positive breast cancer. N. Engl. J. Med. 2017, 377, 122–131. [Google Scholar] [CrossRef]
- Gerratana, L.; Bonotto, M.; Bozza, C.; Ongaro, E.; Fanotto, V.; Pelizzari, G.; Puglisi, F. Pertuzumab and breast cancer: Another piece in the anti-HER2 puzzle. Expert Opin. Biol. Ther. 2017, 17, 365–374. [Google Scholar] [CrossRef] [PubMed]
- Nahta, R. Molecular Mechanisms of Trastuzumab-Based Treatment in HER2-Overexpressing Breast Cancer. ISRN Oncol. 2012, 2012, 1–16. [Google Scholar] [CrossRef] [Green Version]
- Yamashita-Kashima, Y.; Shu, S.; Yorozu, K.; Moriya, Y.; Harada, N. Mode of action of pertuzumab in combination with trastuzumab plus docetaxel therapy in a HER2-positive breast cancer xenograft model. Oncol. Lett. 2017, 14, 4197–4205. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Wu, S.; Zhuang, X.; Weng, G.; Fan, J.; Yang, X.; Xu, Y.; Pan, L.; Hou, T.; Zhou, Z.; et al. Identification of an activating mutation in the extracellular domain of HER2 conferring resistance to pertuzumab. Onco Targets. Ther. 2019, 12, 11597–11608. [Google Scholar] [CrossRef] [Green Version]
- Gaibar, M.; Beltrán, L.; Romero-Lorca, A.; Fernández-Santander, A.; Novillo, A.; Selli, C. Somatic Mutations in HER2 and Implications for Current Treatment Paradigms in HER2-Positive Breast Cancer. J. Oncol. 2020, 2020, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Von Minckwitz, G.; Huang, C.S.; Mano, M.S.; Loibl, S.; Mamounas, E.P.; Untch, M.; Wolmark, N.; Rastogi, P.; Schneeweiss, A.; Redondo, A.; et al. Trastuzumab emtansine for residual invasive HER2-positive breast cancer. N. Engl. J. Med. 2019, 380, 617–628. [Google Scholar] [CrossRef]
- Phillips, G.D.L.; Li, G.; Dugger, D.L.; Crocker, L.M.; Parsons, K.L.; Mai, E.; Blättler, W.A.; Lambert, J.M.; Chari, R.V.J.; Lutz, R.J.; et al. Targeting HER2-positive breast cancer with trastuzumab-DM1, an antibody-cytotoxic drug conjugate. Cancer Res. 2008, 68, 9280–9290. [Google Scholar] [CrossRef] [Green Version]
- Klute, K.; Nackos, E.; Tasaki, S.; Tagawa, S.T. Microtubule inhibitor-based antibody—Drug conjugates for cancer therapy. Onco. Targets Ther. 2014, 7, 2227–2236. [Google Scholar]
- Barok, M.; Joensuu, H.; Isola, J. Trastuzumab emtansine: Mechanisms of action and drug resistance. Breast Cancer Res. 2014, 16, 3378. [Google Scholar] [CrossRef] [Green Version]
- Liu, P.; Fan, J.; Wang, Z.; Zai, W.; Song, P.; Li, Y.; Ju, D. The role of autophagy in the cytotoxicity induced by trastuzumab emtansine (T-DM1) in HER2-positive breast cancer cells. AMB Express 2020, 10, 1–10. [Google Scholar] [CrossRef]
- Wang, L.; Wang, Q.; Gao, M.; Fu, L.; Li, Y.; Quan, H.; Lou, L. STAT3 activation confers trastuzumab-emtansine (T-DM1) resistance in HER2-positive breast cancer. Cancer Sci. 2018, 109, 3305–3315. [Google Scholar] [CrossRef]
- Sabbaghi, M.A.; Gil-Gomez, G.; Guardia, C.; Servitja, S.; Arpí, O.; García-Alonso, S.; Menendez, S.; Arumi-Uria, M.; Serrano, L.; Salido, M.; et al. Defective cyclin B1 induction in trastuzumab-emtansine (T-DM1) acquired resistance in HER2-positive breast cancer. Clin. Cancer Res. 2017, 23, 7006–7019. [Google Scholar] [CrossRef] [Green Version]
- Schroeder, R.L.; Stevens, C.L.; Sridhar, J. Small molecule tyrosine kinase inhibitors of ErbB2/HER2/Neu in the treatment of aggressive breast cancer. Molecules 2014, 19, 15196–15212. [Google Scholar] [CrossRef] [Green Version]
- Tóth, G.; Szöőr, Á.; Simon, L.; Yarden, Y.; Szöllősi, J.; Vereb, G. The combination of trastuzumab and pertuzumab administered at approved doses may delay development of trastuzumab resistance by additively enhancing antibody-dependent cell-mediated cytotoxicity. mAbs 2016, 8, 1361–1370. [Google Scholar] [CrossRef] [Green Version]
- Nahta, R.; Hung, M.C.; Esteva, F.J. The HER-2-Targeting Antibodies Trastuzumab and Pertuzumab Synergistically Inhibit the Survival of Breast Cancer Cells. Cancer Res. 2004, 64, 2343–2346. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Harbeck, N.; Beckmann, M.W.; Rody, A.; Schneeweiss, A.; Müller, V.; Fehm, T.; Marschner, N.; Gluz, O.; Schrader, I.; Heinrich, G.; et al. HER2 dimerization inhibitor pertuzumab—Mode of action and clinical data in breast cancer. Breast Care 2013, 8, 49–55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Canonici, A.; Ivers, L.; Conlon, N.T.; Pedersen, K.; Gaynor, N.; Browne, B.C.; O’Brien, N.A.; Gullo, G.; Collins, D.M.; O’Donovan, N.; et al. HER-targeted tyrosine kinase inhibitors enhance response to trastuzumab and pertuzumab in HER2-positive breast cancer. Investig. New Drugs 2019, 37, 441–451. [Google Scholar] [CrossRef]
- Watson, S.S.; Dane, M.; Chin, K.; Tatarova, Z.; Liu, M.; Liby, T.; Thompson, W.; Smith, R.; Nederlof, M.; Bucher, E.; et al. Microenvironment-Mediated Mechanisms of Resistance to HER2 Inhibitors Differ between HER2+ Breast Cancer Subtypes. Cell Syst. 2018, 6, 329–342.e6. [Google Scholar] [CrossRef] [Green Version]
- Okita, R.; Uhiko Shimizu, K.; Nojima, Y.; Yukawa, T.; Maeda, A.; Saisho, S.; Nakata, M. Lapatinib enhances trastuzumab-mediated antibody-dependent cellular cytotoxicity via upregulation of HER2 in malignant mesothelioma cells. Oncol. Rep. 2015, 34, 2864–2870. [Google Scholar] [CrossRef] [Green Version]
- Cheung, K.L. Treatment strategies and survival outcomes in breast cancer. Cancers 2020, 12, 735. [Google Scholar] [CrossRef] [Green Version]
- Maniscalco, L.; Millan, Y.; Iussich, S.; Denina, M.; Sanchez-Cespedes, R.; Gattino, F.; Biolatti, B.; Sasaki, N.; Nakagawa, T.; Di Renzo, M.F.; et al. Activation of mammalian target of rapamycin (mTOR) in triple negative feline mammary carcinomas. BMC Vet. Res. 2013, 9, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Almeida, F.; Gameiro, A.; Correia, J.; Ferreira, F. Histone Deacetylase Inhibitors and Microtubule Inhibitors Induce Apoptosis in Feline Luminal Mammary Carcinoma Cells. Animals 2021, 11, 502. [Google Scholar] [CrossRef]
- Wolff, A.C.; Hammond, M.E.H.; Hicks, D.G.; Dowsett, M.; McShane, L.M.; Allison, K.H.; Allred, D.C.; Bartlett, J.M.S.; Bilous, M.; Fitzgibbons, P.; et al. Recommendations for human epidermal growth factor receptor 2 testing in breast. J. Clin. Oncol. 2013, 31, 3997–4013. [Google Scholar] [CrossRef] [PubMed]
- Santos, S.; Sá, D.; Bastos, E.; Guedes-Pinto, H.; Gut, I.; Gärtner, F.; Chaves, R. An efficient protocol for genomic DNA extraction from formalin-fixed paraffin-embedded tissues. Res. Vet. Sci. 2009, 86, 421–426. [Google Scholar] [CrossRef]
- Ferreira, D.; Soares, M.; Correia, J.; Adega, F.; Ferreira, F.; Chaves, R. Assessment of ERBB2 and TOP2agene statusand expression profilein feline mammary tumors: Findings and guidelines. Aging 2019, 11, 4688–4705. [Google Scholar] [CrossRef] [PubMed]
- Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Stucky, B.J. Seqtrace: A graphical tool for rapidly processing DNA sequencing chromatograms. J. Biomol. Tech. 2012, 23, 90–93. [Google Scholar] [CrossRef] [Green Version]
- Porrello, A.; Cardelli, P.; Spugnini, E.P. Oncology of companion animals as a model for humans. An overview of tumor histotypes. J. Exp. Clin. Cancer Res. 2006, 25, 97–105. [Google Scholar]
- Gearing, D.P.; Huebner, M.; Virtue, E.R.; Knight, K.; Hansen, P.; Lascelles, B.D.X.; Gearing, R.P.; Drew, A.C. In Vitro and In Vivo Characterization of a Fully Felinized Therapeutic Anti-Nerve Growth Factor Monoclonal Antibody for the Treatment of Pain in Cats. J. Vet. Intern. Med. 2016, 30, 1129–1137. [Google Scholar] [CrossRef]
- Enomoto, M.; Mantyh, P.W.; Murrell, J.; Innes, J.F.; Lascelles, B.D.X. Anti-nerve growth factor monoclonal antibodies for the control of pain in dogs and cats. Vet. Rec. 2019, 184, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Hegde, P.S.; Rusnak, D.; Bertiaux, M.; Alligood, K.; Strum, J.; Gagnon, R.; Gilmer, T.M. Delineation of molecular mechanisms of sensitivity to lapatinib in breast cancer cell lines using global gene expression profiles. Mol. Cancer Ther. 2007, 6, 1629–1640. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Zhang, J.; Liu, C.; Du, S.; Feng, L.; Luan, X.; Zhang, Y.; Shi, Y.; Wang, T.; Wu, Y.; et al. Neratinib induces ErbB2 ubiquitylation and endocytic degradation via HSP90 dissociation in breast cancer cells. Cancer Lett. 2016, 382, 176–185. [Google Scholar] [CrossRef] [PubMed]
- Gameiro, A.; Almeida, F.; Nascimento, C.; Correia, J. Tyrosine Kinase Inhibitors Are Promising Therapeutic Tools for Cats with HER2-Positive Mammary Carcinoma. Pharmaceutics 2021, 13, 346. [Google Scholar] [CrossRef]
- Bonkobara, M. Dysregulation of tyrosine kinases and use of imatinib in small animal practice. Vet. J. 2015, 205, 180–188. [Google Scholar] [CrossRef] [Green Version]
- Henson, E.S.; Hu, X.; Gibson, S.B. Herceptin sensitizes ErbB2-overexpressing cells to apoptosis by reducing antiapoptotic Mcl-1 expression. Clin. Cancer Res. 2006, 12, 845–853. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mohsin, S.K.; Weiss, H.L.; Gutierrez, M.C.; Chamness, G.C.; Schiff, R.; DiGiovanna, M.P.; Wang, C.X.; Hilsenbeck, S.G.; Osborne, C.K.; Allred, D.C.; et al. Neoadjuvant trastuzumab induces apoptosis in primary breast cancers. J. Clin. Oncol. 2005, 23, 2460–2468. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Chen, J.; Weng, Z.; Li, Q.; Zhao, L.; Yu, N.; Deng, L.; Xu, W.; Yang, Y.; Zhu, Z.; et al. A new anti-HER2 antibody that enhances the anti-tumor efficacy of trastuzumab and pertuzumab with a distinct mechanism of action. Mol. Immunol. 2020, 119, 48–58. [Google Scholar] [CrossRef] [PubMed]
- Hofstaedter, F.; Vollmann, A.; Diermeier, S.; Brockhoff, G.; Heckel, B. Differential impact of Cetuximab, Pertuzumab and Trastuzumab on BT474 and SK-BR-3 breast cancer cell proliferation. Cell Prolif. 2007, 49, 488–507. [Google Scholar]
- Yao, H.; He, G.; Yan, S.; Chen, C.; Song, L.; Rosol, T.J.; Deng, X. Triple-negative breast cancer: Is there a treatment on the horizon? Oncotarget 2017, 8, 1913–1924. [Google Scholar] [CrossRef] [Green Version]
- Burguin, A.; Furrer, D.; Ouellette, G.; Jacob, S.; Diorio, C.; Durocher, F. Trastuzumab effects depend on HER2 phosphorylation in HER2-negative breast cancer cell lines. PLoS ONE 2020, 15, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Weigelt, B.; Lo, A.T.; Park, C.C.; Gray, J.W.; Bissell, M.J. HER2 signaling pathway activation and response of breast cancer cells to HER2-targeting agents is dependent strongly on the 3D microenvironment. Breast Cancer Res. Treat. 2010, 122, 35–43. [Google Scholar] [CrossRef] [Green Version]
- Diermeier-Daucher, S.; Breindl, S.; Buchholz, S.; Ortmann, O.; Brockhoff, G. Modular anti-EGFR and anti-Her2 targeting of SK-BR-3 and BT474 breast cancer cell lines in the presence of ErbB receptor-specific growth factors. Cytom. Part A 2011, 79, 684–693. [Google Scholar] [CrossRef]
- Franklin, M.C.; Carey, K.D.; Vajdos, F.F.; Leahy, D.J.; De Vos, A.M.; Sliwkowski, M.X. Insights into ErbB signaling from the structure of the ErbB2-pertuzumab complex. Cancer Cell 2004, 5, 317–328. [Google Scholar] [CrossRef] [Green Version]
- Metzger-Filho, O.; Winer, E.P.; Krop, I. Pertuzumab: Optimizing HER2 blockade. Clin. Cancer Res. 2013, 19, 5552–5556. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Agus, D.B.; Akita, R.W.; Fox, W.D.; Lewis, G.D.; Higgins, B.; Pisacane, P.I.; Lofgren, J.A.; Tindell, C.; Evans, D.P.; Maiese, K.; et al. Targeting ligand-activated ErbB2 signaling inhibits breast and prostate tumor growth. Cancer Cell 2002, 2, 127–137. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Ma, M.; Yang, X.; Zhang, M.; Luo, J.; Zhou, H.; Huang, N.; Xiao, F.; Lai, B.; Lv, W.; et al. Circular HER2 RNA positive triple negative breast cancer is sensitive to Pertuzumab. Mol. Cancer 2020, 19, 142. [Google Scholar] [CrossRef]
- Lambert, J.M.; Chari, R.V.J. Ado-trastuzumab emtansine (T-DM1): An antibody-drug conjugate (ADC) for HER2-positive breast cancer. J. Med. Chem. 2014, 57, 6949–6964. [Google Scholar] [CrossRef] [PubMed]
- Endo, Y.; Takeda, K.; Mohan, N.; Shen, Y.; Jiang, J.; Rotstein, D.; Wu, W.J. Payload of T-DM1 binds to cell surface cytoskeleton-associated protein 5 to mediate cytotoxicity of hepatocytes. Oncotarget 2018, 9, 37200–37215. [Google Scholar] [CrossRef] [Green Version]
- Nagayama, A.; Neelima, V.; Leif, E.; Bardia, A. Novel antibody–drug conjugates for triple negative breast cancer Aiko. Ther. Adv. Med. Oncol. 2020, 12, 1–12. [Google Scholar] [CrossRef]
- Barok, M.; Tanner, M.; Köninki, K.; Isola, J. Trastuzumab-DM1 causes tumour growth inhibition by mitotic catastrophe in trastuzumab-resistant breast cancer cells in vivo. Breast Cancer Res. 2011, 13, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Januszyk, M.; Rennert, R.; Sorkin, M.; Maan, Z.; Wong, L.; Whittam, A.; Whitmore, A.; Duscher, D.; Gurtner, G. Evaluating the Effect of Cell Culture on Gene Expression in Primary Tissue Samples Using Microfluidic-Based Single Cell Transcriptional Analysis. Microarrays 2015, 4, 540–550. [Google Scholar] [CrossRef]
- Zaitseva, M.; Vollenhoven, B.J.; Rogers, P.A.W. In vitro culture significantly alters gene expression profiles and reduces differences between myometrial and fibroid smooth muscle cells. Mol. Hum. Reprod. 2006, 12, 187–207. [Google Scholar] [CrossRef] [Green Version]
- Tatara, T.; Mukohara, T.; Tanaka, R.; Shimono, Y.; Funakoshi, Y.; Imamura, Y.; Toyoda, M.; Kiyota, N.; Hirai, M.; Kakeji, Y.; et al. 3D Culture Represents Apoptosis Induced by Trastuzumab Better than 2D Monolayer Culture. Anticancer Res. 2018, 38, 2831–2839. [Google Scholar]
- Hui-Wen Lo, R.L.C. Regulation of Apoptosis by HER2 in Breast Cancer. J. Carcinog. Mutagen. 2013, 2013. [Google Scholar] [CrossRef]
- Poon, I.K.H.; Hulett, M.D.; Parish, C.R. Molecular mechanisms of late apoptotic/necrotic cell clearance. Cell Death Differ. 2010, 17, 381–397. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsang, R.Y.; Finn, R.S. Beyond trastuzumab: Novel therapeutic strategies in HER2-positive metastatic breast cancer. Br. J. Cancer 2012, 106, 6–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, T.; Yacoub, R.; Taliaferro-Smith, L.D.; Sun, S.-Y.; Graham, T.R.; Dolan, R.; Lobo, C.; Tighiouart, M.; Yang, L.; Adams, A.; et al. Combinatorial Effects of Lapatinib and Rapamycin in Triple-Negative Breast Cancer Cells. Mol. Cancer Ther. 2011, 10, 1460–1469. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Watanabe, S.; Yonesaka, K.; Tanizaki, J.; Nonagase, Y.; Takegawa, N.; Haratani, K.; Kawakami, H.; Hayashi, H.; Takeda, M.; Tsurutani, J.; et al. Targeting of the HER2/HER3 signaling axis overcomes ligand-mediated resistance to trastuzumab in HER2-positive breast cancer. Cancer Med. 2019, 8, 1258–1268. [Google Scholar] [CrossRef] [Green Version]
- Wehrman, T.S.; Raab, W.J.; Casipit, C.L.; Doyonnas, R.; Pomerantz, J.H.; Blau, H.M. A system for quantifying dynamic protein interactions defines a role for Herceptin in modulating ErbB2 interactions. Proc. Natl. Acad. Sci. USA 2006, 103, 19063–19068. [Google Scholar] [CrossRef] [Green Version]
- Lu, Y.; Zi, X.; Zhao, Y.; Mascarenhas, D.; Pollak, M. Insulin-Like Growth Factor-I Receptor Signaling and Resistance to Trastuzumab (Herceptin). J. Natl. Cancer Inst. 2001, 93, 1852–1857. [Google Scholar] [CrossRef] [Green Version]
- Agarwal, S.; Zerillo, C.; Kolmakova, J.; Christensen, J.G.; Harris, L.N.; Rimm, D.L.; Digiovanna, M.P.; Stern, D.F. Association of constitutively activated hepatocyte growth factor receptor (Met) with resistance to a dual EGFR/Her2 inhibitor in non-small-cell lung cancer cells. Br. J. Cancer 2009, 100, 941–949. [Google Scholar] [CrossRef]
- Nagata, Y.; Lan, K.H.; Zhou, X.; Tan, M.; Esteva, F.J.; Sahin, A.A.; Klos, K.S.; Li, P.; Monia, B.P.; Nguyen, N.T.; et al. PTEN activation contributes to tumor inhibition by trastuzumab, and loss of PTEN predicts trastuzumab resistance in patients. Cancer Cell 2004, 6, 117–127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gagliato, D.D.M.; Leonardo, D.; Jardim, F.; Pereira, M.S.; Hortobagyi, G.N. Mechanisms of resistance and sensitivity to anti-HER2 therapies in HER2 + breast cancer Introduction: Pathways to Trastuzumab. Oncotarget 2016, 7, 64431. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hutcheson, I.; Barrow, D.; Hasmann, M.; Nicholson, R. Induction of erbB3/EGFR heterodimers mediates resistance to pertuzumab in a tamoxifen-resistant MCF-7 breast cancer cell line. In Proceedings of the AACR-NCI-EORTC International Conference, San Francisco, CA, USA, 22–26 October 2007. [Google Scholar]
- Stanley, A.; Ashrafi, G.H.; Seddon, A.M.; Modjtahedi, H. Synergistic effects of various Her inhibitors in combination with IGF-1R, C-MET and Src targeting agents in breast cancer cell lines. Sci. Rep. 2017, 7, 3964. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.Q.; Zhang, Y.; Li, N.; Liu, P.J.; Gao, L.; Gao, X.; Tie, X.J. Efficacy and safety of lapatinib and trastuzumab for HER2-positive breast cancer: A systematic review and meta-analysis of randomised controlled trials. BMJ Open 2017, 7, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scaltriti, M.; Verma, C.; Guzman, M.; Jimenez, J.; Parra, J.L.; Pedersen, K.; Smith, D.J.; Landolfi, S.; y Cajal, S.R.; Arribas, J.; et al. Lapatinib, a HER2 tyrosine kinase inhibitor, induces stabilization and accumulation of HER2 and potentiates trastuzumab-dependent cell cytotoxicity. Oncogene 2009, 28, 803–814. [Google Scholar] [CrossRef] [Green Version]
- Blackwell, K.L.; Zaman, K.; Qin, S.; Tkaczuk, K.H.R.; Campone, M.; Hunt, D.; Bryce, R.; Goldstein, L.J. Neratinib in Combination with Trastuzumab for the Treatment of Patients with Advanced HER2-positive Breast Cancer: A Phase I/II Study. Clin. Breast Cancer 2019, 19, 97–104.e4. [Google Scholar] [CrossRef]
- Mishra, R.; Hanker, A.B.; Garrett, J.T. Genomic alterations of ERBB receptors in cancer: Clinical implications. Oncotarget 2017, 8, 114371–114392. [Google Scholar] [CrossRef] [Green Version]
- Rajasekaran, R.; Doss, C.G.P.; Sudandiradoss, C.; Ramanathan, K.; Purohit, R.; Sethumadhavan, R. Effect of deleterious nsSNP on the HER2 receptor based on stability and binding affinity with herceptin: A computational approach. Comptes Rendus Biol. 2008, 331, 409–417. [Google Scholar] [CrossRef]
- Hyman, D.M.; Piha, S.A.-P.; Won, H.; Rodon, J.; Saura, C.; Shapiro, G.I.; Juric, D.; Quinn, D.I.; Moreno, V.; Doger, B.; et al. HER kinase inhibition in patients with HER2-and HER3-mutant cancers. Nature 2018, 554, 189–194. [Google Scholar] [CrossRef]
- Connell, C.M.; Doherty, G.J. Activating HER2 mutations as emerging targets in multiple solid cancers. ESMO Open 2017, 2, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Drug Concentrations for the Cytotoxicity Assays (µg/mL) | ||
---|---|---|
Trastuzumab | Pertuzumab | T-DM1 |
25 | 50 | 5 |
50 | 100 | 12.5 |
125 | 250 | 25 |
250 | 500 | 50 |
500 | 1000 | 100 |
1000 | 2000 | 200 |
2000 | 5000 | 500 |
5000 | 10,000 | 1000 |
10,000 |
Drug Concentrations for the Combined Treatments (µg/mL) | ||
---|---|---|
Trastuzumab | Pertuzumab | Lapatinib |
125 | 250 | 0.453 |
500 | 2000 | 7.26 |
Score | Interpretation |
---|---|
0 | No staining |
1+ | Weak, incomplete membrane staining |
2+ | Complete membrane staining, with obvious circumferential distribution in at least 10% of cells, that has either no uniform or is weak in intensity |
3+ | Uniform and intense membrane staining, at a minimum of 10% of the tumor cells |
Breed | Number (%) | Age | Number (%) |
Indeterminate | 33 (82.5%) | <8 years old | 3 (7.5%) |
Siamese | 4 (10%) | ≥8 years old | 37 (92.5%) |
Persian | 2 (5%) | Tumor Size | |
Norwegian Forest | 1 (2.5%) | <2 cm | 9 (22.5%) |
Spayed (One Unknown) | 2–3 cm | 19 (47.5%) | |
Yes | 19 (47.5%) | >3 cm | 12 (30%) |
No | 20 (50%) | HP * Classification | |
Contraceptives (Seven Unknown) | Tubulopapillary carcinoma | 8 (20%) | |
Yes | 23 (57.5%) | Solid carcinoma | 9 (22.5%) |
No | 10 (25%) | Cribiform carcinoma | 5 (12.5%) |
Treatment | Mucinous carcinoma | 5 (12.5%) | |
Mastectomy | 36 (90%) | Tubular carcinoma | 11 (27.5%) |
Mastectomy+Chemo | 4 (10%) | Papillary-cystic carcinoma | 2 (5%) |
Multiple Tumors | HP * Malignancy Grade | ||
Yes | 31 (77.5%) | I | 2 (5%) |
No | 9 (22.5%) | II | 5 (12.5%) |
Regional Lymph Node Status (Two Unknown) | III | 33 (82.5%) | |
Positive | 14 (35%) | Tumor Necrosis | |
Negative | 24 (60%) | Yes | 29 (72.5%) |
Stage (TNM Classification) | No | 11 (27.5%) | |
I | 9 (22.5%) | Lymphatic Invasion | |
II | 7 (17.5%) | Yes | 5 (12.5%) |
III | 21 (52.5%) | No | 35 (87.5%) |
IV | 3 (7.5%) | Lymphocytic Infiltration | |
Mammary Location | Yes | 27 (67.5%) | |
M1 | 11 (27.5%) | No | 13 (32.5%) |
M2 | 8 (20%) | Tumor Ulceration | |
M3 | 14 (35%) | Yes | 3 (7.5%) |
M4 | 11 (27.5%) | No | 37 (92.5%) |
fHER2 Status | Ki67 Index | ||
Positive | 12 (30%) | Low (<14%) | 30 (75%) |
Negative | 28 (70%) | High (≥14%) | 10 (25%) |
ER Status | PR Status | ||
Positive | 12 (30%) | Positive | 20 (50%) |
Negative | 28 (70%) | Negative | 20 (50%) |
Tumor Molecular Subtype | |||
Luminal A | 3 (7.5%) | ||
Luminal B | 18 (45%) | ||
Luminal B/HER2-positive | 8 (20%) | ||
HER2-positive | 4 (10%) | ||
Triple-negative | 7 (17.5%) |
Exons | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|
3 | GGCGCTTGCTCATAGTTCAC | ATCAAACTGTGCAGGCTCGT |
4 | GAGGCCTGCTCCCCTCTAAA | AAGAGGGAATGGGTAGCGTT |
10–11 | GGGCTTGGGCTTTGAAACTC | TGAAGGGTCAGCGAGTAAGC |
12–13(1st pair) | TGGGAGTTTTCGGAGTGTGC | AAGCCTGACAGAAGGGATGG |
12–13 (2nd pair) | GTGCTTACTCGCTGACCCTTCA | ACCCCTGCAATACTCGGCATTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gameiro, A.; Nascimento, C.; Correia, J.; Ferreira, F. HER2-Targeted Immunotherapy and Combined Protocols Showed Promising Antiproliferative Effects in Feline Mammary Carcinoma Cell-Based Models. Cancers 2021, 13, 2007. https://doi.org/10.3390/cancers13092007
Gameiro A, Nascimento C, Correia J, Ferreira F. HER2-Targeted Immunotherapy and Combined Protocols Showed Promising Antiproliferative Effects in Feline Mammary Carcinoma Cell-Based Models. Cancers. 2021; 13(9):2007. https://doi.org/10.3390/cancers13092007
Chicago/Turabian StyleGameiro, Andreia, Catarina Nascimento, Jorge Correia, and Fernando Ferreira. 2021. "HER2-Targeted Immunotherapy and Combined Protocols Showed Promising Antiproliferative Effects in Feline Mammary Carcinoma Cell-Based Models" Cancers 13, no. 9: 2007. https://doi.org/10.3390/cancers13092007