1. Introduction
High-grade serous ovarian cancer (HGSOC) is the most common ovarian cancer and is the leading cause of death from gynecologic cancers [
1]. Most patients are diagnosed at the advanced stage and tend to develop a recurrence following standard clinical treatment in two years. The 5-year survival is < 40% and has not improved significantly over the last 30 years [
2]. Furthermore, no novel biomarker has been approved for the screening, diagnosis, or monitoring of HGSOC in over two decades [
3]. Therefore, a better understanding of HGSOC-specific molecular oncogenic mechanisms will provide information for improving the diagnosis and treatment of HGSOC.
It was proven that aberrant DNA methylation is a characteristic of various tumor types and serves as reliable earliest biomarkers in carcinogenesis [
4,
5]. As a common epigenetic modification mechanism in cancer, DNA methylation is a crucial regulator of gene transcription [
6]. Aberrant DNA methylation alters gene expression and function, resulting in genome-wide abnormalities by interfering with the binding of transcription factors to the recognition position of gene promoters. It is generally believed that the hypermethylation of the tumor suppressor gene promoters inhibits corresponding gene expression and that hypomethylation of protooncogene promoter regions promotes corresponding gene expression. The DNA methylation of tumor suppressor genes and protooncogenes plays a role in the occurrence and progression of various tumor types [
7,
8]. These changes often occur before tumor formation or development, so identifying methylation-regulated differentially expressed genes (MeDEGs) based on high-throughput data has been considered to be of notable significance and can be considered biomarkers for the early diagnosis of tumors or predictors of high-risk cancer patients.
To our knowledge, limited studies have been performed regarding the cumulative analysis for MeDEGs of ovarian cancer using an array of data from multiple platforms. In the present study, we performed an analysis based on four gene expression profiling datasets (GSE69428, GSE18520, GSE54388, and GSE27651) and a gene methylation profiling dataset (GSE133556). We achieved 47 hub genes of MeDEGs by the Protein–Protein Interaction (PPI) network analysis and then performed the GO and KEGG analysis of these hub genes. We found that UBE2C was ranked not only top 13 in the hub genes but is also one of the most enriched pathways (cell cycle).
Ubiquitin-conjugating enzyme E2 C (UBE2C), as a member of the E2 ubiquitin-conjugating enzyme family, participates in the ubiquitination system, mitosis, and the regulation of the cell cycle by interacting with the anaphase-promoting complex/cyclostome (APC/C) [
9]. A previous study from our group demonstrated that UBE2C was highly expressed in ovarian cancer tissues and promoted ovarian cancer progression by upregulating CDK1 [
10]. Accumulating evidence has shown that UBE2C is highly expressed and acts as a proto-oncogene in various types of human cancers, such as breast cancer [
11], lung cancer [
12], esophageal cancer [
13], colon cancer [
14], and thyroid cancer [
15]. However, the role of the UBE2C gene and the associated molecular mechanisms during tumorigenesis are unclear.
Here, we further investigate the expression of UBE2C, its relationship with prognosis, and DNA methylation in pan-cancers. Importantly, we want to verify the increased expression of UBE2C using clinical HGSOC clinical samples and ovarian cell lines. Additionally, we also tested the DNA methylation level of UBE2C in ovarian cell lines by bisulfite sequencing PCR and investigated the relationship between UBE2C expression and DNA methylation using DNA methylation inhibitor 5-Azacytidine. Furthermore, we obtained two UBE2C-related genes, CDC20 and MAD2L1, by determining the overlap between the sets of interacting proteins and coexpressed genes. As a result, the current data support an oncogenic function of UBE2C in pan-cancer tumorigenesis and may offer a new prognostic biomarker or therapeutic target for future development.
2. Materials and Methods
2.1. Microarray Data Information
The primary data from the DNA methylation profiling dataset GSE133556 (Infinium MethylationEPIC, based on GPL21145 platform) were downloaded from the Gene Expression Omnibus (
https://www.ncbi.nlm.nih.gov/geo/; accessed 7 April 2020; GEO), which contained 99 HGSOC samples and 12 normal controls. The gene expression profiling datasets (GSE69428, GSE18520, GSE54388, and GSE27651; Affymetrix Human Genome U133 Plus 2.0 Array dataset, based on the GPL570 platform) were also acquired from the GEO database. The GSE69428 dataset included ten HGSOC samples and ten matched nontumor tissues; the GSE18520 dataset comprised 53 HGSOC samples and ten normal tissues; the GSE54388 dataset consisted of 16 HGSOC samples and six normal tissues; the GSE27651 dataset contained 22 HGSOC samples and six normal tissues.
2.2. Data Processing for Identification of DEGs, DMGs, and MeDEGs
First, the ChAMP package was used to read, filter, and standardize the original data from the GSE133556 methylation profile. During the filtering process, the following probes were sequentially removed: probes for non-CpG sites, all SNP-related probes, multihit probes, and X and Y chromosomes probes. Afterward, differentially methylated sites between the HGSOC group and the control group were selected according to the corrected p-value < 0.01. Subsequently, the DMGs were obtained by annotating the differentially methylated sites using the EPIC chip.
The differential expression between the HGSOC group and the control group from the chip expression data was analyzed using the limma package. Before the expression differences were examined, the probes were annotated; for cases where multiple probes corresponded to the same gene, the average value of multiple probes was taken as the expression level of the gene. The primary expression profile data were log2 transformed and normalized to obtain the Series Matrix File. The screening threshold for a significant difference in gene expression was a p-value < 0.05 and |log2Fold Change| > 0.585 (that is, a Fold Change >1.5 or a Fold Change < 1/1.5). Then, the genes that were significantly differentially expressed, either all upregulated or downregulated, in at least three expression datasets were selected as the final DEGs.
Finally, the intersection of the above-obtained hypermethylated genes and down-regulated genes and the overlap of hypomethylated genes and upregulated genes were examined to identify the MeDEGs.
2.3. Gene Ontology (GO) and Pathway Enrichment Analysis
Gene Ontology (GO) annotation and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of all the MeDEGs and the hub genes were performed with the clusterprofile package. KEGG pathway analysis was performed to explore the involvement of MeDEGs or the hub genes in biological pathways. GO analysis was used to determine the relevant pathways in cellular components, biological processes, and specific molecular functions related to the MeDEGs or the hub genes. The pathview package was used to visualize the enrichment of MeDEGs on the KEGG pathways.
2.4. Protein-Protein Interaction (PPI) Network Construction and Module Analysis
The STRING (
https://www.string-db.org/; accessed 20 June 2020) database was utilized to analyze the PPI of the MeDEGs at the highest confidence level of protein–protein interaction (combined score > 0.9). The hub genes in the PPI network, as well as the hub genes network, were identified by the Molecular Complex Detection (MCODE) plug-in and cytoHubba plug-ins.
2.5. Validation of the Screen Genes
Gene Expression Profiling Interactive Analysis (
http://gepia2.cancer-pku.cn/; accessed 11 June 2021; GEPIA2.0) is an easy-to-use web tool that shows the gene expression based on the source of the Cancer Genome Atlas (TCGA) database. The single-gene expression level of the top 15 hub genes in ovarian cancer was examined via the GEPIA2.0. A fold change of >2 and a
p value of < 0.01 were considered statistically significant.
Oncomine (
http://oncomine.org/; accessed 11 June 2021) is a web-based data-mining platform that allows the analysis of differential gene expression for a majority of cancer types compared with respective normal tissues [
16]. In the current study, the expression levels of the hub genes in ovarian cancer tumor tissues and normal tissues were verified using this platform.
2.6. Gene Expression Analysis
Using the Oncomine platform, the expression level of UBE2C in tumor tissues and healthy tissues was visualized. Then, UBE2C was evaluated with the “Gene_DE” module of the Tumor Immune Estimation Resource, version 2 website (
http://timer.cistrome.org/; accessed 20 June 2021; TIMER2.0). The differences in the expression of UBE2C between the tumor tissues and the normal controls were analyzed for a variety of tumors and tumor subtypes from the TCGA. The GEPIA2.0 was utilized to generate box plots of the differences in expression between tumor tissues and the relevant normal tissues for the tumors without normal controls or highly limited normal tissues in TIMER2.0. A P value cutoff = 0.01, log2FC (Fold change) cutoff = 1, and “Match TCGA normal and GTEx data” were set. Violin plots of UBE2C expression were generated using the “Pathological Stage Plot” module of the GEPIA2.0 to show the relationship between UBE2C expression and the pathological stages (stage I, stage II, stage III, and stage IV) of all tumor types of TCGA database.
The Human Protein Atlas (
https://www.proteinatlas.org/; accessed 15 June 2021; HPA) is a valuable tool for researchers studying protein localization and expression in human tissues and cells. We obtained the mRNA level of UBE2C in single-cell types with the “Cell type atlas” module. Meanwhile, we obtained the immunohistochemistry (IHC) staining of UBE2C in different types of tumor tissues and normal tissues of different tumor types by using the “Pathology Atlas” module and “Tissue Atlas” module, respectively. UBE2C expression in different tissues was quantitatively analyzed based on the degree of staining, staining intensity, and staining quantity provided by the HPA.
The UALCAN portal (
http://ualcan.path.uab.edu/analysis-prot.html; accessed 23 June 2021) is a user-friendly web resource for analyzing cancer OMICS data, including the protein expression analysis based on the Clinical Proteomic Tumor Analysis Consortium (CPTAC) dataset [
17]. In this study, we performed a protein expression analysis of UBE2C. All of the tumor types provided by the dataset were included. A
p-value < 0.01 was regarded as statistically significant.
2.7. Survival Prognosis Analysis
The “Survival Map” module of the GEPIA2.0 was utilized to achieve the OS (overall survival) and RFS (disease-free survival) significance map data of UBE2C for all the tumor types of the TCGA database. The cut-off value for defining high and low was set at 50%, and the significant level was considered to be 0.05. The “survival analysis” module was also used to generate survival plots.
The Kaplan–Meier plotter (
http://kmplot.com/analysis/; accessed 17 June 2021) was used to perform a survival analysis of the UBE2C expression for breast cancer, ovarian cancer, lung cancer, and gastric cancer. A
p-value < 0.05 was regarded as statistically significant.
2.8. DNA Methylation Analysis of UBE2C
DNMIVD (at
http://www.unimd.org/dnmivd/; accessed 21 June 2021) is a comprehensive annotation and interactive visualization database for DNA methylation profiles of diverse human cancers that draws on TCGA and GEO databases [
18]. We searched for “UBE2C” in the “Quick Search” to obtain the methylation levels of the UBE2C promoter for specific cancers. The relationship between the methylation level and the expression level of UBE2C was displayed in the “Meth-Exp correlation” module. In the “survival” module, we performed the survival analysis based on the methylation level of UBE2C, using median DNA methylation beta values as a threshold to divide samples into high and low groups. The feature importance bar plot and the heatmap of the DNA methylation profile were generated in the diagnostic module.
2.9. UBE2C-Related Gene Enrichment Analysis
To obtain the top 100 similar genes correlated with UBE2C, we used the “Similar Genes Detection” module of the GEPIA2.0, choosing all the cancer types of the TCGA. The correlation analysis of the top 5 genes coexpressed with UBE2C was conducted via the “Correlation Analysis” of the GEPIA2.0, including all the cancer types from TCGA. A p-value < 0.01 was regarded as statistically significant. Subsequently, using the “Gene_Corr” module of “Exploration” in TIMER2.0, the correlations of UBE2C and the top 5 coexpressed genes were determined.
We searched the STRING website using “UBE2C” as a single protein and “Homo sapiens” as an organism. The proteins that can bind with UBE2C were obtained by setting the “Experiments” to active interaction sources, “low confidence (0.150)” as the minimum required interaction score, and “no more than 50 interactors” as the maximum number of interactors to display. The top 100 coexpressed genes from GEPIA2.0 and the 50 proteins that interacted with UBE2C from STRING were superimposed.
The Pathway Commons Network Visualizer (
http://www.pathwacommons.org/pcviz/; accessed 26 June 2021; PCViz), a concise and efficient website, was used to perform the bioinformatics network analyses to describe the PPI. GO analysis and KEGG pathway analysis were conducted with OmicsBean (
http://omicsbean.eicp.net:47349/; accessed 26 June 2021) software.
2.10. Quantitative Real-Time PCR (qRT-PCR)
The total RNA from ovarian cancer cell lines and tissues was extracted using Total RNA Extraction Reagent (Vazyme, Nanjing, China). The RNA was reverse-transcribed into complementary DNA using a ReverTra Ace qPCR RT Master Mix (TOYOBO, Shanghai, China). qRT-PCR was performed using SYBR Green Master Mix (Yeasen, Shanghai, China). GAPDH was used as an internal standard. The primers used in these studies were: UBE2C (forward: 5′ -GACCTGAGGTATAAGCTCTCGC- 3′, reverse: 5′- TTACCCTGGGTGTCCACGTT -3′) and GAPDH (forward: 5′- GGAGCGAGATCCCTCCAAAAT -3′, reverse: 5′-GGCTGTTGTCATACTTCTCATGG -3′).
2.11. Bisulfite Sequencing (BS) PCR
The next-generation sequencing-based BSP was performed to examine the gene DNA methylation following the previously reported method [
19]. In brief, genomic DNA was extracted from ovarian cancer cells using the QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany). Bisulfite sequencing (BS) was utilized to determine the DNA methylation status of the CpG islands of the promoter region of UBE2C. The bisulfite conversion of genomic DNA was performed using the ZYMO EZ DNA Methylation-Gold Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions. BSP primers of UBE2C were designed using the online MethPrimer software (
http://www.urogene.org/methprimer/; accessed 25 June 2021) and listed in
Table S1. Bisulfite-treated genomic DNA was used to amplify the CpG islands of the UBE2C promoter, which contains 47 CpG sites, using KAPA HiFi HotStart Uracil+ ReadyMix PCR Kit (Kapa Biosystems, Wilmington, MA, USA). Amplified PCR products were pooled in equal volumes, 5’-phosphorylated, 3’-dA-tailed, and ligated to a barcoded adapter using T4 DNA ligase (NEB). The barcoded libraries were sequenced on an Illumina platform.
2.12. Western Blot
The proteins in the tissues and cells were isolated using RIPA lysis buffer containing phenylmethylsulfonyl fluoride and protease inhibitor cocktail. The proteins were separated by SDS-PAGE and transferred to PVDF membranes before blocking with 5% milk. The membranes were incubated with primary antibody overnight at 4 °C and secondary antibody for 1 h at room temperature. Chemiluminescence was detected on a Tanon-5500 Imaging System (Tanon Science & Technology Ltd., Tanon, Shanghai, China). The primary antibodies used were rabbit polyclonal anti-UBE2C (ab252940, Abcam, Cambridge, MA, USA), mouse polyclonal anti-GAPDH (10494-1-AP, Proteintech, Wuhan, China), and rabbit polyclonal anti-tubulin (11224-1-AP, Proteintech, Wuhan, China).
2.13. RNA Interference
A2780 or SKOV3 cells were plated in six-well plates and transfected with five μM UBE2C siRNA (GenePharma, Shanghai, China) or control siRNA (GenePharma, Shanghai, China) using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). After 48 h, the mRNA and proteins in A2780 or SKOV3 cells were collected for validation. A knockdown efficiency above 80% was considered successful. The UBE2C-homo466: GGACCAUUCUGCUCUCCAUTT, AUGGAGAGCAGAAUGGUCCTT; UBE2C-homo505: CCAACA
UUGAUAGUCCCUUTT, AAGGGACUAUCAAUGUUGGTT; UBE2C-homo212: GUCU
GGCGAUAAAGGGAUUTT, AAUCCCUUUAUCGCCAGACTT.
2.14. Immunohistochemistry (IHC)
All samples, including 25 HGSOC tissues and 12 normal ovarian specimens, were obtained from the Obstetrics & Gynecology Hospital of Fudan University. Our study was approved by the institute’s Ethics Committee. The specimens were paraffin-embedded and sliced into 4 μm sections. The slides were heated for 1 h at 65 °C, deparaffinized in xylene for 40 min, and rehydrated through a series of graded ethanol solutions (100%, 95%, 80%, and 70%, each for 10 min). After incubation with 1% Triton and 3% hydrogen peroxide each for 10 min, Improved Antigen Retrieval Buffer (50 × Citrate Sodium Buffer, pH 6.0) (Yeasen, Shanghai, China) was used for antigen retrieval at 95 °C according to the instructions. After the slides were blocked with 5% donkey serum at room temperature for one hour, they were incubated with the primary antibody against human UBE2C (ab252940, Abcam, Cambridge, MA, USA) overnight at 4 °C. Following incubation with the secondary antibody at room temperature for one hour, the DAB Horseradish Peroxidase Color Development Kit (Beyotime Biotechnology, Shanghai, China) was used to detect the antibody binding according to the instructions before counterstaining with hematoxylin (Beyotime Biotechnology, Shanghai, China)and dehydration were performed. At least three fields, mainly containing cancer cells in each slide, were selected randomly for quantitative analysis. The score was calculated as the average staining intensity of all the selected cancer cells in each field. The evaluation of the protein expression was based on the staining score: (a) the percentage of positive cells in the tissue: 0 (0%), 1 (1–10%), 2 (11–50%), 3 (51–70%), or 4 (71–100%); (b) the staining intensity: 0 (none), 1 (weak), 2 (moderate), or 3 (strong). The staining score = (a) × (b).
2.15. Transwell Migration Assay
A total of 1 × 105 A2780 or SKOV3 cells were seeded in the upper chamber of a 24-well transwell chamber with an 8 μm pore polycarbonate membrane (Corning, Corning, NY, USA), and a double-serum medium was added to the lower chamber. After incubation for 24 h, the migrated cells on the lower chamber membrane surface were fixed with 4% paraformaldehyde (Solarbio, Beijing, China) for 10 min at room temperature. Then, the chamber was stained with 0.1% crystal violet (KeyGEN Biotech, Nanjing, China) for 30 min at room temperature. After the cells in the upper chamber were removed, images of the stained cells were acquired under an optical microscope. The migrated cells (crystal violet-stained cells) were counted in five random fields per well.
2.16. Statistical Analysis
All of the data were presented as mean ± S.D. The Student’s t-test was used to evaluate the differences between the two groups. GraphPad Prism Software was used to analyze all data. A p < 0.05 was considered statistically significant.
4. Discussion
Altered methylation has been reported to be an early and prevalent event in cancer development, and was widely recognized as an essential cancer-related biomarker and potential therapeutic target [
20]. Therefore, the identification and analysis of methylation-regulated differentially expressed genes (MeDEGs) will be of great significance. Most previous studies have demonstrated that methylation in the promoter region tends to inhibit gene expression, while hypomethylation promotes gene expression [
19,
21]. Here, we identified 1113 MeDEGs by analyzing gene expression profiling datasets (GSE69428, GSE18520, GSE54388, and GSE27651) and gene methylation profiling dataset (GSE133556) of HGSOC tissues extracted from the GEO database. By analyzing the PPI network of these MeDEGs, we identified the hub genes, most of which were significantly upregulated and thus merit further study.
Among these 47 hub genes, ubiquitin-conjugating enzyme 2C (UBE2C) is a gene that we have previously reported. UBE2C was significantly upregulated in ovarian cancer, and downregulation of UBE2C inhibited cell proliferation, promoted cell apoptosis, induced G2/M cycle arrest, and reversed cisplatin resistance in vivo and in vitro experiments [
10]. Meantime, overexpression of UBE2C has been demonstrated in various human malignancies, such as breast carcinoma, lung cancer, gastric cancer, etc [
11,
12,
13,
14]. Recently, there was an article on the bioinformatics analysis of UBE2C in pan-cancer [
22]. Still, this article did not conduct a comprehensive and intensive analysis of UBE2C, only reporting the expression of UBE2C and its relationship with cancer stage and prognosis, as well as coexpressed genes in different cancers. The molecular mechanism underlying increased UBE2C gene expression in cancers is unclear and the relevant findings were not validated by experiments. Therefore, we conducted an integral analysis of the pan-cancer role of UBE2C with a variety of multibioinformatics tools, especially DNA methylation analysis. In accordance with previous studies, a global analysis of UBE2C expression found that upregulation of UBE2C was a common feature in human cancers and predicted invasive progression. Importantly, the overexpression of UBE2C was correlated with poor prognosis in a wide array of human cancers. Consistent with the above results, we verified that UBE2C was highly expressed in clinical HGSOC specimens and ovarian cell lines with Western blot analysis, qRT–PCR, and IHC. In addition, we found that downregulation of UBE2C could reduce ovarian cancer cell migration.
UBE2C plays a key role in the regulation of the cell cycle by partnering with APC/C to degrade mitotic cyclins. Surprisingly, our data confirmed that the genes that interacted or were coexpressed with UBE2C were mainly enriched in the regulation of the cell cycle, as well as oocyte maturation and meiosis, ubiquitin-mediated proteolysis, and DNA replication. This was consistent with our prior report showing cell cycle arrest in ovarian cancer cells by UBE2C downregulation [
10].
Furthermore, by determining the overlap between the sets of interacting proteins and genes coexpressed with UBE2C, we identified two molecules: CDC20 and MAD2L1. Notably, as an activator of APC/C during mitosis, CDC20 is an important regulator of the cell cycle and plays a role in cancer emergence and development [
23]. Consistent with the literature, CDC20 was coexpressed with UBE2C in human clear cell renal cell carcinoma [
24]. MAD2L1 is a vital component of the spindle assembly checkpoint and tends to be overexpressed in many cancer types [
25,
26,
27]. It can therefore be assumed that the two molecules might be able to explain the involvement of UBE2C with cancer progression and invasion.
The relationship between DNA hypomethylation and the mRNA overexpression of UBE2C, as well as the prognostic value of UBE2C hypomethylation, have previously been reported in a genome-wide study of CpG methylation in breast cancer samples [
28]. Another genome-wide DNA methylation analysis in nonalcoholic steatohepatitis-related hepatocellular carcinomas found both hypomethylation of UBE2C promoters and UBE2C upregulation in hepatocellular carcinomas [
29]. Recently, bioinformatics analyses have also discovered a UBE2C overexpression-hypomethylation correlation in hepatocellular carcinoma [
30,
31]. In agreement with the previous studies, our data found significant DNA hypomethylation of UBE2C in CHOL, KIRC, and PCPG tumor tissues and a negative correlation between the methylation levels of UBE2C and its expression levels in multiple cancer types. In addition, the hypermethylation level of UBE2C in cancers was associated with better follow-up survival in KIRC and KIPR. Importantly, our cell experiments also showed that the inhibition of DNA methylation upregulated the expression of UBE2C in ovarian cancer. Therefore, these results supported the potential functional effects of DNA hypomethylation on UBE2C upregulation in tumors. Hypomethylated UBE2C might serve as a potential new pan-cancer biomarker for the prognosis and diagnosis of various types of cancers. Therefore, we established a risk or prognosis model related to UBE2C methylation sites and identified three sites according to their importance score (cg03969725, cg02838589, and cg00242976).
However, there are still some limitations to this study. First, the MeDEGs were obtained by the bioinformatics analysis of the HGSOC gene methylation profiling dataset and gene expression profiling datasets from the GEO database. Second, we only verified that inhibiting DNA methylation increases the gene expression of UBE2C in ovarian cancer, ignoring other cancer types. Thus, further studies are necessary to elucidate exactly how DNA methylation regulates UBE2C expression in cancers.
In conclusion, we conducted a series of analyses on four gene expression profiling datasets and a gene methylation profiling dataset for HGSOC tissues and identified differentially expressed genes regulated by methylation. According to the identification of hub genes from the PPI network, we selected UBE2C for further bioinformatics analysis. Our pan-cancer analysis of UBE2C was the first to identify that the expression of UBE2C was consistently higher in almost all cancer types and that it was associated with cancer stage, clinical prognosis, and DNA methylation. Next, we established a risk or prognosis model related to UBE2C methylation sites and screened out the three sites. Finally, we verified the expression and role of UBE2C in HGSOC tissues with clinical specimens and cell functional experiments. Importantly, inhibiting DNA methylation was able to restore the expression of UBE2C in ovarian cancer. This finding, while preliminary, may help us to understand the underlying molecular mechanism of UBE2C in pan-cancer tumorigenesis, and UBE2C might be a diagnostic biomarker and a therapeutic target across many cancers.