27-Hydroxycholesterol Binds GPER and Induces Progression of Estrogen Receptor-Negative Breast Cancer
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Clones Selection
2.2. Proliferation and Viability Quantitation
2.3. Western Blot Analysis
2.4. RNA Extraction, Reverse Transcription and Real-Time PCR
2.5. GPER Competitive Binding Assay
2.6. Mammosphere Formation Assay
2.7. Mouse Studies
2.7.1. Ethics Statement
2.7.2. Orthotopic Breast Tumor Xenograft Model
2.8. Histopathological Analysis and Staining
2.9. Conditioned Medium
2.10. Tube Formation Assay
2.11. Statistical Analysis
3. Results
3.1. TNBC Cells Convert Cholesterol to 27HC to Increase Tumor Growth
3.2. 27HC Binds to GPR30 and Mediates ERK1/2 and NFκB Activation to Increase Tumor Proliferation




3.3. 27HC Increases Cell Migration
3.4. 27HC Requires GPER to Induce Tumor Angiogenesis


4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sørlie, T.; Perou, C.M.; Tibshirani, R.; Aas, T.; Geisler, S.; Johnsen, H.; Hastie, T.; Eisen, M.B.; Van De Rijn, M.; Jeffrey, S.S.; et al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc. Natl. Acad. Sci. USA 2001, 98, 10869–10874. [Google Scholar] [CrossRef]
- Bernard, P.S.; Parker, J.S.; Mullins, M.; Cheung, M.C.U.; Leung, S.; Voduc, D.; Vickery, T.; Davies, S.; Fauron, C.; He, X.; et al. Supervised risk predictor of breast cancer based on intrinsic subtypes. J. Clin. Oncol. 2009, 27, 1160–1167. [Google Scholar] [CrossRef]
- Perou, C.M.; Sørile, T.; Eisen, M.B.; Van De Rijn, M.; Jeffrey, S.S.; Ress, C.A.; Pollack, J.R.; Ross, D.T.; Johnsen, H.; Akslen, L.A.; et al. Molecular portraits of human breast tumours. Nature 2000, 406, 747–752. [Google Scholar] [CrossRef] [PubMed]
- Rotheneder, M.; Kostner, G.M. Effects of low- and high-density lipoproteins on the proliferation of human breast cancer cells In vitro: Differences between hormone-dependent and hormone-independent cell lines. Int. J. Cancer 1989, 43, 875–879. [Google Scholar] [CrossRef] [PubMed]
- Pussinen, P.J.; Karten, B.; Wintersperger, A.; Reicher, H.; McLean, M.; Malle, E.; Sattler, W. The human breast carcinoma cell line HBL-100 acquires exogenous cholesterol from high-density lipoprotein via CLA-1 (CD-36 and LIMPII analogous 1)-mediated selective cholesteryl ester uptake. Biochem. J. 2000, 349, 559–566. [Google Scholar] [CrossRef]
- Antalis, C.J.; Arnold, T.; Rasool, T.; Lee, B.; Buhman, K.K.; Siddiqui, R.A. High ACAT1 expression in estrogen receptor negative basal-like breast cancer cells is associated with LDL-induced proliferation. Breast Cancer Res. Treat. 2010, 122, 661–670. [Google Scholar] [CrossRef] [PubMed]
- Gospodarowicz, D.; Lui, G.M.; Gonzalez, R. High-Density Lipoproteins and the Proliferation of Human Tumor Cells Maintained on Extracellular Matrix-coated Dishes and Exposed to Defined Medium. Cancer Res. 1982, 42, 3704–3713. [Google Scholar] [CrossRef]
- Chimento, A.; Casaburi, I.; Avena, P.; Trotta, F.; De Luca, A.; Rago, V.; Pezzi, V.; Sirianni, R. Cholesterol and Its Metabolites in Tumor Growth: Therapeutic Potential of Statins in Cancer Treatment. Front. Endocrinol. 2019, 9, 807. [Google Scholar] [CrossRef] [PubMed]
- Janowski, B.A.; Willy, P.J.; Devi, T.R.; Falck, J.R.; Mangelsdorf, D.J. An oxysterol signalling pathway mediated by the nuclear receptor LXRα. Nature 1996, 383, 728–731. [Google Scholar] [CrossRef] [PubMed]
- Janowski, B.A.; Grogan, M.J.; Jones, S.A.; Wisely, G.B.; Kliewer, S.A.; Corey, E.J.; Mangelsdorf, D.J. Structural requirements of ligands for the oxysterol liver X receptors LXRa and LXRβ. Proc. Natl. Acad. Sci. USA 1999, 96, 266–271. [Google Scholar] [CrossRef]
- DuSell, C.D.; Nelson, E.R.; Wang, X.; Abdo, J.; Mödder, U.I.; Umetani, M.; Gesty-Palmer, D.; Javitt, N.B.; Khosla, S.; McDonnell, D.P. The endogenous selective estrogen receptor modulator 27-hydroxycholesterol is a negative regulator of bone homeostasis. Endocrinology 2010, 151, 3675–3685. [Google Scholar] [CrossRef] [PubMed]
- Umetani, M.; Domoto, H.; Gormley, A.K.; Yuhanna, I.S.; Cummins, C.L.; Javitt, N.B.; Korach, K.S.; Shaul, P.W.; Mangelsdorf, D.J. 27-Hydroxycholesterol is an endogenous SERM that inhibits the cardiovascular effects of estrogen. Nat. Med. 2007, 13, 1185–1192. [Google Scholar] [CrossRef] [PubMed]
- He, S.; Nelson, E.R. 27-Hydroxycholesterol, an endogenous selective estrogen receptor modulator. Maturitas 2017, 104, 29–35. [Google Scholar] [CrossRef]
- Wu, Q.; Ishikawa, T.; Sirianni, R.; Tang, H.; McDonald, J.G.; Yuhanna, I.S.; Thompson, B.; Girard, L.; Mineo, C.; Brekken, R.A.; et al. 27-Hydroxycholesterol promotes cell-autonomous, ER-positive breast cancer growth. Cell Rep. 2013, 5, 637–645. [Google Scholar] [CrossRef]
- Nelson, E.R.; Wardell, S.E.; Jasper, J.S.; Park, S.; Suchindran, S.; Howe, M.K.; Carver, N.J.; Pillai, R.V.; Sullivan, P.M.; Sondhi, V.; et al. 27-Hydroxycholesterol links hypercholesterolemia and breast cancer pathophysiology. Science 2013, 342, 1094–1098. [Google Scholar] [CrossRef]
- Shi, S.-Z.; Lee, E.-J.; Lin, Y.-J.; Chen, L.; Zheng, H.-Y.; He, X.-Q.; Peng, J.-Y.; Noonepalle, S.K.; Shull, A.Y.; Pei, F.C.; et al. Recruitment of monocytes and epigenetic silencing of intratumoral CYP7B1 primarily contribute to the accumulation of 27-hydroxycholesterol in breast cancer. Am. J. Cancer Res. 2019, 9, 2194–2208. [Google Scholar]
- Shen, Z.; Zhu, D.; Liu, J.; Chen, J.; Liu, Y.; Hu, C.; Li, Z.; Li, Y. 27-Hydroxycholesterol induces invasion and migration of breast cancer cells by increasing MMP9 and generating EMT through activation of STAT-3. Environ. Toxicol. Pharmacol. 2017, 51, 1–8. [Google Scholar] [CrossRef]
- Kimbung, S.; Chang, C.Y.; Bendahl, P.O.; Dubois, L.; Thompson, J.W.; McDonnell, D.P.; Borgquist, S. Impact of 27-hydroxylase (CYP27A1) and 27-hydroxycholesterol in breast cancer. Endocr. Relat. Cancer 2017, 24, 339–349. [Google Scholar] [CrossRef]
- Torres-Luquis, O.; Madden, K.; N’dri, N.M.R.; Berg, R.; Olopade, O.F.; Ngwa, W.; Abuidris, D.; Mittal, S.; Lyn-Cook, B.; Mohammed, S.I. LXR/RXR pathway signaling associated with triple-negative breast cancer in African American women. Breast Cancer Targets Ther. 2019, 11, 1–12. [Google Scholar] [CrossRef]
- Zhu, D.; Shen, Z.; Liu, J.; Chen, J.; Liu, Y.; Hu, C.; Li, Z.; Li, Y. The ROS-mediated activation of STAT-3/VEGF signaling is involved in the 27-hydroxycholesterol-induced angiogenesis in human breast cancer cells. Toxicol. Lett. 2016, 264, 79–86. [Google Scholar] [CrossRef]
- Vedin, L.L.; Lewandowski, S.A.; Parini, P.; Gustafsson, J.Å.; Steffensen, K.R. The oxysterol receptor LXR inhibits proliferation of human breast cancer cells. Carcinogenesis 2009, 30, 575–579. [Google Scholar] [CrossRef] [PubMed]
- Prossnitz, E.R.; Barton, M. The G-protein-coupled estrogen receptor GPER in health and disease. Nat. Rev. Endocrinol. 2011, 7, 715–726. [Google Scholar] [CrossRef] [PubMed]
- Lappano, R.; Rosano, C.; De Marco, P.; De Francesco, E.M.; Pezzi, V.; Maggiolini, M. Estriol acts as a GPR30 antagonist in estrogen receptor-negative breast cancer cells. Mol. Cell. Endocrinol. 2010, 320, 162–170. [Google Scholar] [CrossRef] [PubMed]
- Girgert, R.; Emons, G.; Gründker, C. Inactivation of GPR30 reduces growth of triple-negative breast cancer cells: Possible application in targeted therapy. Breast Cancer Res. Treat. 2012, 134, 199–205. [Google Scholar] [CrossRef] [PubMed]
- Steiman, J.; Peralta, E.A.; Louis, S.; Kamel, O. Biology of the estrogen receptor, GPR30, in triple negative breast cancer. Am. J. Surg. 2013, 206, 698–703. [Google Scholar] [CrossRef] [PubMed]
- Yu, T.; Liu, M.; Luo, H.; Wu, C.; Tang, X.; Tang, S.; Hu, P.; Yan, Y.; Wang, Z.; Tu, G. GPER mediates enhanced cell viability and motility via non-genomic signaling induced by 17β-estradiol in triple-negative breast cancer cells. J. Steroid Biochem. Mol. Biol. 2014, 143, 392–403. [Google Scholar] [CrossRef]
- Zhou, K.; Sun, P.; Zhang, Y.; You, X.; Li, P.; Wang, T. Estrogen stimulated migration and invasion of estrogen receptor-negative breast cancer cells involves an ezrin-dependent crosstalk between G protein-coupled receptor 30 and estrogen receptor beta signaling. Steroids 2016, 111, 113–120. [Google Scholar] [CrossRef]
- Albanito, L.; Sisci, D.; Aquila, S.; Brunelli, E.; Vivacqua, A.; Madeo, A.; Lappano, R.; Pandey, D.P.; Picard, D.; Mauro, L.; et al. Epidermal growth factor induces G protein-coupled receptor 30 expression in estrogen receptor-negative breast cancer cells. Endocrinology 2008, 149, 3799–3808. [Google Scholar] [CrossRef]
- De Francesco, E.M.; Pellegrino, M.; Santolla, M.F.; Lappano, R.; Ricchio, E.; Abonante, S.; Maggiolini, M. GPER mediates activation of HIF1α/VEGF signaling by estrogens. Cancer Res. 2014, 74, 4053–4064. [Google Scholar] [CrossRef]
- Thomas, P.; Pang, Y.; Filardo, E.J.; Dong, J. Identity of an estrogen membrane receptor coupled to a G protein in human breast cancer cells. Endocrinology 2005, 146, 624–632. [Google Scholar] [CrossRef]
- Trotta, F.; Avena, P.; Chimento, A.; Rago, V.; De Luca, A.; Sculco, S.; Nocito, M.C.; Malivindi, R.; Fallo, F.; Pezzani, R.; et al. Statins Reduce Intratumor Cholesterol Affecting Adrenocortical Cancer Growth. Mol. Cancer Ther. 2020, 19, 1909–1921. [Google Scholar] [CrossRef]
- Andrews, N.C.; Faller, D.V. A rapid micrqpreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res. 1991, 19, 2499. [Google Scholar] [CrossRef] [PubMed]
- De Luca, A.; Fiorillo, M.; Peiris-Pagès, M.; Ozsvari, B.; Smith, D.L.; Sanchez-Alvarez, R.; Martinez-Outschoorn, U.E.; Cappello, A.R.; Pezzi, V.; Lisanti, M.P.; et al. Mitochondrial biogenesis is required for the anchorage-independent survival and propagation of stem-like cancer cells. Oncotarget 2015, 6, 14777. [Google Scholar] [CrossRef]
- Chajès, V.; Mahon, M.; Kostner, G.M. Influence of LDL oxidation on the proliferation of human breast cancer cells. Free Radic. Biol. Med. 1996, 20, 113–120. [Google Scholar] [CrossRef]
- Hutchinson, S.A.; Lianto, P.; Roberg-Larsen, H.; Battaglia, S.; Hughes, T.A.; Thorne, J.L. ER-Negative Breast Cancer Is Highly Responsive to Cholesterol Metabolite Signalling. Nutrients 2019, 11, 2618. [Google Scholar] [CrossRef] [PubMed]
- Xu, F.; Wang, X.; Wu, N.; He, S.; Yi, W.; Xiang, S.; Zhang, P.; Xie, X.; Ying, C. Bisphenol A induces proliferative effects on both breast cancer cells and vascular endothelial cells through a shared GPER-dependent pathway in hypoxia. Environ. Pollut. 2017, 231, 1609–1620. [Google Scholar] [CrossRef] [PubMed]
- Filardo, E.J.; Quinn, J.A.; Bland, K.I.; Frackelton, J. Estrogen-induced activation of Erk-1 and Erk-2 requires the G protein-coupled receptor homolog, GPR30, and occurs via trans-activation of the epidermal growth factor receptor through release of HB-EGF. Mol. Endocrinol. 2000, 14, 1649–1660. [Google Scholar] [CrossRef] [PubMed]
- Ledoux, A.C.; Perkins, N.D. NF-κB and the cell cycle. Biochem. Soc. Trans. 2014, 42, 76–81. [Google Scholar] [CrossRef]
- Zhu, P.; Liao, L.Y.; Zhao, T.T.; Mo, X.M.; Chen, G.G.; Liu, Z.M. GPER/ERK&AKT/NF-κB pathway is involved in cadmium-induced proliferation, invasion and migration of GPER-positive thyroid cancer cells. Mol. Cell. Endocrinol. 2017, 442, 68–80. [Google Scholar] [CrossRef]
- Hinz, M.; Krappmann, D.; Eichten, A.; Heder, A.; Scheidereit, C.; Strauss, M. NF-κB Function in Growth Control: Regulation of Cyclin D1 Expression and G0/G1-to-S-Phase Transition. Mol. Cell. Biol. 1999, 19, 2690–2698. [Google Scholar] [CrossRef]
- Wang, D.; Stockard, C.; Harkins, L.; Lott, P.; Salih, C.; Yuan, K.; Buchsbaum, D.; Hashim, A.; Zayzafoon, M.; Hardy, R.; et al. Immunohistochemistry in the evaluation of neovascularization in tumor xenografts. Biotech. Histochem. 2008, 83, 179–189. [Google Scholar] [CrossRef] [PubMed]
- Dessì, S.; Batetta, B.; Anchisi, C.; Costelli, P.; Tessitore, L.; Baccino, F.M. Cholesterol metabolism during the growth of a rat ascites hepatoma (Yoshida ah-130). Br. J. Cancer 1992, 66, 779–808. [Google Scholar] [CrossRef] [PubMed]
- Schaffner, C.P. Prostatic cholesterol metabolism: Regulation and alteration. Prog. Clin. Biol. Res. 1981, 75 A, 279–324. [Google Scholar]
- Antalis, C.J.; Uchida, A.; Buhman, K.K.; Siddiqui, R.A. Migration of MDA-MB-231 breast cancer cells depends on the availability of exogenous lipids and cholesterol esterification. Clin. Exp. Metastasis 2011, 28, 733–741. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues Dos Santos, C.; Domingues, G.; Matias, I.; Matos, J.; Fonseca, I.; De Almeida, J.M.; Dias, S. LDL-cholesterol signaling induces breast cancer proliferation and invasion. Lipids Health Dis. 2014, 13, 16. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A.S.; Benz, C.C.; Shim, V.; Minami, C.A.; Moore, D.H.; Esserman, L.J. Estrogen receptor-negative breast cancer is less likely to arise among lipophilic statin users. Cancer Epidemiol. Biomarkers Prev. 2008, 17, 1028–1033. [Google Scholar] [CrossRef] [PubMed]
- Borgquist, S.; Jögi, A.; Pontén, F.; Rydén, L.; Brennan, D.J.; Jirström, K. Prognostic impact of tumour-specific HMG-CoA reductase expression in primary breast cancer. Breast Cancer Res. 2008, 10, R79. [Google Scholar] [CrossRef] [PubMed]
- Wolfe, A.R.; Debeb, B.G.; Lacerda, L.; Larson, R.; Bambhroliya, A.; Huang, X.; Bertucci, F.; Finetti, P.; Birnbaum, D.; Van Laere, S.; et al. Simvastatin prevents triple-negative breast cancer metastasis in pre-clinical models through regulation of FOXO3a. Breast Cancer Res. Treat. 2015, 154, 495–508. [Google Scholar] [CrossRef]
- Bjarnadottir, O.; Feldt, M.; Inasu, M.; Bendahl, P.O.; Elebro, K.; Kimbung, S.; Borgquist, S. Statin use, HMGCR expression, and breast cancer survival—The Malmö Diet and Cancer Study. Sci. Rep. 2020, 10, 558. [Google Scholar] [CrossRef]
- Luo, J.; Liu, D. Does GPER Really Function as a G Protein-Coupled Estrogen Receptor in vivo? Front. Endocrinol. 2020, 11, 148. [Google Scholar] [CrossRef]
- Nagahashi, M.; Yuza, K.; Hirose, Y.; Nakajima, M.; Ramanathan, R.; Hait, N.C.; Hylemon, P.B.; Zhou, H.; Takabe, K.; Wakai, T. The roles of bile acids and sphingosine-1-phosphate signaling in the hepatobiliary diseases. J. Lipid Res. 2016, 57, 1636–1643. [Google Scholar] [CrossRef] [PubMed]
- Baek, A.E.; Yu, Y.R.A.; He, S.; Wardell, S.E.; Chang, C.Y.; Kwon, S.; Pillai, R.V.; McDowell, H.B.; Thompson, J.W.; Dubois, L.G.; et al. The cholesterol metabolite 27 hydroxycholesterol facilitates breast cancer metastasis through its actions on immune cells. Nat. Commun. 2017, 8, 864. [Google Scholar] [CrossRef] [PubMed]
- Pelton, K.; Coticchia, C.M.; Curatolo, A.S.; Schaffner, C.P.; Zurakowski, D.; Solomon, K.R.; Moses, M.A. Hypercholesterolemia induces angiogenesis and accelerates growth of breast tumors in vivo. Am. J. Pathol. 2014, 184, 2099–2110. [Google Scholar] [CrossRef] [PubMed]
- Naugler, W.E.; Karin, M. NF-κB and cancer—Identifying targets and mechanisms. Curr. Opin. Genet. Dev. 2008, 18, 19–26. [Google Scholar] [CrossRef] [PubMed]
- Ossovskaya, V.; Wang, Y.; Budoff, A.; Xu, Q.; Lituev, A.; Potapova, O.; Vansant, G.; Monforte, J.; Daraselia, N. Exploring Molecular Pathways of Triple-Negative Breast Cancer. Genes Cancer 2011, 2, 870–879. [Google Scholar] [CrossRef]
- Nedeljković, M.; Damjanović, A. Mechanisms of Chemotherapy Resistance in Triple-Negative Breast Cancer-How We Can Rise to the Challenge. Cells 2019, 8, 957. [Google Scholar] [CrossRef] [PubMed]
- Li, M.X.; Jin, L.T.; Wang, T.J.; Feng, Y.J.; Pan, C.P.; Zhao, D.M.; Shao, J. Identification of potential core genes in triple negative breast cancer using bioinformatics analysis. Onco. Targets Ther. 2018, 11, 4105–4112. [Google Scholar] [CrossRef]
- Narrandes, S.; Huang, S.; Murphy, L.; Xu, W. The exploration of contrasting pathways in Triple Negative Breast Cancer (TNBC). BMC Cancer 2018, 18, 22. [Google Scholar] [CrossRef]
| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| ZEB1 | GCACCTGAAGAGGACCAGAG | TGCATCTGGTGTTCCATTTT |
| VIMENTIN | CCTTGAACGCAAAGTGGAATC | GACATGCTGTTCCTGAATCTGAG |
| TWIST | CGGGAGTCCGCAGTCTTA | TGAATCTTGCTCAGCTTGTC |
| SNAI2 | CATGCCTGTCATACCACAAC | GGTGTCAGATGGAGGAGGG |
| VEGF | TGCAGATTATGCGGATCAAACC | TGCATTCACATTTGTTGTGCTGTAG |
| CCND1 | CACGCGCAGACCTTCGT | ATGGAGGGCGGATTGGAA |
| 18S | CGGCGACGACCCATTCGAAC | GAATCGAACCCTGATTCCCCGTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Avena, P.; Casaburi, I.; Zavaglia, L.; Nocito, M.C.; La Padula, D.; Rago, V.; Dong, J.; Thomas, P.; Mineo, C.; Sirianni, R.; et al. 27-Hydroxycholesterol Binds GPER and Induces Progression of Estrogen Receptor-Negative Breast Cancer. Cancers 2022, 14, 1521. https://doi.org/10.3390/cancers14061521
Avena P, Casaburi I, Zavaglia L, Nocito MC, La Padula D, Rago V, Dong J, Thomas P, Mineo C, Sirianni R, et al. 27-Hydroxycholesterol Binds GPER and Induces Progression of Estrogen Receptor-Negative Breast Cancer. Cancers. 2022; 14(6):1521. https://doi.org/10.3390/cancers14061521
Chicago/Turabian StyleAvena, Paola, Ivan Casaburi, Lucia Zavaglia, Marta C. Nocito, Davide La Padula, Vittoria Rago, Jing Dong, Peter Thomas, Chieko Mineo, Rosa Sirianni, and et al. 2022. "27-Hydroxycholesterol Binds GPER and Induces Progression of Estrogen Receptor-Negative Breast Cancer" Cancers 14, no. 6: 1521. https://doi.org/10.3390/cancers14061521
APA StyleAvena, P., Casaburi, I., Zavaglia, L., Nocito, M. C., La Padula, D., Rago, V., Dong, J., Thomas, P., Mineo, C., Sirianni, R., & Shaul, P. W. (2022). 27-Hydroxycholesterol Binds GPER and Induces Progression of Estrogen Receptor-Negative Breast Cancer. Cancers, 14(6), 1521. https://doi.org/10.3390/cancers14061521

