Next Article in Journal
An Exploratory Study: Can Native T1 Mapping Differentiate Sarcoma from Benign Soft Tissue Tumors at 1.5 T and 3 T?
Previous Article in Journal
Psychological Interventions for Insomnia in Patients with Cancer: A Scoping Review
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A New Approach of Detecting ALK Fusion Oncogenes by RNA Sequencing Exon Coverage Analysis

1
Institute for Personalized Oncology, World-Class Research Center “Digital Biodesign and Personalized Healthcare”, I.M. Sechenov First Moscow State Medical University, 119991 Moscow, Russia
2
Endocrinology Research Center, 117292 Moscow, Russia
3
Medical Holding SM-Clinic, 105120 Moscow, Russia
4
Clinical Center Vitamed, 121309 Moscow, Russia
5
Oncobox LLC, 119991 Moscow, Russia
6
Institute for System Programming of RAS, 109004 Moscow, Russia
7
Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, 117997 Moscow, Russia
8
PathoBiology Group, European Organization for Research and Treatment of Cancer (EORTC), 1200 Brussels, Belgium
*
Author to whom correspondence should be addressed.
Cancers 2024, 16(22), 3851; https://doi.org/10.3390/cancers16223851
Submission received: 1 October 2024 / Revised: 5 November 2024 / Accepted: 13 November 2024 / Published: 16 November 2024
(This article belongs to the Special Issue The Role of RNAs in Cancers)

Simple Summary

Chimeric transcripts frequently function as oncogenic drivers and represent potential targets for tumor-specific therapies. Routine methods for detecting these transcripts include (i) approaches that can detect a limited number of pre-defined targets, such as immunohistochemistry, fluorescence in situ hybridization, and reverse transcription–quantitative polymerase chain reaction, and (ii) approaches that can simultaneously detect multiple fusions, such as NanoString assays and NGS targeted panels. Whole transcriptome sequencing enables the analysis of a wide range of cancer biomarkers, including dysregulated genes, molecular pathways, and both known and novel cancer driver fusion transcripts. However, this method is not commonly employed for fusion discovery due to inadequate coverage at the fusion breakpoint. To address this limitation, we have developed a novel bioinformatics approach that enables the highly accurate prediction of clinically significant ALK fusions from RNA sequencing data. This extends the functionality of whole transcriptome NGS and improves its cost-effectiveness.

Abstract

Background: In clinical practice, various methods are used to identify ALK gene rearrangements in tumor samples, ranging from “classic” techniques, such as IHC, FISH, and RT-qPCR, to more advanced highly multiplexed approaches, such as NanoString technology and NGS panels. Each of these methods has its own advantages and disadvantages, but they share the drawback of detecting only a restricted (although sometimes quite extensive) set of preselected biomarkers. At the same time, whole transcriptome sequencing (WTS, RNAseq) can, in principle, be used to detect gene fusions while simultaneously analyzing an incomparably wide range of tumor characteristics. However, WTS is not widely used in practice due to purely analytical limitations and the high complexity of bioinformatic analysis, which requires considerable expertise. In particular, methods to detect gene fusions in RNAseq data rely on the identification of chimeric reads. However, the typically low number of true fusion reads in RNAseq limits its sensitivity. In a previous study, we observed asymmetry in the RNAseq exon coverage of the 3′ partners of some fusion transcripts. In this study, we conducted a comprehensive evaluation of the accuracy of ALK fusion detection through an analysis of differences in the coverage of its tyrosine kinase exons. Methods: A total of 906 human cancer biosamples were subjected to analysis using experimental RNAseq data, with the objective of determining the extent of asymmetry in ALK coverage. A total of 50 samples were analyzed, comprising 13 samples with predicted ALK fusions and 37 samples without predicted ALK fusions. These samples were assessed by targeted sequencing with two NGS panels that were specifically designed to detect fusion transcripts (the TruSight RNA Fusion Panel and the OncoFu Elite panel). Results: ALK fusions were confirmed in 11 out of the 13 predicted cases, with an overall accuracy of 96% (sensitivity 100%, specificity 94.9%). Two discordant cases exhibited low ALK coverage depth, which could be addressed algorithmically to enhance the accuracy of the results. It was also important to consider read strand specificity due to the presence of antisense transcripts involving parts of ALK. In a limited patient sample undergoing ALK-targeted therapy, the algorithm successfully predicted treatment efficacy. Conclusions: RNAseq exon coverage analysis can effectively detect ALK rearrangements.

Graphical Abstract

1. Introduction

Chromosomal rearrangements resulting in the formation of transcribed fusion genes are a common source of driver mutations in a wide range of cancer types [1,2]. The identification of functional tyrosine kinase (TK) fusions is of great importance in clinical practice, as TK inhibitors (TKIs) have demonstrated significant efficacy in the treatment of cancers harboring these fusions [3,4,5]. The most frequently observed therapeutic target fusions involve ALK (anaplastic lymphoma kinase), ROS1 (ROS proto-oncogene 1), RET (ret proto-oncogene), NTRK1-3 (neurotrophic receptor tyrosine kinases 1-3), BRAF (B-raf proto-oncogene), EFGR (epidermal growth factor receptor), and ABL1 (ABL proto-oncogene 1) genes [6,7].
The ALK gene encodes a receptor tyrosine kinase (RTK) that plays a key role in fetal neuronal development [8,9]. In adults, ALK is expressed in limited quantities in a restricted number of tissues, including the brain, pituitary gland, and testis, as indicated by the Human Protein Atlas project (https://www.proteinatlas.org/ENSG00000171094-ALK/tissue, accessed on 13 September 2024) [10].
ALK was initially identified as a component of a fusion protein in anaplastic large cell lymphomas, which led to its designation as a specific kinase [11,12]. In pan-cancer studies, approximately 0.2–0.8% of cases were found to have ALK rearrangements [13,14]. In anaplastic large cell lymphoma, the frequency of ALK fusions is approximately 50–80% [15], with a similar prevalence observed in inflammatory myofibroblastic tumors at around 50–60% [16,17]. In solid tumors, ALK rearrangements are most commonly observed in non-small cell lung cancer (NSCLC), occurring in about 3–8% of cases [13,18].
The ALK gene is located on chromosome 2p23 and consists of 29 exons (Figure 1). The catalytically active tyrosine kinase (TK) domain is encoded by exons 20–29. The formation of oncogenic ALK fusions can occur through a number of different mechanisms, as reviewed in detail elsewhere [19]. The ALK breakpoint is most frequently located in intron 19 [20,21], resulting in the loss of extracellular and transmembrane domains. The resulting fusion transcripts maintain the TK domain of ALK at the 3′-end, while the 5′-partner genes exhibit variability. Among the most frequent 5′-partners are EML4 (echinoderm microtubule-associated protein-like 4) in NSCLC and STRN (striatin), NPM1 (nucleophosmin), and TPM3 (tropomyscin 3) in non-NSCLC neoplasms [22,23]. It has been established that nearly all known 5′-partner genes contain oligomerization domains, which result in the constitutive activation of ALK [19]. This results in cellular transformation, uncontrolled growth, lack of normal differentiation, and clonal expansion, as ALK is involved in key proliferative signaling pathways, including Ras/extracellular signal-regulated kinase (ERK), phosphatidylinositol 3 kinase (PI3K)/Akt, and Janus protein tyrosine kinase (JAK)/STAT [24,25,26] (Figure 2).
In clinical practice, a number of methods are commonly employed for the identification of ALK fusions, including immunohistochemistry (IHC), immunocytochemistry (ICC), fluorescence in situ hybridization (FISH), real-time polymerase chain reaction with reverse transcription (RT-qPCR), high-throughput nucleic acid hybridization technology (NanoString, Seattle, WA, USA), and DNA- and RNA-based targeted next-generation sequencing (NGS) [7,27,28].
IHC and FISH testing for ALK rearrangements frequently yield discrepant results [14,29,30]. This discrepancy is not solely attributable to inherent differences in the sensitivity and specificity of these methods or to the potential influence of human error. Rather, it is a consequence of the fact that the assays in question target biologically distinct features. While FISH is capable of detecting chromosomal rearrangements, it is unable to ascertain whether a functional fusion transcript has been formed. In contrast, IHC is able to detect an elevated expression of the carboxy terminus of ALK, which may result not only from chromosomal translocation but also from overexpression of a wild-type protein or a short transcript variant ALKATI [31].
While some studies indicate that IHC results are more efficacious than FISH in predicting potential responsiveness to tyrosine kinase inhibitor therapy [32,33], this methodology exhibits moderate sensitivity compared to NGS [34]. The issues of abnormal staining and interpretative uncertainties in IHC results underscore the necessity of standardized diagnostic practices, robust internal quality control, and consistent quality monitoring [35], which may prove challenging to implement in all diagnostic laboratories.
Another frequently used method for ALK fusion testing is RT-qPCR [14,36,37]. RT-qPCR demonstrates high sensitivity and specificity [36,38]. Compared to the RT-qPCR results, FISH has low sensitivity (about 58%) but excellent specificity (about 99%), and IHC staining has high sensitivity (about 92%) and modest specificity (about 80%) [14]. However, the crucial drawback of RT-qPCR is that it can only capture a small subset of fusion variants, predominantly those that are already well characterized and frequently occurring. At the same time, according to the COSMIC [20] (https://cancer.sanger.ac.uk/cosmic, accessed on 2 July 2024) and FusionGDB 2.0 [21] (https://compbio.uth.edu/FusionGDB2/, accessed on 2 July 2024) databases, more than 25 fusion partner genes for ALK have been identified with different breakpoints, further increasing the diversity of ALK fusions [39].
The nCounter platform (NanoString, Seattle, WA, USA) employs an amplification-free, high-throughput nucleic acid hybridization technology for the purpose of fusion detection. In contrast to the aforementioned methodologies, NanoString enables multiplexed analysis, allowing for the simultaneous detection of tens or even hundreds of unique fusions [40]. It is a relatively cost-effective solution, offers a rapid turnaround time, and provides straightforward result analysis. The nCounter results show strong agreement with IHC, FISH, and RT-qPCR findings, with concordance rates of 98.5%, 87%, and 85.7%, respectively [41]. However, like RT-qPCR, detection with NanoString assays is limited to pre-defined targets. Additionally, the performance of the NanoString assay varies across tumor types and genes [42] and depends on the probe list and its effectiveness.
Next-generation sequencing (NGS) is increasingly being incorporated into routine practice for the study of tumor biomarkers. Fusions can be detected by both DNA- and RNA-based NGS methods. The latter allows for an assessment of the functionality of the rearrangement, including the presence of the transcript, maintenance of the reading frame, and evaluation of the integrity of the kinase domain. Thus, RNA-based NGS appears to be the preferred choice.
A variety of RNA-based fusion detection panels employ diverse approaches to target enrichment, including (i) highly multiplexed PCR amplification of target regions, as in the Oncomine and Ion AmpliSeq panels (Thermo Fisher Scientific, Waltham, MA, USA); (ii) multiplexed anchored PCR, as in the FusionPlex panel (Archer, San Jose, CA, USA); (iii) single-primer enrichment technology (SPET), as in the ovation fusion panel (NuGEN, San Carlos, CA, USA); and (iv) probe-based hybridization enrichment, as in the TruSight panel (Illumina, San Diego, CA, USA). With the exception of the first method, all of these enrichment techniques allow for the sequencing of all fusions involving target genes, even with unknown fusion partners. NGS panels have demonstrated high sensitivity and specificity for fusion detection [43,44,45]. The European Society for Medical Oncology (ESMO) recommends their use in routine practice for analyzing fusions in NSCLC samples [46]. However, NGS panels also have some drawbacks, including their labor-intensive nature and relatively high cost. The limited number of targets is advantageous in that it increases the sensitivity of detection and simplifies the processing and interpretation of results. However, it is also a disadvantage because it provides only constrained information about the tumor.
In contrast, total RNA sequencing (RNAseq) represents the most comprehensive approach to assessing tumor characteristics, yet it remains the least common. While fusion detection is possible with RNAseq, the number of reads supporting a fusion event is often very low (1–5 junction reads), which presents a challenge in distinguishing true fusions from random DNA fragment chimeras that can arise during library preparation.
In our previous study [47], we observed a distinct asymmetry in exon coverage in RNAseq data from experimental samples with tyrosine kinase gene fusions, as confirmed by RT-qPCR. Specifically, it was observed that in a fused transcript with the TK domain located at the 3′ end, the depth of coverage preceding the breakpoint was significantly less than that observed following it. Given that ALK expression is typically low or undetectable in most normal tissues, rearrangement of this gene should lead to a marked increase in the expression of 3′ exons, as has been previously observed for the RTK genes RET and ROS1 [47].
A review of the literature revealed the existence of several analytical assays that use coverage imbalance assessment to detect fusion.
The first set of assays is based on PCR. For example, in [48], a digital PCR method was used for this purpose, with primer pairs to amplify the junctions of the ALK exons 2–3, 17–18, and 22–23. Another work [49] describes a method for detecting ALK fusions in circulating plasma tumor RNA by measuring the difference in expression of the exon 20/exon 3 portion using qPCR. Patent US11021758B2 describes a method for detecting ERG and TMPRSS2 dysregulation (including fusion formation) in prostate cancer that is based on differences in expression between the 5′ and 3′ regions of a gene using RT-qPCR with probe detection.
The same principle is used in the multiplex RT-qPCR assay Idylla GeneFusion (Biocartis, Mechelen, Belgium), which measures the expression imbalance between the 5′ PCR and 3′ PCR of six kinase genes (ALK, ROS1, RET, NTRK1-3). Idylla GeneFusion also targets a panel of 16 ALK fusions, 13 ROS1 fusions, and 7 RET fusions.
Among NGS approaches, certain ultrahigh multiplex PCR amplicon-based Ion AmpliSeq and Oncomine (Thermo Fisher Scientific, Waltham, MA, USA) panels offer 5′-partner-agnostic fusion detection for ALK, ROS1, RET, and NTRK1 using expression imbalance as an additional option to identify fusions [50]. This method is based on either comparing the number of amplicons representing exon–exon junctions of a gene or comparing the levels of amplicons from the 5′ and 3′ regions of a gene.
Limitations of PCR-based approaches include (i) the need to select and validate primers, probes, and PCR conditions for each gene of interest; (ii) the potential for allelic dropout of a primer due to polymorphism, which may result in a false negative; (iii) the fact that when performing reverse transcription and qPCR in a single tube format, as described in patent US11021758B2, amplification of antisense transcripts, if present, also occurs; and (iv) the fact that fusion detection is only possible for a predefined set of target genes.
Another approach to detecting gene fusions based on 5′/3′ imbalance assessment is used in the nCounter platform (NanoString, Seattle, WA, USA). This involves hybridization with multiple fluorescence-labeled probes targeting a 5′ region upstream of the kinase domain exons and a 3′ region either within these exons or further downstream (with eight probes per ALK, RET, and ROS1 in the standard assay). In [51], the custom panel for evaluating fusions for 23 sarcoma-related genes (ALK, BCORL1, BCOR, BRAF, CAMTA1, CCNB3, CREB3L1, CREB3L2, CSF1, FOSB, NFATC2, NTRK1-3, NUTM1, PDGFB, PHF1, PLAG1, RET, ROS1, STAT6, TFE3, and USP6) by 3′/5′ exon imbalance is described. As with PCR-based methods, the NanoString-based approach requires prior selection and validation of probes for all target genes.
Unlike these existing techniques, WTS does not limit the choice of targets and eliminates the need to develop assays for each specific gene. In addition, RNAseq provides comprehensive information beyond fusions alone, providing broader insights into the nature of the tumor.
Therefore, we aimed to systematically evaluate the accuracy of the imbalance-based approach using the example of ALK fusion detection by analyzing the differences in the coverage levels of its tyrosine kinase and non-tyrosine kinase exons through RNAseq reads. For this, we analyzed 906 experimental whole transcriptome sequencing profiles from a pan-cancer cohort of samples. Based on the developed algorithm for determining ALK coverage asymmetry, we predicted the presence of ALK fusions in 13 samples. To validate the ALK status, we performed targeted sequencing using two NGS panels, and, where biomaterial was available, confirmed the results by Sanger sequencing. The predicted ALK fusions were confirmed in 11 out of 13 samples, giving a prediction accuracy of 96%. We also demonstrated that the ALK coverage asymmetry detection method worked with the panel sequencing data.

2. Materials and Methods

2.1. Biosamples and RNA Sequencing

Our own whole transcriptome data from 1039 cancer samples across 27 tumor types were used in this study. Most of the samples (n = 764) either were from an Oncobox clinical trial (Clinicaltrials.gov ID NCT03724097, NCT03521245) or were biosamples submitted for Oncobox molecular testing. For each patient biospecimen, written informed consent for participation in this study was obtained from the patient or their legal representative. The consent process and study design were guided and approved by the local ethics committees of the Vitamed Clinic (Moscow, Russia).
Patients’ clinical information, including ALK status in some cases, was previously collected.
RNA extraction, library preparation, sequencing, and RNAseq data processing were performed as described in [47,52], and the resulting BAM files were analyzed.
To minimize bias in NGS data, we used standardized protocols for RNA extraction and library preparation. RNA was extracted from formalin-fixed paraffin-embedded (FFPE) samples using the RNeasy FFPE Kit (Qiagen, Hilden, Germany) and from bone marrow nucleated cells using the RNeasy Kit (Qiagen, Hilden, Germany). Sequencing libraries were prepared using the strand-specific KAPA RNA HyperPrep Kit with RiboErase (Roche, Basel, Switzerland). NGS was performed on either the HiSeq 3000 (Illumina, San Diego, CA, USA) or the NextSeq 550 (Illumina, San Diego, CA USA) in single-end mode, with read lengths of 50 bp or 75 bp, respectively.
After excluding samples with less than 2.5 million unique reads, 906 profiles remained. A total of 119 samples (13.1%) represented NSCLC and 788 (86.9%) represented other tumor types (Table 1). The gender and age characteristics of all cohorts are shown in Table 1.

2.2. Exon Coverage Calculation

ALK is expressed at low levels in the majority of normal human tissues. In the event of ALK fusion with other genes, a segment on the 5′ end of ALK (pre-TK) was excluded from the resulting oncogene. Given that the fusion transcript exhibited a markedly elevated expression level relative to that of the wild-type ALK transcript, a greater number of reads would be generated from the fusion transcript and aligned with the TK-related exons of ALK. Accordingly, an ALK rearrangement could be predicted on the basis of a comparison of the expression of the 5′ and 3′ regions of the gene.
The input files were BAM (binary alignment/map) files resulting from whole transcriptome sequencing. Deduplication of aligned sequencing reads was performed using the MarkDuplicates module of the Picard Toolkit with default parameters. Coverage asymmetry of TK and non-TK related exons of ALK was calculated using the following algorithm. RNA sequencing reads were aligned to the human genome (hg38, version GCF_000001405.39) using STAR v 2.7.4a. For ALK coverage statistics, only reads with a mapping quality (MQ) > 100 and an alignment length of at least 10 bp were considered. This information was binned to the coordinates of ALK exons obtained from the Ensembl database (for ENST00000389048.8), and the coverage was normalized to the length of the corresponding exons. Additionally, for within-sample normalization, the coverage was divided by the total number of reads and multiplied by 1,000,000. The approach utilized for coverage normalization was analogous to the RPKM metric for gene expression calculation but was applied to individual exons rather than to entire genes.
Coverage was calculated considering the strand specificity of the reads separately for antisense (corresponding to ALK sense transcripts) and sense reads (corresponding to ALK antisense transcripts). The former were visualized on the plots as “positive” bars. ALK antisense transcript reads were plotted as “negative coverage” bars and only used for quality control.
To assess coverage asymmetry, the coverage levels of exons 2–6 (non-TK) and exons 20–24 (TK-related) were compared using a one-sided Mann–Whitney U test with the alternative hypothesis that the coverage of non-TK-related exons was lower than that of TK-related exons. The significance of the coverage difference was determined based on the p-value of the statistical test.
The Mann–Whitney U test was used due to the non-normality of the coverage distribution, which was assessed using the Shapiro–Wilk test with Benjamini–Hochberg correction for multiple hypothesis testing (with the null hypothesis that the distribution was normal).
The code used for the analysis and the accompanying data are available at https://github.com/smiranast/coverage_asymmetry (accessed on 5 November 2024).
The coverage depth of ALK exons 20–24 was also calculated as the number of bases of all reads matching these exons divided by their combined length.

2.3. Experimental Validation of ALK Fusion Transcripts by Targeted NGS

Two targeted NGS panels were used for ALK rearrangement verification: the TruSight RNA Fusion Panel (Illumina, San Diego, CA USA) and the OncoFu Elite (for RNA) Panel v1.0 (Nanodigmbio, Nanjing, China). NGS libraries were prepared according to the manufacturer’s protocol. For the TruSight panel, libraries were prepared by starting from previously extracted RNA samples. For the OncoFu panel, hybridization enrichment was performed on previously prepared cDNA libraries, which were used for whole transcriptome sequencing.
Sequencing was performed on the FASTASeq 300 platform (GeneMind Biosciences, Shenzhen, China) (2 × 75 bp paired end) with an expected yield of approximately 4.5 million reads per sample for the TruSight panel and 2.5 million reads per sample for the OncoFu panel.

2.4. Experimental Validation of ALK Fusion Transcripts by Sanger Sequencing

To generate amplicons for Sanger sequencing, single-stranded cDNA was synthesized using the MMLV RT kit (Evrogen, Moscow, Russia) according to the manufacturer’s instructions. Reverse transcriptase was pre-diluted ten-fold with enzyme dilution buffer. Reverse transcription was performed using gene-specific reverse primer for ALK exon 20 (5′-GCTTGCAGCTCCTGGTG-3′), with a final concentration of 500 nM.
For preparative PCR, the following reagents were used (all from Evrogen, Moscow, Russia): 10× Turbo Buffer, dNTP mix (10 mM each), HS-Taq DNA polymerase, 50× SYBR Green I, and PCR-grade water. PCR was performed in 50 uL volumes using a T100 Thermal Cycler (Bio-Rad, Hercules, CA USA). The thermal cycling protocol was (1) 2 min at 95 °C; (2) 40 cycles of 15 s at 95 °C, 20 s at 60 °C, and 10 s at 70 °C; and (3) 1 min at 70 °C. The primer pairs are listed in Table 2.
Amplicons were purified using the standard NGS Clean and Select Beads protocol (Meridian Bioscience, Cincinnati, OH, USA), with a twofold excess of magnetic bead suspension volume. Sanger sequencing was performed on the genetic analyzer 3500xL (Applied Biosystems, Foster City, CA, USA).

2.5. Bioinformatics Approach to Detecting ALK Fusion Transcripts

ALK fusion transcripts were identified in both RNAseq profiles and data from NGS panels using STAR-Fusion software [16] (version STAR-2.7.2b). The pre-assembled genome build GRCh38_gencode_v33_CTAT_lib_Apr062020.plug-n-play was used as the reference genome sequence. For STAR-Fusion, default parameters were used.
Fusion candidate files were generated, followed by extraction of the relevant RNA sequencing reads associated with ALK. The resulting data were then verified by manual inspection using UCSC BLAT and the UCSC Genome Browser (https://genome-euro.ucsc.edu, accessed 1 August 2024). Candidate ALK fusions were evaluated based on the following criteria: (i) whether the sequencing read spanned an exon junction between two distinct, previously characterized transcripts, (ii) whether the junction site corresponded precisely to exon boundaries of known genes, considering established splice sites, and (iii) whether both transcripts were aligned in the same orientation, indicating the presence of a putative fusion RNA. Reads meeting these criteria were considered as evidence of fusion.

2.6. Statistical Analysis

Survival analysis was performed using the Kaplan–Meier method and the ‘survival’ package of R (https://cran.r-project.org/package=survival, accessed on 16 September 2024) Kaplan–Meier curves were plotted using the ‘ggsurvplot’ function of ‘survminer’ package (https://cran.r-project.org/web/packages/survminer/index.html, accessed on 16 September 2024). Cox proportional hazard analysis for progression-free survival (PFS) was performed to assess differences in survival between these groups using the ‘coxph’ function of the ‘survival’ package of R (https://cran.r-project.org/package=survival, accessed on 16 September 2024). The hazard ratio (HR) and 95% confidence interval (CI) were calculated as the ratio of failure rates in patients with predicted ALK fusion relative to those without it. The statistical significance of differences between the groups was estimated using the log-rank test with the ‘logrank’ function from the Python 3 ‘scipy’ library [53] (https://docs.scipy.org/doc/scipy/reference/generated/scipy.stats.logrank.html, accessed on 16 September 2024). A p-value less than 0.05 was considered to be statistically significant.

3. Results

3.1. ALK Coverage Assymetry Screening

According to the COSMIC [20] (https://cancer.sanger.ac.uk/cosmic, accessed on 2 July 2024) and the FusionGDB 2.0 [21] (https://compbio.uth.edu/FusionGDB2/, accessed on 2 July 2024) databases, ALK rearrangements occur in intron 19 in approximately 92% of cases, in intron 18 in 1.5% of cases, and in exon 20 in approximately 4% of cases. Thus, in the case of ALK fusion, the expression levels of exons 20–29 are expected to be elevated, while the expression levels of exons 1–19 should be close to the control levels.
First, we investigated whether ALK coverage asymmetry could be detected in the RNAseq data. For this purpose, we analyzed our experimental dataset consisting of 906 WTS profiles from samples representing different malignant tumor types (Table 1). Initially, we determined the expression levels of all ALK exons and normalized coverage to the exon length and the total number of reads in the sample. As a criterion for asymmetry of ALK gene coverage, we used the p-value calculated by the Mann–Whitney U test, comparing the coverage levels of exons 20–24 (corresponding to the first half of the TK domain) with those of exons 2–6. Coverage was considered asymmetric if the p-value was less than 0.05. The number of selected exons (n = 5) in each region was justified by two considerations: (i) to reach the 5% significance level and (ii) to verify the functionality of a putative ALK fusion, as it was important to ensure that the TK domain was preserved. Thus, we selected the first five exons of the TK domain for the TK region coverage calculation and the same number of exons at the start of the gene, except for the first exon, which was expected to be artificially underrepresented due to the cDNA priming protocol used.
It is important to note that the RNAseq library preparation protocol we used was strand-specific, and only ALK transcript sense reads were used for the asymmetry calculation. This is important because in many samples, the 3′ end of ALK exons was significantly covered by ALK antisense reads (as shown in Supplementary Figure S1). These reads may belong to antisense transcripts involving fragments of the ALK gene that could be initiated by read-through downstream transcription of the CLIP4 (CAP-gly domain containing linker protein family member 4) gene [54,55], which was expressed in the opposite orientation and located “tail to tail” only ~9 kb away from ALK.
A total of 13 samples from our experimental collection showed asymmetric coverage according to the above criteria, suggesting the presence of ALK fusion (Figure 3, Supplementary Figure S2). Of these, 12 represented lung cancer, and one represented ovarian cancer (Table 3).
We also found that in 79 samples (of which 62 were central nervous system (CNS) tumors, seven were ovarian cancers, five were NSCLC, and five were other cancers), all ALK exons were transcribed, indicating the increased expression of the wild-type gene. The expression of wt-ALK in a large number of CNS tumors was expected, as it is known that ALK is expressed in brain tissues [10]. Four examples of uniform ALK coverage (ALK_15, ALK_3, OC_7, and NS_20) are shown in Table 3 and Supplementary Figure S2.
We then compared these data with the available clinical information on ALK status. In nine cases, the prediction matched the clinical annotation of our experimental biospecimens. In two samples, ALK_3 (IHC-positive) and ALK_15 (showed conflicting IHC results from two laboratories), ALK exon coverage was uniform, indicating increased expression of the wild-type enzyme. Since IHC targeted the carboxy terminus of ALK, it could not distinguish between the expression levels of ALK fusions and wild-type enzymes. Another two samples (LuC_62 and LuC_68) were annotated as ALK-negative, but they were predicted to be ALK fusion carriers by our algorithm. Finally, three samples (ALK_6_2, ALK_14, and LuC_103) were annotated as ALK-positive, but no ALK expression was detected in the RNAseq data.
Unfortunately, paraffin-embedded tissue was only available for one case with discordance between the clinical annotation and prediction of ALK fusion based on an imbalance in RNAseq data, i.e., LuC_103. Upon review of the IHC (clone D5F3, Ventana, Oro Valley, AZ USA) results for this sample by a pathologist, it was determined that the ALK-positive status had previously been incorrectly assigned, as high signal foci were present in the normal mucosa while the tumor cells were unstained (Figure 4; additional high-resolution images are provided in Supplementary Figure S3). This apparent ALK-negative status was indirectly confirmed by the patient’s lack of response to the ALK-targeted therapeutic alectinib. Thus, we were able to algorithmically identify at least one false-positive clinical case.
Given the discrepancy between the clinical annotation of ALK status and the predicted ALK fusion status based on the coverage imbalance observed in a number of cases (ALK_3, ALK_6_2, ALK_14, ALK_15, LuC_62, LuC_68, and LuC_103), we proceeded to validate the ALK status through an experimental approach involving targeted sequencing, which offered high sensitivity and specificity. To this end, we used two panels specifically designed to detect fusion transcripts, the TruSight RNA Fusion Panel (Illumina, San Diego, CA, USA) and the OncoFu Elite (for RNA) Panel v1.0 (Nanodigmbio, Nanjing, China).

3.2. ALK Fusion Validation with Targeted NGS

For experimental validation, we selected a pool of 50 samples including all predicted ALK fusion cases (with p-value < 0.05 for coverage asymmetry; n = 13), all samples without coverage asymmetry but clinically annotated as ALK-positive (n = 6), and control samples without ALK coverage asymmetry and with negative or unknown clinical ALK status (n = 31), as shown in Supplementary Table S1.
Both targeted NGS panels used for experimental validation were based on hybridization enrichment. For the OncoFu panel, previously prepared cDNA libraries were used as the starting material. For the TruSight panel, libraries were prepared de novo from RNA samples. The STAR-Fusion package [16] was used to search for fusion reads in the resulting panel sequencing data. STAR-Fusion was also used to analyze the WTS data for junction reads confirming ALK fusions.
The main results of the panel sequencing experiments are shown in Table 4; more detailed information is provided in Supplementary Table S1. Junction reads for different variants of the EML4::ALK were detected in the WTS data for only four samples. Using panel sequencing, ALK fusions were detected in 11 samples. Consistent with previously published studies, the most common variants were found to be EML4::ALK fusions with a breakpoint in EML4 intron 6 (variant 3) and intron 13 (variant 1) [23,56,57]. One sample (ALK_16) showed a rearrangement in EML4 in intron 20 (variant 2).
Notably, the results from the above two fusion panels showed some variation: the OncoFu panel generally had more supporting reads; in two samples, the TruSight panel did not detect the fusion while the OncoFu panel did, and in one sample, the reverse was observed (Table 4). The elevated number of supporting reads in OncoFu was not attributable to the presence of duplicate reads, as the data were analyzed using the STAR-Fusion package, which exclusively analyzed unique reads. Since the full protocol details for OncoFu and TruSight panels were unknown, we assumed that differences in the number of chimeric reads could result from: (i) different panel sizes, which affected the coverage of each individual target (the TruSight panel included 507 genes, while OncoFu included only 105 genes); (ii) differences in the design of probes used for enrichment; (iii) differences in library preparation protocols: for enrichment with OncoFu probes, ready-made cDNA libraries were used, which were prepared following the KAPA RNA HyperPrep Kit with RiboErase (Roche, Switzerland), whereas the TruSight panel required de novo library preparation using Illumina reagents, which were prepared following the manufacturer’s instructions; and (iv) other factors such as the composition of hybridization and wash buffers.
In clinical practice, parallel testing of the sample with two panels is unlikely due to the cost of analysis and limited sample material, making conflicting results from targeted sequencing improbable. However, cases of conflicting results from other fusion tests, such as IHC and FISH, are relatively common. In these cases, re-evaluation or an alternative test (e.g., PCR for common fusion variants) may be ordered, or, if the material is limited, the physician’s decision regarding targeted therapy is based on professional society guidelines and personal experience. Since no single method provides 100% sensitivity or specificity on a large scale, the most reliable approach is to use orthogonal methods.
In all 11 targeted NGS-positive samples, the presence of the ALK fusion was predicted by our algorithm based on the assessment of ALK coverage asymmetry. In all samples where the algorithm predicted the absence of the fusion (n = 37), the fusion was not detected by panel sequencing. In two samples (LuC_68 and OC_25), the ALK coverage imbalance was statistically significant; however, ALK fusion was not confirmed in any of the targeted fusion detection panels. A review of the reads mapping to the ALK exons revealed a markedly low coverage depth for four samples: ALK_1_2, ALK_4, LuC_68, and OC_25 (Supplementary Table S1). Of these, the panels were able to detect fusion in two samples (ALK_1_2 and ALK_4) with an extremely low number of supporting reads. This finding suggested that low coverage depth could contribute to the generation of false positive predictions according to the coverage imbalance analysis (see Section 3.3).
Subsequently, we validated the fusion findings from the NGS panels in five samples (ALK_5, ALK_8, ALK_9, ALK_10, and ALK_16), in which sufficient RNA had been retained for further experimental examination. To this end, we employed Sanger sequencing. This analysis confirmed the corresponding EML4::ALK fusion variants in all tested samples (Supplementary Figure S4).
Compared to the targeted NGS results, our ALK fusion prediction algorithm using RNAseq coverage asymmetry demonstrated 96% accuracy, with 100% sensitivity and 94.9% specificity. It was proposed that the specificity of the method could be further increased by the introduction of an additional parameter, namely, the depth of TK domain coverage (Section 3.3). Of course, these data were preliminary as we only had a small number of ALK-positive samples available to test our approach, and the approach needed to be validated in larger cohorts of true positive samples.

3.3. Minimum Required RNAseq Coverage Depth for ALK Asymmetry Analysis

Given the discrepancies observed between different ALK fusion detection methods for low-coverage samples (LuC_68, OC_25, ALK_1_2, and ALK_4), we sought to determine the minimum coverage of RNAseq reads at which the prediction of the presence of an ALK fusion by asymmetry could be considered reliable. Since we did not have enough true positive samples to experimentally determine a coverage depth threshold at the time, we used the subsampling method to model how coverage affects assay detection. From the original FASTQ files for three true-positive samples with confirmed ALK fusions (ALK_2, ALK_5, and ALK_16), as well as for two samples expressing wt-ALK (ALK_15 and NS_20), we randomly selected 1/2/5/10/20 million reads in triplicate for each sample and each read count. For each subsample, we calculated the coverage depth of ALK exons 20–24 and the p-value (U-test) for ALK coverage asymmetry. Since the common factor for the detection of fusions and wild-type enzymes is the expression of the TK domain, the coverage depth of ALK exons 20–24 was chosen as the coverage metric. Supplementary Figure S5 shows the change in the p-value as a function of the ALK coverage. It can be seen that in true positive samples (ALK_2 and ALK_5), when simulating a TK coverage depth below 0.7, the p-value exceeded the statistical significance threshold in some cases, while in the true negative sample NS_20, at a coverage of about 0.2, an ALK asymmetry was erroneously detected. Consequently, it was essential to consider coverage depth when estimating asymmetry. The data obtained permitted a tentative estimation of the required minimum coverage depth for ALK exons 20–24, which was estimated to be 0.7.

3.4. ALK Coverage Asymmetry in Targeted NGS Data

Both the TruSight panel and the OncoFu panels were based on hybridization probe enrichment but differ in the number of target genes (507 versus 102, respectively). In both panels, probes covered all exons of ALK, which, in principle, made it possible to assess ALK coverage asymmetry based on panel sequencing data as well. We tested this assumption. In both panels, ALK coverage asymmetry was indeed clearly evident in the cases with confirmed fusions. However, the TruSight data were of greater interest because, in the case of OncoFu, the enrichment was performed on pre-prepared RNAseq libraries, and the coverage plots fully mirrored those obtained for WTS. Conversely, for TruSight sequencing, libraries were freshly prepared from RNA. Thus, they could serve as an independent confirmation of the ALK coverage asymmetry observed in WTS.
Figure 5 shows individual ALK coverage plots based on TruSight data. Results for all samples are shown in Supplementary Figure S6. For all samples with confirmed ALK fusion, a clear coverage asymmetry was observed in the TruSight data (with p-value < 0.01). Furthermore, the TruSight data reproduced the uniform coverage pattern of all ALK exons in samples ALK_3, ALK_15, and NS_20 observed in the WTS data, indicating the expression of wild-type ALK (Figure 3b and Figure 5b). Most interestingly, the samples with a low number of fusion-supporting reads in the TruSight NGS data (ALK_1_2, ALK_2, ALK_4, ALK_5, ALK_12, and ALK_16) showed a clear heterogeneity in ALK coverage with significantly increased expression levels of exons 20–29 (Figure 5c–f).
An important implication of this is that NGS panel data could be used to search for potential ALK fusions, regardless of the presence of supporting junction reads. ALK coverage asymmetry could also be used as an additional confirmation criterion.

3.5. ALK Coverage Asymmetry in RNAseq Data and Response to Targeted Therapy

In our cohort there were 13 patients with ALK-positive status by clinical annotation and one with controversial IHC results (ALK_15). Of these 14 samples, ten patients listed in Table 5 received ALK-targeted therapy. The rest (ALK_5, ALK_6_2, ALK_14, and ALK_15) either did not receive targeted therapy for various reasons or were lost during follow-up, and data on the efficacy of therapy were unknown.
Crizotinib and ensartinib were used in the first-line setting, and alectinib, brigatinib, and crizotinib were used in the second-line setting. Information on therapeutic agents and progression-free survival (PFS) is presented in Table 5. Kaplan–Meier plots for PFS are shown in Figure 6 for patients with predicted ALK fusion based on ALK coverage asymmetry in RNAseq data and for patients without ALK coverage asymmetry. The former group showed significantly longer PFS in response to TKI therapy (p < 0.05). A statistically significant determination of the hazard ratio was not possible due to the small size of the comparison groups. However, the trend observed suggested that our method had the potential to predict the individual patient response to ALK-specific targeted therapies. A study with a larger group of patients was needed to establish the predictive power of our approach in more detail.

4. Discussion

Genetic methods for the analysis of tumor molecular markers are becoming increasingly widespread for two main reasons: (i) they allow the analysis of a large number of biomarkers simultaneously and (ii) their results are less susceptible to subjective interpretation compared to classical methods, such as IHC and FISH. For the identification of clinically significant gene fusions, targeted NGS panels are increasingly being used, demonstrating high sensitivity and specificity [58,59]. Since about 2020, the use of large multigene NGS panels for tumor marker analysis has been included in the guidelines of relevant professional communities [46,60]. Remarkably, during targeted TKI therapy, patients who tested positive for ALK fusions by NGS showed improved disease control rates and prolonged progression-free survival compared to NGS-negative patients, while IHC and FISH were less predictive [30].
Whole transcriptome sequencing (WTS), while primarily a scientific tool, also has great potential for implementation in clinical practice, as it allows the evaluation of a significantly larger number of cancer features compared to targeted NGS [61,62,63]. Unfortunately, WTS is less suitable for the detection of chimeric transcripts due to its limited coverage of potential fusion junctions.
Existing bioinformatic methods to detect fusions in WTS data rely on the identification of chimeric reads, i.e., reads that map to two different genomic regions. During library preparation, particularly at the adapter ligation stage, unintended ligation of random cDNA fragments can occur, resulting in artifact chimeric reads. To distinguish true fusion reads from such artifacts, various filtering criteria are applied, such as assessing gene orientation, preserving the reading frame, and checking for the occurrence of similar fusions in databases [35]. Several programs have been developed for this purpose, including deFuse [64], FusionCatcher [65], PRADA [66], FusionHunter [67], SOAPfuse [68], JAFFA [69], STAR-Fusion [70], and Arriba [71]. STAR-Fusion and Arriba algorithms have been found to be the most accurate in identifying fused transcripts in cancer [16,72,73]. However, the number of junction reads is typically low, even in targeted sequencing, as shown in this study. In addition, even when true chimeric reads are present, the output of fusion detection programs often includes multiple false-positive “garbage” results after all filtering, making the analysis much more difficult.
At the same time, our proposed approach for predicting ALK gene fusions using RNAseq exon coverage analysis does not require direct identification of the fusion junction. Instead, the presence of a gene fusion can be predicted by analyzing the uniformity of expression of the target gene exons. As shown in our study, this method works well to detect ALK fusions using WTS data with an accuracy of 96% (sensitivity 100%, specificity 94.9%). We also demonstrate that coverage asymmetry can be used to detect ALK fusions in panel sequencing data, allowing the identification or confirmation of rearrangements for which no supporting reads are found. In addition, in a small sample of patients receiving ALK-targeted therapy, the proposed algorithm is shown to be potentially successful in predicting treatment response.
According to our preliminary data, published in [47], as well as unpublished data, the proposed RNAseq approach can also identify fusions with several other tyrosine kinases involved as 3′ partners of chimeric genes. Based on the analysis of coverage unevenness, gene fusions are suspected in four samples for RET, two samples for ROS1, and one sample for PDGFRB, and the presence of the corresponding fusions in these samples is then confirmed by panel sequencing. However, we have not yet collected enough positive samples to evaluate the predictive accuracy in this case. Nevertheless, our RNAseq data are consistent with previous findings in ROS1, RET, and PDGFR fusion-positive samples where 5′/3′ asymmetry is detected using PCR-based [50] and NanoString-based methods [51].
In comparison to alternative methodologies, the proposed algorithm offers the following benefits: (1) it enables the prediction of a fused transcript exclusively through the calculation of ALK exon coverage, even in the absence of chimeric read detection, in contrast to other approaches for the analysis of RNAseq data; (2) it identifies only transcriptionally active chimeric genes, excluding passenger mutations, in contrast to FISH and DNA-based NGS; (3) it permits the evaluation of the integrity of the kinase domain within the chimeric gene, which is not possible with FISH or IHC; and (4) it allows the discrimination between the expression of the fused gene and the wild-type enzyme, unlike IHC. The main drawbacks of whole transcriptome RNAseq remain its cost and the greater complexity of data interpretation, and for these reasons, it is still not widely adopted in clinical practice. Thus, our approach cannot yet replace existing methods for fusion detection, but it allows for more clinically relevant information to be extracted from RNAseq data when it is performed for any reason.
It is important to emphasize that, although our study yielded promising results, further investigations using larger and more diverse datasets are essential to accurately determine the robustness and broader applicability of this approach. One parameter that needs to be elucidated is the threshold coverage level at which ALK fusion detection based on coverage asymmetry can be determined with a reasonable degree of confidence. In our simulation, reducing the coverage depth below 0.7 for the TK domain increases the likelihood of false negative and false positive results. Therefore, results obtained for samples with extremely low ALK coverage should be interpreted with caution.
Another limitation of our approach is that it does not allow for the identification of the 5′ partner in the fusion or the exact breakpoint of the 3′ partner (although it can be inferred from the exon expression pattern). Routine methods such as IHC share this limitation. Since anti-ALK targeted therapy specifically targets the ALK TK domain, clinical guidelines for its prescription do not require knowledge of the 5′ fusion partner gene [60]. While this does not limit the clinical application of our approach, it may limit the investigation of new fusion variants and their biological characteristics.
In summary, we hope that the current approach can be seen as an important new direction in RNA-based molecular cancer diagnostics for ALK and other oncogenic genome rearrangements.

5. Conclusions

Genetic methods for tumor molecular marker analysis are increasingly favored because of their ability to assess multiple biomarkers simultaneously and reduce subjective interpretation compared to traditional techniques such as IHC and FISH. While whole transcriptome sequencing (WTS) holds promise for a more comprehensive assessment of cancer characteristics, it faces challenges in detecting chimeric transcripts due to low true fusion read counts and potential false positives. Our proposed RNAseq approach, which predicts ALK gene fusions by exon coverage analysis without requiring identification of the fusion junction, achieves 96% accuracy (100% sensitivity, 94.9% specificity) in a limited cohort of ALK-positive tumors. Based on our preliminary data, the approach can also identify other tyrosine kinase fusions for ROS1, RET, and PDGFRB.
Despite limitations such as the inability to determine 5′ fusion partners, our method represents a significant advance in RNAseq molecular diagnostics for ALK and other oncogenic rearrangements. However, further investigation with larger and more diverse datasets is essential to accurately determine the robustness and broad applicability of this approach.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/cancers16223851/s1. Figure S1: RNAseq reads mapping on ALK exons 20–29; Figure S2: ALK coverage plots based on RNAseq data; Figure S3: ALK immunostaining with clone D5F3 (Ventana) for sample LuC_103; Figure S4: Results of ALK fusion validation by Sanger sequencing; Figure S5: Dependence of statistical significance for ALK coverage asymmetry on the coverage depth of TK-related exons 20–24; Figure S6: ALK coverage plots based on TruSight panel data; Table S1: Clinical annotation, RNAseq ALK coverage asymmetry data, and the results of ALK fusion validation using targeted NGS panels TruSight and OncoFu for tumor samples from validation cohort.

Author Contributions

Conceptualization, A.B., M.S. (Maxim Sorokin) and M.S. (Maria Suntsova); methodology, M.S. (Maria Suntsova), M.S. (Maxim Sorokin) and G.Z.; software, A.S. (Alexander Simonov) and V.T.; investigation, E.R., T.M., A.D., A.M. and A.S. (Alexander Seryakov); validation, M.S. (Maria Suntsova) and G.Z.; formal analysis, M.S. (Maksim Sorokin), A.S. (Anastasia Smirnova), E.G. and E.K.; resources, E.P., A.S. (Alexander Seryakov), A.M. and V.T.; data curation, E.R., T.M. and V.T.; writing—original draft preparation, G.Z.; writing—review and editing, A.B.; visualization, A.S. (Anastasia Smirnova) and G.Z.; supervision, A.B.; project administration, M.S. (Maria Suntsova), G.Z.; funding acquisition, M.S. (Maria Suntsova) and A.B. All authors have read and agreed to the published version of the manuscript.

Funding

This study was financed by the Ministry of Science and Higher Education of the Russian Federation within the framework of state support for the creation and development of World-Class Research Centers “Digital biodesign and personalized healthcare” (No. 075-15-2022-304). The contributions of Maria Suntsova, Elena Poddubskaya, Tharaa Mohammad, and Elizaveta Rabushko, who performed experimental validation of the predicted ALK fusions using NGS panel sequencing, were funded by the Russian Science Foundation (grant number 20-75-10071). The funders had no role in the design of the study, in the collection, analyses, or interpretation of data, in the writing of the manuscript, or in the decision to publish the results.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the local ethical committees of the Vitamed Clinic (Moscow, Russia). The date of approval was 16 October 2017 for studies involving human cancer tissue biopsy materials.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Data are contained within the article and supplementary materials.

Acknowledgments

We express our gratitude to Maria Ternovskaya and Alexandra Emelyanova for their invaluable assistance with the clinical annotation of tumor samples.

Conflicts of Interest

A.M., A.S. (Anastasia Smirnova), M.S. (Maxim Sorokin), and V.T. have a financial relationship with Oncobox LLC. The remaining authors declare no conflicts of interest.

References

  1. Glenfield, C.; Innan, H. Gene Duplication and Gene Fusion Are Important Drivers of Tumourigenesis during Cancer Evolution. Genes 2021, 12, 1376. [Google Scholar] [CrossRef] [PubMed]
  2. Mohammad, T.; Zolotovskaia, M.A.; Suntsova, M.V.; Buzdin, A.A. Cancer Fusion Transcripts with Human Non-Coding RNAs. Front. Oncol. 2024, 14, 1415801. [Google Scholar] [CrossRef]
  3. Kong, Y.; Jiang, C.; Wei, G.; Sun, K.; Wang, R.; Qiu, T. Small Molecule Iinhibitors as Therapeutic Agents Targeting Oncogenic Fusion Proteins: Current Status and Clinical. Molecules 2023, 28, 4672. [Google Scholar] [CrossRef] [PubMed]
  4. Crescenzo, R.; Inghirami, G. Anaplastic Lymphoma Kinase Inhibitors. Curr. Opin. Pharmacol. 2015, 23, 39. [Google Scholar] [CrossRef]
  5. Eide, I.J.Z.; Nilssen, Y.; Stensland, E.M.; Brustugun, O.T. Real-World Data on EGFR and ALK Testing and TKI Usage in Norway—A Nation-Wide Population Study. Cancers 2023, 15, 1505. [Google Scholar] [CrossRef]
  6. Taniue, K.; Akimitsu, N. Fusion Genes and RNAs in Cancer Development. Non-Coding RNA 2021, 7, 10. [Google Scholar] [CrossRef]
  7. Sorokin, M.; Rabushko, E.; Rozenberg, J.M.; Mohammad, T.; Seryakov, A.; Sekacheva, M.; Buzdin, A. Clinically Relevant Fusion Oncogenes: Detection and Practical Implications. Ther. Adv. Med. Oncol. 2022, 14, 175883592211441. [Google Scholar] [CrossRef] [PubMed]
  8. Iwahara, T.; Fujimoto, J.; Wen, D.; Cupples, R.; Bucay, N.; Arakawa, T.; Mori, S.; Ratzkin, B.; Yamamoto, T. Molecular Characterization of ALK, a Receptor Tyrosine Kinase Expressed Specifically in the Nervous System. Oncogene 1997, 14, 439–449. [Google Scholar] [CrossRef]
  9. Morris, S.W.; Naeve, C.; Mathew, P.; James, P.L.; Kirstein, M.N.; Cui, X.; Witte, D.P. ALK the Chromosome 2 Gene Locus Altered by the t(2;5) in Non-Hodgkin’s Lymphoma, Encodes a Novel Neural Receptor Tyrosine Kinase That Is Highly Related to Leukocyte Tyrosine Kinase (LTK). Oncogene 1997, 14, 2175–2188. [Google Scholar] [CrossRef]
  10. Uhlén, M.; Fagerberg, L.; Hallström, B.M.; Lindskog, C.; Oksvold, P.; Mardinoglu, A.; Sivertsson, Å.; Kampf, C.; Sjöstedt, E.; Asplund, A.; et al. Tissue-Based Map of the Human Proteome. Science 2015, 347, 1260419. [Google Scholar] [CrossRef]
  11. Shiota, M.; Fujimoto, J.; Semba, T.; Satoh, H.; Yamamoto, T.; Mori, S. Hyperphosphorylation of a Novel 80 KDa Protein-Tyrosine Kinase Similar to Ltk in a Human Ki-1 Lymphoma Cell Line, AMS3. Oncogene 1994, 9, 1567–1574. [Google Scholar] [PubMed]
  12. Morris, S.W.; Kirstein, M.N.; Valentine, M.B.; Dittmer, K.G.; Shapiro, D.N.; Saltman, D.L.; Look, A.T. Fusion of a Kinase Gene, ALK, to a Nucleolar Protein Gene, NPM, in Non-Hodgkin’s Lymphoma. Science 1994, 263, 1281–1284. [Google Scholar] [CrossRef] [PubMed]
  13. Ross, J.S.; Ali, S.M.; Fasan, O.; Block, J.; Pal, S.; Elvin, J.A.; Schrock, A.B.; Suh, J.; Nozad, S.; Kim, S.; et al. ALK Fusions in a Wide Variety of Tumor Types Respond to Anti-ALK Targeted Therapy. Oncologist 2017, 22, 1444–1450. [Google Scholar] [CrossRef] [PubMed]
  14. Wu, Y.C.; Chang, I.C.; Wang, C.L.; Chen, T.D.; Chen, Y.T.; Liu, H.P.; Chu, Y.; Chiu, Y.T.; Wu, T.H.; Chou, L.H.; et al. Comparison of IHC, FISH and RT-PCR Methods for Detection of ALK Rearrangements in 312 Non-Small Cell Lung Cancer Patients in Taiwan. PLoS ONE 2013, 8, e70839. [Google Scholar] [CrossRef]
  15. Medeiros, L.J.; Elenitoba-Johnson, K.S.J. Anaplastic Large Cell Lymphoma. Am. J. Clin. Pathol. 2007, 127, 707–722. [Google Scholar] [CrossRef]
  16. Haas, B.J.; Dobin, A.; Li, B.; Stransky, N.; Pochet, N.; Regev, A. Accuracy Assessment of Fusion Transcript Detection via Read-Mapping and de Novo Fusion Transcript Assembly-Based Methods. Genome Biol. 2019, 20, 213. [Google Scholar] [CrossRef]
  17. Cook, J.R.; Dehner, L.P.; Collins, M.H.; Ma, Z.; Morris, S.W.; Coffin, C.M.; Hill, D.A. Anaplastic Lymphoma Kinase (ALK) Expression in the Inflammatory Myofibroblastic Tumor: A Comparative Immunohistochemical Study. Am. J. Surg. Pathol. 2001, 25, 1364–1371. [Google Scholar] [CrossRef]
  18. Chang, W.C.; Kim, H.K.; Shin, B.K. Clinicopathological Features and Diagnostic Methods of ALK Fusion-Positive Non-Small Cell Lung Cancer in Korea. Oncol. Rep. 2020, 43, 218–228. [Google Scholar] [CrossRef]
  19. Tuna, M.; Amos, C.I.; Mills, G.B. Molecular Mechanisms and Pathobiology of Oncogenic Fusion Transcripts in Epithelial Tumors. Oncotarget 2019, 10, 2095–2111. [Google Scholar] [CrossRef]
  20. Sondka, Z.; Dhir, N.B.; Carvalho-Silva, D.; Jupe, S.; Madhumita; McLaren, K.; Starkey, M.; Ward, S.; Wilding, J.; Ahmed, M.; et al. COSMIC: A Curated Database of Somatic Variants and Clinical Data for Cancer. Nucleic Acids Res. 2024, 52, D1210–D1217. [Google Scholar] [CrossRef]
  21. Kim, P.; Zhou, X. FusionGDB: Fusion Gene Annotation DataBase. Nucleic Acids Res. 2019, 47, D994–D1004. [Google Scholar] [CrossRef] [PubMed]
  22. Stein, H.; Foss, H.D.; Durkop, H.; Marafioti, T.; Delsol, G.; Pulford, K.; Pileri, S.; Falini, B. CD30+ Anaplastic Large Cell Lymphoma: A Review of Its Histopathologic, Genetic, and Clinical Features. Blood 2000, 96, 3681–3695. [Google Scholar] [CrossRef] [PubMed]
  23. Zhang, S.S.; Nagasaka, M.; Zhu, V.W.; Ou, S.H.I. Going beneath the Tip of the Iceberg. Identifying and Understanding EML4-ALK Variants and TP53 Mutations to Optimize Treatment of ALK Fusion Positive (ALK+) NSCLC. Lung Cancer 2021, 158, 126–136. [Google Scholar] [CrossRef] [PubMed]
  24. Holla, V.R.; Elamin, Y.Y.; Bailey, A.M.; Johnson, A.M.; Litzenburger, B.C.; Khotskaya, Y.B.; Sanchez, N.S.; Zeng, J.; Shufean, M.A.; Shaw, K.R.; et al. ALK: A Tyrosine Kinase Target for Cancer Therapy. Mol. Case Stud. 2017, 3, a001115. [Google Scholar] [CrossRef] [PubMed]
  25. Shreenivas, A.; Janku, F.; Gouda, M.A.; Chen, H.Z.; George, B.; Kato, S.; Kurzrock, R. ALK Fusions in the Pan-Cancer Setting: Another Tumor-Agnostic Target? NPJ Precis. Oncol. 2023, 7, 101. [Google Scholar] [CrossRef]
  26. Chiarle, R.; Voena, C.; Ambrogio, C.; Piva, R.; Inghirami, G. The Anaplastic Lymphoma Kinase in the Pathogenesis of Cancer. Nat. Rev. Cancer 2008, 8, 11–23. [Google Scholar] [CrossRef]
  27. Pisapia, P.; Pepe, F.; Sgariglia, R.; Nacchio, M.; Russo, G.; Gragnano, G.; Conticelli, F.; Salatiello, M.; Luca, C.D.; Girolami, I.; et al. Methods for Actionable Gene Fusion Detection in Lung Cancer: Now and in the Future. Pharmacogenomics 2021, 22, 833–847. [Google Scholar] [CrossRef]
  28. Malapelle, U.; Pepe, F.; Pisapia, P.; Altimari, A.; Bellevicine, C.; Brunnström, H.; Bruno, R.; Büttner, R.; Cirnes, L.; De Andrea, C.E.; et al. Reference Standards for Gene Fusion Molecular Assays on Cytological Samples: An International Validation Study. J. Clin. Pathol. 2023, 76, 47–52. [Google Scholar] [CrossRef]
  29. Ilie, M.I.; Bence, C.; Hofman, V.; Long-Mira, E.; Butori, C.; Bouhlel, L.; Lalvée, S.; Mouroux, J.; Poudenx, M.; Otto, J.; et al. Discrepancies between FISH and Immunohistochemistry for Assessment of the ALK Status Are Associated with ALK ’Borderline’-Positive Rearrangements or a High Copy Number: A Potential Major Issue for Anti-ALK Therapeutic Strategies. Ann. Oncol. 2015, 26, 238–244. [Google Scholar] [CrossRef]
  30. Lin, C.; Shi, X.; Yang, S.; Zhao, J.; He, Q.; Jin, Y.; Yu, X. Comparison of ALK Detection by FISH, IHC and NGS to Predict Benefit from Crizotinib in Advanced Non-Small-Cell Lung Cancer. Lung Cancer 2019, 131, 62–68. [Google Scholar] [CrossRef]
  31. Wiesner, T.; Lee, W.; Obenauf, A.C.; Ran, L.; Murali, R.; Zhang, Q.F.; Wong, E.W.P.; Hu, W.; Scott, S.N.; Shah, R.H.; et al. Alternative Transcription Initiation Leads to Expression of a Novel ALK Isoform in Cancer. Nature 2015, 526, 453–457. [Google Scholar] [CrossRef] [PubMed]
  32. Cabillic, F.; Hofman, P.; Ilie, M.; Peled, N.; Hochmair, M.; Dietel, M.; Von Laffert, M.; Gosney, J.R.; Lopez-Rios, F.; Erb, G.; et al. ALK IHC and FISH Discordant Results in Patients with NSCLC and Treatment Response: For Discussion of the Question—To Treat or Not to Treat? ESMO Open 2018, 3, e000419. [Google Scholar] [CrossRef] [PubMed]
  33. Mok, T.; Peters, S.; Camidge, D.R.; Noé, J.; Gadgeel, S.; Ou, S.H.I.; Kim, D.W.; Konopa, K.; Pozzi, E.; Liu, T.; et al. Outcomes According to ALK Status Determined by Central Immunohistochemistry or Fluorescence in Situ Hybridization in Patients with ALK-Positive NSCLC Enrolled in the Phase 3 ALEX Study. J. Thorac. Oncol. 2021, 16, 259–268. [Google Scholar] [CrossRef] [PubMed]
  34. Zeng, L.; Li, Y.; Xu, Q.; Jiang, W.; Lizaso, A.; Mao, X.; Zhang, Y.; Yang, N.; Wang, Z. Comparison of Next-Generation Sequencing and Ventana Immunohistochemistry in Detecting ALK Rearrangements and Predicting the Efficacy of First-Line Crizotinib in Patients with Advanced Non-Small Cell Lung Cancer. Onco. Targets. Ther. 2020, 13, 7101–7109. [Google Scholar] [CrossRef] [PubMed]
  35. Li, W.; Zhang, J.; Wang, Z.; Li, L.; Ma, J.; Zhou, X.; Wang, J.; Liang, Z.; Ying, J. Guidelines for Clinical Practice of ALK Fusion Detection in Non-Small-Cell Lung Cancer: A Proposal from the Chinese RATICAL Study Group. J. Natl. Cancer Cent. 2021, 1, 123–131. [Google Scholar] [CrossRef]
  36. Kuang, Y.; Xu, P.; Wang, J.; Zheng, Y.; Sun, X.; Li, Z.; Gan, R.J.; Li, H.; Guo, Y.; Yao, F.; et al. Detecting ALK Rearrangement with RT-PCR: A Reliable Approach Compared with next-Generation Sequencing in Patients with NSCLC. Mol. Diagn. Ther. 2021, 25, 487–494. [Google Scholar] [CrossRef]
  37. Takeuchi, K.; Choi, Y.L.; Soda, M.; Inamura, K.; Togashi, Y.; Hatano, S.; Enomoto, M.; Takada, S.; Yamashita, Y.; Satoh, Y.; et al. Multiplex Reverse Transcription-PCR Screening for EML4-ALK Fusion Transcripts. Clin. Cancer Res. 2008, 14, 6618–6624. [Google Scholar] [CrossRef]
  38. Hout, D.R.; Schweitzer, B.L.; Lawrence, K.; Morris, S.W.; Tucker, T.; Mazzola, R.; Skelton, R.; McMahon, F.; Handshoe, J.; Lesperance, M.; et al. Performance of a RT-PCR Assay in Comparison to Fish and Immunohistochemistry for the Detection of ALK in Non-Small Cell Lung Cancer. Cancers 2017, 9, 99. [Google Scholar] [CrossRef]
  39. Rosenbaum, J.N.; Bloom, R.; Forys, J.T.; Hiken, J.; Armstrong, J.R.; Branson, J.; McNulty, S.; Velu, P.D.; Pepin, K.; Abel, H.; et al. Genomic Heterogeneity of ALK Fusion Breakpoints in Non-Small-Cell Lung Cancer. Mod. Pathol. 2018, 31, 791–808. [Google Scholar] [CrossRef]
  40. Goytain, A.; Ng, T. NanoString NCounter Technology: High-Throughput RNA Validation; Springer: Berlin/Heidelberg, Germany, 2020; pp. 125–139. [Google Scholar]
  41. Pisapia, P.; Lozano, M.D.; Vigliar, E.; Bellevicine, C.; Pepe, F.; Malapelle, U.; Troncone, G. ALK and ROS1 Testing on Lung Cancer Cytologic Samples: Perspectives. Cancer Cytopathol. 2017, 125, 817–830. [Google Scholar] [CrossRef]
  42. Song, W.; Platteel, I.; Suurmeijer, A.J.H.; van Kempen, L.C. Diagnostic Yield of NanoString NCounter FusionPlex Profiling in Soft Tissue Tumors. Genes Chromosome Cancer 2020, 59, 318–324. [Google Scholar] [CrossRef] [PubMed]
  43. Ilié, M.; Goffinet, S.; Rignol, G.; Lespinet-Fabre, V.; Lalvée, S.; Bordone, O.; Zahaf, K.; Bonnetaud, C.; Washetine, K.; Lassalle, S.; et al. Shifting from Immunohistochemistry to Screen for ALK Rearrangements: Real-World Experience in a Large Single-Center Cohort of Patients with Non-Small-Cell Lung Cancer. Cancers 2024, 16, 2219. [Google Scholar] [CrossRef]
  44. De Luca, C.; Pepe, F.; Iaccarino, A.; Pisapia, P.; Righi, L.; Listì, A.; Greco, L.; Gragnano, G.; Campione, S.; De Dominicis, G.; et al. RNA-Based Assay for next-Generation Sequencing of Clinically Relevant Gene Fusions in Non-Small Cell Lung Cancer. Cancers 2021, 13, 139. [Google Scholar] [CrossRef] [PubMed]
  45. Luca, C.D.; Pepe, F.; Pisapia, P.; Iaccarino, A.; Righi, L.; Listì, A.; Russo, G.; Campione, S.; Pagni, F.; Nacchio, M.; et al. RNA-Based Next-Generation Sequencing in Non-Small-Cell Lung Cancer in a Routine Setting: An Experience from an Italian Referral Center. Per. Med. 2022, 19, 395–401. [Google Scholar] [CrossRef] [PubMed]
  46. Mosele, F.; Remon, J.; Mateo, J.; Westphalen, C.B.; Barlesi, F.; Lolkema, M.P.; Normanno, N.; Scarpa, A.; Robson, M.; Meric-Bernstam, F.; et al. Recommendations for the Use of Next-Generation Sequencing (NGS) for Patients with Metastatic Cancers: A Report from the ESMO Precision Medicine Working Group. Ann. Oncol. 2020, 31, 1491–1505. [Google Scholar] [CrossRef]
  47. Rabushko, E.; Sorokin, M.; Suntsova, M.; Seryakov, A.P.; Kuzmin, D.V.; Poddubskaya, E.; Buzdin, A.A. Experimentally Deduced Criteria for Detection of Clinically Relevant Fusion 3′ Oncogenes from FFPE Bulk RNA Sequencing Data. Biomedicines 2022, 10, 1866. [Google Scholar] [CrossRef]
  48. Liu, Y.; Wu, S.; Shi, X.; Lu, L.; Zhu, L.; Guo, Y.; Zhang, L.; Zeng, X. linical evaluation of the effectiveness of fusion-induced asymmetric transcription assay-based reverse transcription droplet digital PCR for ALK detection in formalin-fixed paraffin-embedded samples from lung cancer. Thorac. Cancer 2020, 11, 2252–2261. [Google Scholar] [CrossRef]
  49. Tong, Y.; Zhao, Z.; Liu, B.; Bao, A.; Zheng, H.; Gu, J.; McGrath, M.; Xia, Y.; Tan, B.; Song, C.; et al. 5′/3′ Imbalance Strategy to Detect ALK Fusion Genes in Circulating Tumor RNA from Patients with Non-Small Cell Lung Cancer. J. Exp. Clin. Cancer Res. 2018, 37, 1–8. [Google Scholar] [CrossRef]
  50. Vaughn, C.P.; Costa, J.L.; Feilotter, H.E.; Petraroli, R.; Bagai, V.; Rachiglio, A.M.; Marino, F.Z.; Tops, B.; Kurth, H.M.; Sakai, K.; et al. Simultaneous Detection of Lung Fusions Using a Multiplex RT-PCR next Generation Sequencing-Based Approach: A Multi-Institutional Research Study. BMC Cancer 2018, 18, 828. [Google Scholar] [CrossRef]
  51. Goytain, A.; Chang, K.T.E.; Goh, J.Y.; Nielsen, T.O.; Ng, T.L. Diagnosis of Fusion-Associated Sarcomas by Exon Expression Imbalance and Gene Expression. J. Mol. Diagn. 2023, 25, 121–131. [Google Scholar] [CrossRef]
  52. Suntsova, M.; Gaifullin, N.; Allina, D.; Reshetun, A.; Li, X.; Mendeleeva, L.; Surin, V.; Sergeeva, A.; Spirin, P.; Prassolov, V.; et al. Atlas of RNA Sequencing Profiles for Normal Human Tissues. Sci. Data 2019, 6, 36. [Google Scholar] [CrossRef] [PubMed]
  53. Virtanen, P.; Gommers, R.; Oliphant, T.E.; Haberland, M.; Reddy, T.; Cournapeau, D.; Burovski, E.; Peterson, P.; Weckesser, W.; Bright, J.; et al. SciPy 1.0: Fundamental Algorithms for Scientific Computing in Python. Nat. Methods 2020, 17, 261–272. [Google Scholar] [CrossRef] [PubMed]
  54. Morgan, M.; Shiekhattar, R.; Shilatifard, A.; Lauberth, S.M. It’s a DoG-Eat-DoG World—Altered Transcriptional Mechanisms Drive Downstream-of-Gene (DoG) Transcript Production. Mol. Cell 2022, 82, 1981–1991. [Google Scholar] [CrossRef]
  55. Abe, K.; Maunze, B.; Lopez, P.A.; Xu, J.; Muhammad, N.; Yang, G.Y.; Katz, D.; Liu, Y.; Lauberth, S.M. Downstream-of-Gene (DoG) Transcripts Contribute to an Imbalance in the Cancer Cell Transcriptome. Sci. Adv. 2024, 10, eadh9613. [Google Scholar] [CrossRef]
  56. Lin, J.J.; Zhu, V.W.; Yoda, S.; Yeap, B.Y.; Schrock, A.B.; Dagogo-Jack, I.; Jessop, N.A.; Jiang, G.Y.; Le, L.P.; Gowen, K.; et al. Impact of EML4-ALK Variant on Resistance Mechanisms and Clinical Outcomes in ALK-Positive Lung Cancer. J. Clin. Oncol. 2018, 36, 1199–1206. [Google Scholar] [CrossRef]
  57. Xia, W.; Yang, J.; Li, H.; Li, L.; Liu, J. Comparing Genomic Profiles of ALK Fusion-Positive and ALK Fusion-Negative Nonsmall Cell Lung Cancer Patients. Glob. Med. Genet. 2024, 11, 175–186. [Google Scholar] [CrossRef] [PubMed]
  58. Bridge, J.A.; Halling, K.C.; Moncur, J.T.; Souers, R.J.; Hameed, M.R.; Fernandes, H.; Roy, A.; Surrey, L.; Tafe, L.J.; Vasalos, P.; et al. RNA Sequencing for Solid Tumor Fusion Gene Detection. Arch. Pathol. Lab. Med. 2024, 148, 538–544. [Google Scholar] [CrossRef]
  59. Sun, L.; McNulty, S.N.; Evenson, M.J.; Zhu, X.; Robinson, J.A.; Mann, P.R.; Duncavage, E.J.; Pfeifer, J.D. Clinical Implications of a Targeted RNA-Sequencing Panel in the Detection of Gene Fusions in Solid Tumors. J. Mol. Diagn. 2021, 23, 1749–1760. [Google Scholar] [CrossRef]
  60. Hendriks, L.E.; Kerr, K.M.; Menis, J.; Mok, T.S.; Nestle, U.; Passaro, A.; Peters, S.; Planchard, D.; Smit, E.F.; Solomon, B.J.; et al. Oncogene-Addicted Metastatic Non-Small-Cell Lung Cancer: ESMO Clinical Practice Guideline for Diagnosis, Treatment and Follow-Up. Ann. Oncol. 2023, 34, 339–357. [Google Scholar] [CrossRef]
  61. Deyell, R.J.; Shen, Y.; Titmuss, E.; Dixon, K.; Williamson, L.M.; Pleasance, E.; Nelson, J.M.T.; Abbasi, S.; Krzywinski, M.; Armstrong, L.; et al. Whole Genome and Transcriptome Integrated Analyses Guide Clinical Care of Pediatric Poor Prognosis Cancers. Nat. Commun. 2024, 15, 4165. [Google Scholar] [CrossRef]
  62. Walter, W.; Shahswar, R.; Stengel, A.; Meggendorfer, M.; Kern, W.; Haferlach, T.; Haferlach, C. Clinical Application of Whole Transcriptome Sequencing for the Classification of Patients with Acute Lymphoblastic Leukemia. BMC Cancer 2021, 21, 886. [Google Scholar] [CrossRef] [PubMed]
  63. Buzdin, A.; Sorokin, M.; Garazha, A.; Glusker, A.; Aleshin, A.; Poddubskaya, E.; Sekacheva, M.; Kim, E.; Gaifullin, N.; Giese, A.; et al. RNA Sequencing for Research and Diagnostics in Clinical Oncology. Semin. Cancer Biol. 2020, 60, 311–323. [Google Scholar] [CrossRef] [PubMed]
  64. McPherson, A.; Hormozdiari, F.; Zayed, A.; Giuliany, R.; Ha, G.; Sun, M.G.F.; Griffith, M.; Heravi Moussavi, A.; Senz, J.; Melnyk, N.; et al. DeFuse: An Algorithm for Gene Fusion Discovery in Tumor RNA-Seq Data. PLoS Comput. Biol. 2011, 7, e1001138. [Google Scholar] [CrossRef]
  65. Nicorici, D.; Satalan, M.; Edgren, H.; Kangaspeska, S.; Murumagi, A.; Kallioniemi, O.; Virtanen, S.; Kilkku, O. FusionCatcher—A Tool for Finding Somatic Fusion Genes in Paired-End RNA-Sequencing Data. bioRxiv 2014, 011650. [Google Scholar] [CrossRef]
  66. Torres-García, W.; Zheng, S.; Sivachenko, A.; Vegesna, R.; Wang, Q.; Yao, R.; Berger, M.F.; Weinstein, J.N.; Getz, G.; Verhaak, R.G.W. PRADA: Pipeline for RNA Sequencing Data Analysis. Bioinformatics 2014, 30, 2224–2226. [Google Scholar] [CrossRef]
  67. Li, Y.; Chien, J.; Smith, D.I.; Ma, J. FusionHunter: Identifying Fusion Transcripts in Cancer Using Paired-End RNA-Seq. Bioinformatics 2011, 27, 1708–1710. [Google Scholar] [CrossRef] [PubMed]
  68. Jia, W.; Qiu, K.; He, M.; Song, P.; Zhou, Q.; Zhou, F.; Yu, Y.; Zhu, D.; Nickerson, M.L.; Wan, S.; et al. SOAPfuse: An Algorithm for Identifying Fusion Transcripts from Paired-End RNA-Seq Data. Genome Biol. 2013, 14, R12. [Google Scholar] [CrossRef]
  69. Davidson, N.M.; Majewski, I.J.; Oshlack, A. JAFFA: High Sensitivity Transcriptome-Focused Fusion Gene Detection. Genome Med. 2015, 7, 43. [Google Scholar] [CrossRef] [PubMed]
  70. Haas, B.; Dobin, A.; Stransky, N.; Li, B.; Yang, X.; Tickle, T.; Bankapur, A.; Ganote, C.; Doak, T.; Pochet, N. STAR-Fusion: Fast and Accurate Fusion Transcript Detection from RNA-Seq. bioRxiv 2017. [Google Scholar] [CrossRef]
  71. Uhrig, S.; Ellermann, J.; Walther, T.; Burkhardt, P.; Fröhlich, M.; Hutter, B.; Toprak, U.H.; Neumann, O.; Stenzinger, A.; Scholl, C.; et al. Accurate and Efficient Detection of Gene Fusions from RNA Sequencing Data. Genome Res. 2021, 31, 448–460. [Google Scholar] [CrossRef]
  72. Creason, A.; Haan, D.; Dang, K.; Chiotti, K.E.; Inkman, M.; Lamb, A.; Yu, T.; Hu, Y.; Norman, T.C.; Buchanan, A.; et al. A Community Challenge to Evaluate RNA-Seq, Fusion Detection, and Isoform Quantification Methods for Cancer Discovery. Cell Syst. 2021, 12, 827–838. [Google Scholar] [CrossRef] [PubMed]
  73. Musatov, I.Y.; Sorokin, M.I.; Buzdin, A.A. Bioinformatic Approaches for Detection of Fusion Genes and Trans-Splicing Products. Bioorg. Himia 2024, 50, 231–255. [Google Scholar] [CrossRef]
Figure 1. Structure of the wild-type ALK gene and the corresponding protein. MAM—methylthioalkymalate synthase-like domain; LDLa—low-density lipoprotein receptor class A; EGF-like—epidermal growth factor-like domain; TM—transmembrane domain; and TK—tyrosine kinase domain.
Figure 1. Structure of the wild-type ALK gene and the corresponding protein. MAM—methylthioalkymalate synthase-like domain; LDLa—low-density lipoprotein receptor class A; EGF-like—epidermal growth factor-like domain; TM—transmembrane domain; and TK—tyrosine kinase domain.
Cancers 16 03851 g001
Figure 2. Schematic representation of the formation and functional role of an ALK fusion. FAM150—ALK ligand Augmentor α (FAM150A) or Augmentor β (FAM150B); DD—dimerization domain; and TK—tyrosine kinase domain.
Figure 2. Schematic representation of the formation and functional role of an ALK fusion. FAM150—ALK ligand Augmentor α (FAM150A) or Augmentor β (FAM150B); DD—dimerization domain; and TK—tyrosine kinase domain.
Cancers 16 03851 g002
Figure 3. The ALK coverage plots are based on RNAseq data and normalized to the exon length and total number of reads in the sample. The coverage of the ALK sense reads is shown on a positive scale, while the ALK antisense reads are shown on a negative scale. (a) The ALK_9 sample showed pronounced coverage asymmetry and overexpression of exons 20–29. (b) The NS_20 sample showed uniformly high coverage of all exons. TK—tyrosine kinase domain-related exons; non-TK—exons not related to the tyrosine kinase domain; and non-TK/TK coverage—ratios of the mean coverage of five non-TK exons (exons 2–6) and five TK exons (exons 20–24).
Figure 3. The ALK coverage plots are based on RNAseq data and normalized to the exon length and total number of reads in the sample. The coverage of the ALK sense reads is shown on a positive scale, while the ALK antisense reads are shown on a negative scale. (a) The ALK_9 sample showed pronounced coverage asymmetry and overexpression of exons 20–29. (b) The NS_20 sample showed uniformly high coverage of all exons. TK—tyrosine kinase domain-related exons; non-TK—exons not related to the tyrosine kinase domain; and non-TK/TK coverage—ratios of the mean coverage of five non-TK exons (exons 2–6) and five TK exons (exons 20–24).
Cancers 16 03851 g003
Figure 4. ALK immunostaining using clone D5F3 (Ventana) for sample LuC_103.
Figure 4. ALK immunostaining using clone D5F3 (Ventana) for sample LuC_103.
Cancers 16 03851 g004
Figure 5. ALK coverage plots based on targeted RNAseq data, obtained with the TruSight panel, normalized to exon length and the total number of reads in the sample. Coverage of ALK sense reads is shown on a positive scale, while ALK antisense reads are shown on a negative scale. (a) The ALK_10 sample demonstrates clear ALK coverage asymmetry and a high number of fusion-supporting reads. (b) The NS_20 sample shows the detectable expression of all ALK exons. (cf) ALK_4, ALK_5, ALK_12, and ALK_16 samples, respectively, with ALK coverage asymmetry but very few (or no) fusion-supporting reads. TK—tyrosine kinase domain-related exons; non-TK—exons not related to the kinase domain; and non-TK and TK coverage—mean coverage of five non-TK exons (exons 2–6) and of five TK exons (exons 20–24), respectively.
Figure 5. ALK coverage plots based on targeted RNAseq data, obtained with the TruSight panel, normalized to exon length and the total number of reads in the sample. Coverage of ALK sense reads is shown on a positive scale, while ALK antisense reads are shown on a negative scale. (a) The ALK_10 sample demonstrates clear ALK coverage asymmetry and a high number of fusion-supporting reads. (b) The NS_20 sample shows the detectable expression of all ALK exons. (cf) ALK_4, ALK_5, ALK_12, and ALK_16 samples, respectively, with ALK coverage asymmetry but very few (or no) fusion-supporting reads. TK—tyrosine kinase domain-related exons; non-TK—exons not related to the kinase domain; and non-TK and TK coverage—mean coverage of five non-TK exons (exons 2–6) and of five TK exons (exons 20–24), respectively.
Cancers 16 03851 g005aCancers 16 03851 g005b
Figure 6. Kaplan–Meier plots for PFS data in lung cancer patients receiving ALK-specific targeted therapies: (a) for first-line ALK-specific therapy and (b) for second-line ALK-specific therapy. PFS—progression-free survival; HR—hazard ratio; CI—confidence interval; and P_val—p-value.
Figure 6. Kaplan–Meier plots for PFS data in lung cancer patients receiving ALK-specific targeted therapies: (a) for first-line ALK-specific therapy and (b) for second-line ALK-specific therapy. PFS—progression-free survival; HR—hazard ratio; CI—confidence interval; and P_val—p-value.
Cancers 16 03851 g006
Table 1. Clinical characteristics of the included cancer cases.
Table 1. Clinical characteristics of the included cancer cases.
Cancer Type 1Total Cases Sequenced, n (%)Gender, Male/FemaleAge of Onset
MeanMedianRange
NSCLC119 (13.1%)61.3%/36.1% 260.016029–81
CRC113 (12.5%)46.0%/54.0%56.975732–85
TC107 (11.8%)20.6%/72.9% 247.695011–77
BC93 (10.3%)0%/100%51.545227–81
CNS73 (8.1%)58.9%/35.6% 243.90483–70
MM56 (6.2%)55.4%/44.6%58.666029–78
AL50 (5.5%)54%/46%5.7951–15
SC45 (5.0%)55.6%/44.4%55.805531–79
OC44 (4.9%)0%/100%48.954727–80
PC35 (3.9%)51.4%/45.7% 259.676235–77
KC32 (3.5%)62.5%/37.5%55.165540–69
Other139 (15.3%)43.2%/55.4% 252.215412–84
1 Cancer type abbreviations: NSCLC—non-small cell lung cancer; CRC—colorectal cancer; TC—thyroid cancer; BC—breast cancer; CNS—central nervous system cancer; MM—multiple myeloma; AL—acute lymphoblastic/myeloid leukemia; OC—ovarian cancer; SC—stomach cancer; PC—pancreatic cancer; KC—kidney cancer; and SCLC—small cell lung cancer. 2 For the remaining several samples, the annotation was lost.
Table 2. List of primers used to amplify the fusion transcript fragment around the junction point.
Table 2. List of primers used to amplify the fusion transcript fragment around the junction point.
Target FusionForward Primer, 5′–3′Reverse Primer, 5′–3′
EML4(13)::ALK(20)TGGAGATGTTCTTACTGGAGACTCGCTTGCAGCTCCTGGTG
EML4(20)::ALK(20)CATCACACACCTTGACTGGTCGCTTGCAGCTCCTGGTG
Table 3. Characteristics of putative ALK fusions identified by exon coverage asymmetry.
Table 3. Characteristics of putative ALK fusions identified by exon coverage asymmetry.
Sample IDSexAge on OnsetCancer TypeALK Status (Clinical Data) 1RNAseq Data
ALK Coverage Asymmetry, p-Value 2Mean Coverage of ALK
ex2-6/ex20-24 3
ALK_1_2M56Lung adenocarcinomaALK+ (IHC)0.0360.0/0.018
ALK_2F48Lung adenocarcinomaEML4(6)::ALK(20) (RT-qPCR)0.0040.0/0.080
ALK_3F60Lung adenocarcinomaALK+ (IHC)0.9710.023/0.007
ALK_4M52Lung adenocarcinomaALK+ (FISH)0.0130.0/0.012
ALK_5F48Lung adenocarcinomaALK+ (FISH)0.0050.002/0.103
ALK_6_2F66Lung adenocarcinomaALK+ (FISH)10.0/0.0
ALK_8M46Lung adenocarcinomaALK+ (IHC),
EML4(13)::ALK(20) (RT-qPCR)
0.0060.003/0.138
ALK_9F51Lung adenocarcinomaALK+ (FISH)0.0040.0/0.170
ALK_10M45Lung adenocarcinomaALK+ (RT-qPCR, FISH)0.0040.0/0.206
ALK_12F42Lung adenocarcinomaALK+ (IHC, FISH)0.0370.002/0.023
ALK_14M64Lung adenocarcinomaALK+ (IHC, FISH)0.9490.004/0
ALK_15M53Lung adenocarcinomaALK+/− (controversial IHC results in two labs)0.9250.203/0.117
ALK_16F29Lung adenocarcinomaALK+ (IHC, FISH)0.0050.002/0.158
LuC_62F62Lung adenocarcinomaALK− (method unspecified)0.0040.0/0.038
LuC_68M59Lung adenocarcinomaALK− (IHC; barely visible signal)0.0040.0/0.007
LuC_103M75Lung adenocarcinomaALK+ (IHC) 410.0/0.0
LuC_104M46Squamous cell carcinomaunknown0.0040.0/0.125
NS_20M58Glioblastomaunknown0.8450.059/0.042
OC_25F58Ovarian cancerunknown0.0060.001/0.013
1 ALK status determined by FISH or IHC or RT-qPCR. 2 The p-value was calculated using the Mann–Whitney U test for ALK exons 20–24 versus exons 2–6. 3 The mean coverage levels for ALK exons 20–24 and exons 2–6 were calculated based on ALK sense reads only. 4 The IHC status for LuC_103 was reviewed after the NGS results were obtained.
Table 4. Results of ALK fusion validation using the TruSight and OncoFu targeted NGS panels.
Table 4. Results of ALK fusion validation using the TruSight and OncoFu targeted NGS panels.
Sample IDClinical ALK
Status
RNAseq
Coverage-Predicted ALK Fusion 1
ALK Fusion Found in RNAseq
(Number of Junction Reads)
TruSight Results
(Number of
Junction+Spanning Reads)
OncoFu Results
(Number of
Junction+Spanning Reads)
ALK_1_2positiveyesnoEML4(6)::ALK(20)
(1+0)
no fusion
ALK_2positiveyesnoEML4(6)::ALK(20)
(1+0)
EML4(6)::ALK(20)?
(0+3)
ALK_3positivenonono fusionno fusion
ALK_4positiveyesnono fusionEML4(6)::ALK(20)?
(0+3)
ALK_5positiveyesnoEML4(13)::ALK(20)?
(0+1)
EML4(13)::ALK(20)
(51+37)
ALK_6_2positivenonono fusionno fusion
ALK_8positiveyesEML4(13)::ALK(20)
(1)
EML4(13)::ALK(20)
(1+4)
EML4(13)::ALK(20)
(109+91)
ALK_9positiveyesEML4(13)::ALK(20)
(2)
EML4(13)::ALK(20)?
(0+8)
EML4(13)::ALK(20)
(241+255)
ALK_10positiveyesEML4(13)::ALK(20)
(5)
EML4(13)::ALK(20)?
(0+24)
EML4(13)::ALK(20)
(185+325)
ALK_12positiveyesnoEML4(6)::ALK(20)
(2+0)
EML4(6)::ALK(20)
(14+17)
ALK_14positivenonono fusionno fusion
ALK_15controversialnonono fusionno fusion
ALK_16positiveyesEML4(20)::ALK(20)
(4)
no fusionEML4(20)::ALK(20)
(11+0)
LuC_62negativeyesnoEML4(6)::ALK(20)
(2+1)
EML4(6)::ALK(20)
(12+7)
LuC_68negativeyesnono fusionno fusion
LuC_103positivenonono fusionno fusion
LuC_104unknownyesnoEML4(13)::ALK(20)
(3+1)
EML4(13)::ALK(20)
(52+26)
NS_20unknownnonono fusionno fusion
OC_25unknownyesnono fusionno fusion
1 Prediction was made by ALK coverage asymmetry (considered positive, if p < 0.05).
Table 5. Response to TKI therapy and time to progression in lung cancer cases with ALK-positive clinical status.
Table 5. Response to TKI therapy and time to progression in lung cancer cases with ALK-positive clinical status.
Sample IDIHC/FISH/PCR
ALK Status
Predicted ALK Fusion 1Validated ALK Fusion 2First Line TKIFirst Line PFS, WeeksSecond Line TKISecond Line PFS, Weeks
ALK_1_2positiveyesyescrizotinib100alectinibunknown
ALK_2positiveyesyesensartinib136alectinib64
ALK_3positivenonocrizotinib8brigatinib8
ALK_4positiveyesyescrizotinib8alectinib32
ALK_8positiveyesyescrizotinib64alectinib32
ALK_9positiveyesyesunknownunknownalectinib92
ALK_10positiveyesyescrizotinib56alectinibunknown
ALK_12positiveyesyescrizotinib48brigatinib108
ALK_16positiveyesyescrizotinib40crizotinib172
LuC_103positivenonocrizotinib16alectinib12
1 Predicted by ALK coverage asymmetry (positive when p-value < 0.05). 2 Validated with targeted NGS panels designed to capture driver fusion transcripts of known oncogenes. IHC—immunohistochemistry; FISH—fluorescent in situ hybridization; TKI—tyrosine kinase inhibitor; and PFS—progression-free survival.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zakharova, G.; Suntsova, M.; Rabushko, E.; Mohammad, T.; Drobyshev, A.; Seryakov, A.; Poddubskaya, E.; Moisseev, A.; Smirnova, A.; Sorokin, M.; et al. A New Approach of Detecting ALK Fusion Oncogenes by RNA Sequencing Exon Coverage Analysis. Cancers 2024, 16, 3851. https://doi.org/10.3390/cancers16223851

AMA Style

Zakharova G, Suntsova M, Rabushko E, Mohammad T, Drobyshev A, Seryakov A, Poddubskaya E, Moisseev A, Smirnova A, Sorokin M, et al. A New Approach of Detecting ALK Fusion Oncogenes by RNA Sequencing Exon Coverage Analysis. Cancers. 2024; 16(22):3851. https://doi.org/10.3390/cancers16223851

Chicago/Turabian Style

Zakharova, Galina, Maria Suntsova, Elizaveta Rabushko, Tharaa Mohammad, Alexey Drobyshev, Alexander Seryakov, Elena Poddubskaya, Alexey Moisseev, Anastasia Smirnova, Maxim Sorokin, and et al. 2024. "A New Approach of Detecting ALK Fusion Oncogenes by RNA Sequencing Exon Coverage Analysis" Cancers 16, no. 22: 3851. https://doi.org/10.3390/cancers16223851

APA Style

Zakharova, G., Suntsova, M., Rabushko, E., Mohammad, T., Drobyshev, A., Seryakov, A., Poddubskaya, E., Moisseev, A., Smirnova, A., Sorokin, M., Tkachev, V., Simonov, A., Guguchkin, E., Karpulevich, E., & Buzdin, A. (2024). A New Approach of Detecting ALK Fusion Oncogenes by RNA Sequencing Exon Coverage Analysis. Cancers, 16(22), 3851. https://doi.org/10.3390/cancers16223851

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop