A Novel SPOTTED LEAF1-1 (SPL11-1) Gene Confers Resistance to Rice Blast and Bacterial Leaf Blight Diseases in Rice (Oryza sativa L.)

Abstract

Programmed cell death (PCD) plays critical roles in plant immunity but must be regulated to prevent excessive damage. In this study, a novel spotted leaf (spl11-1) mutant was identified from an ethyl methane sulfonate (EMS) population. The SPL11-1 gene was genetically mapped to chromosome 12 between the Indel12-37 and Indel12-39 molecular markers, which harbor a genomic region of 27 kb. Annotation of the SPL11-1 genomic region revealed the presence of two candidate genes. Through gene prediction and cDNA sequencing, it was confirmed that the target gene in the spl11-1 mutant is allelic to the rice SPOTTED LEAF (SPL11), hereafter referred to as spl11-1. Sequence analysis of SPL11 revealed a single bp deletion (T) between the spl11-1 mutant and the ‘Shuangkang77009’ wild type. Moreover, protein structure analysis showed that the structural differences between the SPL11-1 and SPL11 proteins might lead to a change in the function of the SPL11 protein. Compared to the ‘Shuangkang77009’ wild type, the spl11-1 mutant showed more disease resistance. The agronomical evaluation showed that the spl11-1 mutant showed more adverse traits. Through further mutagenesis treatment, we obtained the spl11-2 mutant allelic to spl11-1, which has excellent agronomic traits and more improvement and may have certain breeding prospects in future breeding for disease resistance.

1. Introduction

Lesion mimic mutants (LMMs) of rice (Oryza sativa L.), which spontaneously form necrotic lesions on rice leaves or leaf sheaths under non-stress conditions, are a type of programmed cell death (PCD) and are very similar to lesions caused by pathogenic bacteria infection in the plant hypersensitive response (HR) [1]. These mutants exhibit enhanced disease resistance, especially against rice blast and bacterial leaf blight, accompanied by PCD, accumulation of reactive oxygen species (ROS), upregulation of defense gene expression, and increased synthesis of signaling molecules such as salicylic acid (SA), jasmonic acid (JA), and ethylene (ET) [2]. LMMs are mainly generated through artificial mutagenesis and natural variation [3,4]. The oscul3a mutant was obtained by treating the japonica rice cultivar ZH11 with EMS [5]. In the junction region between the first intron and the second exon of LOC_Os02g51180 in the oscul3a mutant, there exists an 11 bp substitution and an 8 bp deletion, resulting in the incorrect splicing of 28 bp in the second exon of LOC_Os02g51180 in the oscul3a mutant [5]. LMMs are divided into dominant and recessive mutations, each with unique lesion characteristics, and are important materials for research on plant disease resistance and PCD, attracting widespread attention from breeders [6].

In rice, over 40 lesion mimic-related genes have been cloned thus far [7]. The proteins encoded by these genes are primarily enzymes, followed by proteins with unknown physiological functions [7]. Notably, excessive accumulation of ROS has been detected in almost all lesion mimic mutants [7]. SEKIGUCHI LESION (SL) was the first LMM discovered in rice. SL was cloned and reported to encode a CYP71P1 protein, which belongs to the cytochrome P450 monooxygenase family [8]. SL confers enhanced resistance against Magnaporthe oryzae and Xanthomonas oryzae while also influencing chloroplast development or function, leading to lesion mimic formation and ROS accumulation [9,10]. Moreover, SPL11 CELL-DEATH SUPPRESSOR 2 (SDS2) interacts with and phosphorylates SPOTTED LEAF 11 (SPL11) [11], suppressing the lesion mimic phenotype of SPL11 while enhancing resistance to Magnaporthe oryzae [12]. LESION MIMIC MUTANT 22 (LMM22) encodes ubiquitin-specific proteases (UBPs), which interact with SPOTTED LEAF 35 (SPL35) [13] to stabilize the SPL35 protein through targeted deubiquitination [14]. RESISTANCE TO BLAST1 (RBL1), another crucial player, regulates programmed cell death and immunity by modulating phosphatidylinositol biosynthesis [2]. Through gene editing, a novel allele, rbl1^Δ12, has been created [2]. This allele not only alleviates the lesion mimic phenotype in rice but also significantly enhances disease resistance and reduces yield loss, offering broad prospects for disease-resistant breeding applications [2].

Studies have revealed that most LMMs exhibit enhanced resistance traits, providing a rich genetic resource for developing rice varieties with improved disease resistance [2]. However, these mutants often come with the drawback of reduced yield, and the scarcity of favorable alleles poses challenges to the full utilization of LMM genes in rice breeding [2]. The successful creation of rbl1^Δ12 offers researchers valuable insights and methods to effectively address these issues. In this study, we employed map-based cloning to uncover a lesion mimic gene, designated spl11-1, which represents a novel allele of spl11. We conducted experiments to evaluate the resistance of the spl11-1 mutant against rice blast disease and bacterial blight, using the ‘Shuangkang77009’ wild type as a control, in order to clarify the disease resistance profile of the spl11-1 mutant. To obtain spl11 alleles with enhanced disease resistance or superior agronomic traits, we subjected spl11-1 to EMS chemical mutagenesis. Through phenotypic screening and molecular identification of the mutagenized progeny, we identified a novel allele, spl11-2, which not only maintains the original disease resistance characteristics of spl11-1 but also exhibits agronomic traits that are even more favorable than those of spl11-1. This discovery presents a novel genetic resource for disease-resistant breeding and holds promising potential for future applications in this field.

2. Materials and Methods

2.1. Plant Materials

The indica rice cultivar ‘Shuangkang77009’ which contains the Pigm-1 gene [15] and the japonica rice cultivar ‘Hui1586’ [16] were used in the current study. Experiments were conducted at the Rice Research Institute, Fujian Academy of Agricultural Sciences, China. The spl11-1 mutant (the spl11-1 mutant has a similar phenotype to the spl11 mutant) was generated using EMS (Shanghai Cathay Chemical Co., Ltd., Shanghai, China) mutagenesis in the background of the ‘Shuangkang77009’ cultivar. The M₂ (the second generation of chemically mutagenized lines) population of the spl11-1 mutant was implemented. Approximately 1000 M₁ (the first generation of chemically mutagenized lines) spl11-1 plants were field-grown at the Sanya Experimental Station in the Fujian Academy of Agricultural Sciences, and 12,000 M₂ spl11-1 plants were field-grown at the Fuzhou Experimental Station in the Fujian Academy of Agricultural Sciences in 2019.

In the summer of 2020, the spl11-2 mutant was generated in the spl11-1 background using EMS mutagenesis. Approximately 2000 M₁ spl11-2 plants were field-grown at the Sanya Experimental Station in the Fujian Academy of Agricultural Sciences, and 40,000 M₂ spl11-2 plants were field-grown at the Fuzhou Experimental Station in the Fujian Academy of Agricultural Sciences in 2021.

In the summer of 2022, the spl11-1 mutants were crossed with the rice varieties ‘Shuangkang77009’ and ‘Hui1586’ as pollinators. F₁ seeds were sown in the spring at the Sanya Test Station in Hainan Province, and F₂ seeds were harvested in 2023. F₂ spl11-1, the M₀ (the unselected original mutant) spl11-1, the M₀ spl11-2, and ‘Shuangkang77009’ plants were sown at the Fuzhou Experimental Station in Fujian Province in the summer of 2023.

All rice plants were sown according to standard commercial planting procedures, with a row spacing of 13.3 and 26.4 cm, and field management was performed according to locally recommended field cultivation techniques, such as controlled irrigation technology.

2.2. Magnaporthe Oryzae Strains and Xanthomonas oryzae

The Magnaporthe oryzae isolates Guy11, 18SH-D527, FJ2011, 95085AZB, and 18NH-16-3 were kindly provided by the State Key Laboratory for Ecological Pest Control of Fujian and Taiwan Crops, Fujian Agriculture and Forestry University; the isolates KJ201, 501-3, RB22, and 20-15 were obtained from the Fujian Academy of Agricultural Sciences; and the isolates M409, MH86-1, and MH86-3 were isolated and maintained at the Plant Immunity Center, the Fujian Agriculture and Forestry University. The Xanthomonas oryzae isolate PXO99 was kindly provided by the Fujian Agriculture and Forestry University.

2.3. Evaluation of Resistance to Rice Blast and Bacterial Blight Diseases

For the internal resistance identification of rice blast, the inoculation method was improved with reference to the previous methods [17]. In brief, blast spores were washed with 0.02% Tween20 (Beijing Bio-Lab Science & Technology Co., Ltd., Beijing, China) mixture, filtered into a 100 mL conical bottle, adjusted to a spore concentration of 1 × 10⁵/mL, and sprayed on rice leaves of approximately 15-day-old plants. The inoculated seedlings were placed in a controlled environment of 26 ℃ and 80% humidity in darkness for 24 h, and then placed in a warm and humid environment. The incidence was observed and counted after 5 to 7 days. The classification criteria for resistance were established based on modifications to previous methods [16].

The identification of resistance to bacterial wilt disease through inoculation was conducted based on previously modified methods [18]. On sunny evenings, rice seedlings grown for about 8 weeks were inoculated by the artificial leaf-cutting inoculation method. Each plant cut 3 fully extended leaves, and each leaf cut 2–3 cm of sword leaves. The grading standard was based on the previous methods [19] with slight modifications, and the resistance was divided into 6 levels according to the length of the lesion, i.e., an onset length of ≤1.0 cm was rated as highly resistant (HR), an onset length of 1.1–3.0 cm was resistant (R), a length of the disease of 3.1–5.0 cm was moderate resistance (MR), an onset length of 5.1–12.0 cm was moderately susceptible (MS), a length of onset of 12.1–20.0 cm was classified as susceptible (S), and a length of the disease of ≥20.1 cm was classified as highly susceptible (HS).

2.4. Construction of the Mapping Population and Genetic Mapping of the SPL11-1 Gene

The spl11-1 mutant (indica rice) was crossed with ‘Hui1586’ (japonica rice), and the F₂ population was obtained by self-crossbreeding. A total of 1136 mutant phenotypes in the F₂ population were selected for fine mapping of the spl11-1 mutant gene.

Indel markers were designed by artificially comparing the genome sequences between japonica (cv. Nipponpare) and indica (cv. 93-11). The Primer Premier 5.0 software was used to design primers to map polymorphic regions of rice subspecies.

For molecular marker analysis, leaf samples were harvested and freeze-dried. Genomic DNA was extracted and PCR products were amplified using the method described by Yang et al. [20]. PCR products were analyzed by electrophoresis on an 8% polyacrylamide denaturing gel and simple sequence repeat (SSR) labeling with silver staining [21].

The mutant (spl11-1 spl11-1) and wild-type (SPL11-1 SPL11-1) band patterns were denoted as 1 and 3, respectively. The heterozygote (spl11-1 SPL11-1) was denoted as 2. Molecular marker linkage analysis of the spl11-1 locus and polymorphisms was performed using the MAPMAKER 3.0 software [22]. The linkage map in this study was essentially the same as that reported previously [23].

Firstly, 326 SSR markers were selected from the rice molecular map to study the polymorphism of spl11-1 and ‘Hui1586’. Among them, 218 pairs of polymorphic markers, 20 mutant strains, and 20 plants containing either the mutant or wild-type alleles of spl11-1 in the F₂ population were implemented for linkage analysis. Secondly, in order to narrow down the genomic region of the SPL11-1 gene, 1136 mutants were selected from the F₂ population constructed by spl11-1 × ‘Hui1586’ for fine mapping of the target gene.

2.5. Bulked Segregant Analysis

Markers associated with target genes were identified by batch isolation analysis (BSA). Genomic DNA from the leaves of 20 plants containing either the mutant or wild-type alleles of spl11-1 in the F₂ population was randomly selected to construct a mutant mixed DNA bank. The spl11-1 mutant DNA was analyzed using SSR markers distributed in the rice genome, and ‘Hui1586’ was used as a control for linkage detection. The marker band of the mutant library was the same as that of the spl11-1 mutant gene.

2.6. Prediction of spl11-1 and spl11 Protein Structure

The PyMol-2.5.7 software platform (https://www.pymol.org/news.html? (3 June 2024)) [24] was employed to predict the effect of the point mutation induced by EMS mutagenesis on the protein structure of the spl11-1 mutant compared to the SPL11 wild-type alleles.

2.7. Phenotype Investigation

At rice maturity, the following parameters were recorded: plant height, panicle length, number of effective panicles, spikelets per panicle, seed setting rate, 1000-grain weight, grain length, grain width, yield per plant. The heading date was noted when the first spikelet reached approximately 2 cm in length. The 1000-grain weight, grain length, and grain width measurements were performed adhering to the methodologies outlined by Fan et al. [25], while the yield per plant measurement was performed following the methods of Lin et al. [26].

3. Results

3.1. The Main Agronomical Characteristics of the spl11-1 Mutant

Phenotypic analysis revealed that the lesions of the spl11-1 mutant plants showed brown necrotic spots. Under field conditions, symptoms appeared either in the seedling stage or the later growth stages. Moreover, the disease spots gradually began to increase, and there were symptoms of disease spots on the leaves, culms, leaf sheaths, spikes, branches, and spikelet (Figure 1).

To further investigate whether the spl11-1 mutant affects related agronomical traits, phenotypic comparisons were made between the spl11-1 mutant and the ‘Shuangkang77009’ wild type as presented in Supplementary Table S1. The results showed no significant differences in heading date, plant height, panicle length, 1000-grain weight, grain length, and grain width. However, there were significant differences in the number of effective panicles, spikelets per panicle, seed setting rate, and grain yield per plant (Figure 2b–i and Supplementary Table S1).

3.2. Resistance Analysis of the spl11-1 Mutant and ‘Shuangkang77009’ Wild Type

To evaluate the resistance levels of the spl11-1 mutant and the ‘Shuangkang77009’ wild type for rice blast, we used 12 different kinds of blast fungi collected and isolated in the laboratory. The results revealed that both the spl11-1 mutant and ‘Shuangkang77009’ wild type showed resistant phenotypes to these 12 blast fungi (

Table 1. Resistance of the spl11-1 mutant and ‘Shuangkang77009’ wild type to 12 blast fungi.

Magnaporthe oryzae Strain	Shuangkang77009	spl11-1
Guy11	R	R
18SH-D527	R	R
KJ201	R	R
501-3	R	R
FJ2011	R	R
95085AZB	R	R
MH86-1	R	R
MH86-3	R	R
RB22	R	R
20-15	R	R
18NH-16-3	R	R
M409	R	R

).

To compare the resistance levels between the spl11-1 mutant and the ‘Shuangkang77009’ wild type for bacterial blight, the bacterial blight resistance with the Xanthomonas oryzae strain PXO99 was identified between the spl11-1 mutant and the ‘Shuangkang77009’ wild type. The results showed that after infection with bacterial blight, the spl11-1 mutant exhibited a relatively slow disease progression with small lesion areas that were less prone to spreading, while the ‘Shuangkang77009’ wild type experienced rapid disease development and large lesion areas (Figure 3). This indicates that the spl11-1 mutant exhibited high resistance to bacterial blight, whereas the ‘Shuangkang77009’ wild type exhibited high susceptibility to bacterial blight (Figure 3).

3.3. Phenotypic Segregation for spl11-1 Mutant

To determine the genetic characteristics of the spl11-1 mutant, we cross-pollinated the spl11-1 mutant with the ‘Shuangkang77009’ wild type. As expected for dominant–recessive inheritance, F₁ plants originating from this cross showed normal resistance phenotypes, whereas the two F₂ populations showed Mendelian segregation (

Table 2. Genetic analysis of spl11-1.

Crosses	F1 Phenotype	F2 Population			χ2 (3:1)	p
		Wild Type	Mutants	Total
Shuangkang77009/spl11-1	Wild-type phenotype	322	111	433	0.305 *	>0.9
spl11-1/Shuangkang77009	Mutant phenotype	569	191	760	0.34 *	>0.9

Note: * Denotes that the segregation ratio of the wild-type plants to mutant plants complied with 3:1 at the 0.05 significance level.

). ‘Shuangkang77009’ and spl11-1 F₂ plants from the two F₂ populations were evaluated for segregation for the mutant phenotype. The phenotypic segregation ratios did not deviate significantly from the 3:1 segregation ratio expected for the dominant–recessive inheritance of a monogenic trait, as tested by χ² analysis (χ² = 0.124~0.462, p > 0.5), indicating that the spl11-1 mutant phenotype is controlled by a single recessive gene.

3.4. Genetic Mapping of the SPL11-1 Locus

In order to determine which gene mutation causes the spl11-1 mutant phenotype, we performed a preliminary localization of the SPL11-1 locus. The phenotypic marker, i.e., the locus responsible for bacterial leaf streak resistance in this population, was mapped to position 21.1 cM on chromosome 12 and is flanked by the two SSR markers RM4125 and RM235. Based on the recombination frequency, the genetic distance between RM4125 and RM235 was 21.1 cM. Therefore, the SPL11-1 gene was located in the 21.1 cM region on chromosome 12 captured by the SSR markers RM4125 and RM235 (Figure 4a).

3.5. Genetic Fine Mapping of SPL11-1

To delimit the genetic region of the SPL11-1 locus, 1136 recessive individuals were identified from the F₂ populations. In total, 7 Indel polymorphic markers from 20 new markers were selected between the SSR markers RM4125 and RM235. We genotyped all recombinant genes using these 7 polymorphic markers (

Table 3. Indel and SSR molecular markers used for fine mapping of the spl11-1 gene.

Marker	Sequence of Forward Primer	Sequence of Reverse Primer
RM4125	GTGCCTCCATCATCATCATC	TAGGACAAGCGAAGAAACCG
RM235	AGAAGCTAGGGCTAACGAAC	TCACCTGGTCAGCCTCTTTC
Indel12-2	CACGCACCTTTCTGGCTTTCAGC	AGCAACCTCCGACGGGAGAAGG
Indel12-4	TATGGGTCATAACTGAGCCACTCC	CACGTACACCTACTTCTTGCTTGC
Indel12-7	AATAGCTGCATATACCCGGTTGG	TGTGTCTCTGATGATCCGTTTCG
Indel12-10	CGAACACCTTCCTTGTTTCTTCG	AGAAGACGACGACTCCACCAACC
Indel12-13	GCATGACCAATGAGGAAACATGG	CGTCGTCTCCTTCGATTTATTCTCC
Indel12-16	TCACTCACTCACTCAAGCCAAGC	TCTGGATGGTGTCCTTGATCTCC
Indel12-19	CGCAGTGTATTTGTTGTAGCTCTCG	CCACAATACACAGGACATTGATGC
Indel12-23	GAGGTGATCTTAATGCCATCTTGACG	TACATGCAACCTGGGTATGAGAGTGC
Indel12-25	CAGATGTGGTAAACTGGTAAGAGC	TAGCCTGGGTTCTACTTGTCC
Indel12-28	ATCGTGAACACCTCCATGACAGC	ACCTACAAGGTCGCTCGCTACATCC
Indel12-30	CCTAGGTGGTTGTGTTCTGTTTGG	CGTCACCTCTTAAGTCAACACATCG
Indel12-33	AGCATGAGACCCACATATCAGC	CCTATCTTAGAGTGCCATCTAGTTCC
Indel12-37	AGTTTAGTCCGTTTCACGAG	ATTGCTCTCTTCTTGGAATG
Indel12-39	CTCTAGCTTCTTGCTCTTCG	CTCACCTTCTTCAAGCTCC

). The results showed that the SPL11-1 gene was located between the molecular markers Indel12-10 and Indel12-13 with a physical distance of 677 kb (Figure 4b and Table 3).

To further delimit the SPL11-1 genomic region, 4 Indel polymorphic markers from 10 new markers were selected between the two molecular markers Indel12-10 and Indel12-13. All recombinant genes were genotyped using these four polymorphic markers (Table 3). The results further delimit the genomic region of SPL11-1 between the molecular markers Indel12-28 and Indel12-30 with a physical distance of 82 kb (Figure 4c and Table 3).

To more finely map the SPL11-1 gene, 3 polymorphic Indels were selected from 10 new Indels (Table 3). Recombination screening performed using five markers, i.e., Indel12-28, Indel12-33, Indel12-37, Indel12-39, and Indel12-30, located inside the 82 kb genomic region of the SPL11-1 locus identified 5, 3, 1, 1, and 4 recombinant plants, respectively. Thus, the SPL11-1 gene was precisely mapped within a 27 kb genomic region and is flanked by the Indel12-37 and Indel12-39 markers (Figure 4d).

3.6. Identification of Candidate Genes

The 27 kb genomic sequences spanning the causal locus was annotated to the NCBI Reference Sequence (RefSeq) protein database (http://www.ncbi.nlm.nih.gov/refseq (19 November 2023)) by BLASTX searches. Candidate genes were identified based on two criteria, i.e., (i) they are located within the 27 kb genomic sequences; and (ii) demonstrate a function of parasitism genes. Two candidate genes (LOC_Os12g38210 and LOC_Os12g38220) were identified in this 27 kb genomic region (Figure 4e). According to the available annotation database, the two genes have a corresponding full-length cDNA. LOC_Os12g38210 encodes an E3 ubiquitin ligase protein, and LOC_Os12g38220 encodes an expressed protein.

3.7. Sequence Analyses of SPL11-1 Candidate Genes

To analyze which gene is responsible for the mutant phenotype, we sequenced the two genes in the spl11-1 mutant and ‘Shuangkang77009’ wild type. The sequence alignment revealed that the spl11-1 mutant and wild-type alleles of the LOC_Os12g38210 gene differed only by a 1 bp (T) deletion (Figure 5). The T base deletion caused a frameshift mutation, significantly altering the sequence of the encoded SPL11 protein (spl11), which subsequently impacted its protein structure (Figure 6). Therefore, we hypothesized that the LOC_Os12g38210 gene corresponds to the SPL11-1 gene. The open reading frame (ORF) analysis showed that LOC_Os12g38210 has three exons and two introns (Figure 5). Further analysis revealed that SPL11 encodes an E3 ubiquitin ligase protein [10]. Compared to SPL11, the protein structure of SPL11-1 has undergone significant changes (Figure 6). These results indicate that the SPL11-1 gene is most likely allelic to SPL11.

3.8. Application of the SPL11-1 Gene

The present study delved into the phenotypic and genetic characteristics of the spl11-1 mutant in comparison to the ‘Shuangkang77009’ wild type. Notably, our findings demonstrated a marked enhancement in the spl11-1 mutant’s resistance against bacterial blight (Figure 3). Nevertheless, this improvement was paralleled by a notable decline in crucial agronomic traits, encompassing the number of effective panicles, spikelets per panicle, seed setting rate, and grain yield per plant (Figure 2 and Supplementary Table S1). To further probe the potential of the spl11-1 mutant, we employed EMS mutagenesis as a means of inducing additional mutations. Through meticulous selection and screening processes, we successfully isolated a novel mutant, tentatively designated as spl11-2. Phenotypic analysis disclosed that, aside from the number of effective panicles and grain yield per plant, the spl11-2 mutant did not exhibit any significant differences in other agronomic traits when compared to the ‘Shuangkang77009’ wild type (Figure 2 and Supplementary Table S1). To gain a deeper understanding of the genetic underpinnings of these phenotypic variations, we conducted a sequence analysis of the SPL11 gene in the spl11-2 mutant. Our results indicated that both spl11-1 and spl11-2 mutants harbored identical SPL11 alleles, characterized by a single-base pair (T) deletion in comparison to the wild-type allele (Figure 5). This observation prompted us to hypothesize that the distinct agronomic traits observed between spl11-1 and spl11-2 mutants might stem from the presence of additional mutations in the spl11-2 mutant, located in genomic regions beyond the SPL11 gene.

4. Discussion

4.1. Identification of SPL11-1 Alleles

In this study, EMS was used to mutagenize the rice variety ‘Shuangkang77009’, which is susceptible to bacterial leaf streak disease, to screen for mutant materials with resistance to bacterial leaf streak disease. Through this screening and further propagation of the mutagenized plants, a lesion mimic mutant material spl11-1 with resistance to bacterial leaf streak disease was identified (Figure 1). To further confirm whether the mutation occurred in a single gene, we analyzed the resistance phenotypes of two F₂ populations generated by crossing the EMS-induced mutant with the wild-type ‘Shuangkang77009’. Assuming that the mutation is recessive and the resistance locus determines the resistance phenotype in the susceptible parent ‘Shuangkang77009’, a phenotypic segregation ratio of 3:1 for resistance and susceptibility was expected in the F₂ generation. Through chi-square analysis, the phenotypic segregation ratios of the two F₂ populations did not significantly differ from the expected 3:1 ratio for the resistance and susceptibility of plants in single-trait dominant–recessive inheritance, indicating that the mutation occurred in a single gene locus (SPL11) associated with rice resistance to bacterial leaf streak disease. Additionally, we employed map-based cloning techniques to successfully clone a new allele of SPL11, named SPL11-1 (Table 2 and Figure 4). SPL11 has been reported to confer broad-spectrum resistance to non-specialized pathogens such as Magnaporthe oryzae and Xanthomonas oryzae [27]. Furthermore, SPL11, which encodes a U-box family E3 ubiquitin ligase, has been cloned and functionally characterized [10]. SPL11 has also been reported to negatively regulate SPIN1 and Rbs1 and play a role in regulating rice flowering time [28,29]. Moreover, SPL11 ubiquitinates SPIN6 both in vitro and in vivo, thereby participating in the OsRAC1-associated defense system [30]. Further reports have described the spl11-mediated suppressor of disease symptoms (SDS2), which is the first cloned lesion mimic suppressor mutant gene in rice [11,12]. SDS2 interacts with SPL11, OsRLCK118, and OsRLCK176 to form a plasma membrane-resident protein complex that controls PCD and immune responses in rice [11,12]. In this study, SPL11-1 harbors a single-nucleotide (T) deletion in the second exon (Figure 5), which significantly alters the protein structure of SPL11-1 (Figure 6). Notably, both the spl11-1 mutant and ‘Shuangkang77009’ exhibited resistance to all 12 strains of Magnaporthe oryzae (Table 1). Compared to the wild-type ‘Shuangkang77009’, the spl11-1 mutant showed high resistance to bacterial leaf streak disease, while ‘Shuangkang77009’ was highly susceptible to the disease (Figure 3). Our findings not only support previous studies but also provide new genetic resources for studying rice disease resistance and PCD.

The phenotypic segregation data of the two F₂ populations, which do not deviate significantly from the 3:1 ratio expected for the dominant–recessive inheritance of a monogenic trait, suggest that SPL11 constitutes a major genetic locus controlling bacterial leaf streak resistance in rice. Linkage analysis further located the SPL11-1 locus in the 21.1 cM region on chromosome 12 flanked by the RM4125 and RM235 SSR markers. Genotypic analyses of recombinant F₂ individuals using Indel polymorphic markers further delimited the genomic region of the SPL11-1 locus to 27 kb. Annotation of 27 kb genomic sequences spanning the causal locus to the protein database revealed the presence of two gene orthologs that are likely to be involved in plant disease resistance which may indicate an evolutionary trajectory following rice domestication and natural selection. Sequence analysis of the LOC_Os12g38210 candidate gene revealed only a deletion of a single nucleotide (T) in the spl11-1 mutant compared to the wild-type allele, suggesting that LOC_Os12g38210 corresponds to the SPL11-1 gene that encodes an E3 ubiquitin ligase protein. In addition, the significant changes observed in the protein structure of SPL11-1 further suggest a change in the function of the SPL11 protein (Figure 6), and that the SPL11-1 gene is most likely allelic to SPL11.

4.2. Application Prospects of SPL11-2

In this study, while the spl11-1 mutant exhibited comparable agronomical traits to the ‘Shuangkang77009’ wild type in most aspects, its significantly lower number of effective panicles, number of spikelets/panicle, and seed setting rate led to a remarkable reduction in grain yield compared to the ‘Shuangkang77009’ wild type (Figure 2 and Supplementary Table S1), thereby limiting its breeding potential. Recently, research has revealed the development of a superior allele named rbl1^Δ12 through gene-editing technology targeting rbl1. This allele retains disease resistance while eliminating the lesion mimic phenotype and achieving yield traits comparable to controls [2]. The successful creation of rbl1^Δ12 provides valuable insights and technical approaches for exploring favorable alleles in lesion mimic mutants. To address the issue of low yield in the spl11-1 mutant, we conducted further mutagenesis of the spl11-1 mutant using EMS which resulted in a new mutant, spl11-2. Compared to spl11-1, the spl11-2 mutant demonstrated improved agronomical traits across the board (Figure 2 and Supplementary Table S1). When compared to the ‘Shuangkang77009’ wild type, the spl11-2 mutant only lagged behind in the number of effective panicles, resulting in a slightly lower grain yield/plant (Figure 2 and Supplementary Table S1). In addition, the spl11-2 mutant represents a novel allele of SPL11 that we have identified, with higher breeding potential compared to the spl11-1 mutant. This study contributes a new allele resource for LMMs, suggesting that spl11-2 holds promise for future breeding applications.

In conclusion, our results demonstrate the crucial roles of the SPL11 gene that contribute to a valuable disease resistance trait which represents an essential step towards the efficient application of marker-assisted breeding in the development of rice cultivars with improved resistance to bacterial leaf steak. The results further emphasize the important role of lesion mimic mutants in enhancing disease resistance in rice, particularly against rice blast and bacterial leaf blight. In addition, the results highlight the highly efficient implementation of the forward genetic approach accomplished with map-based cloning for the identification and cloning of novel genes. Further functional analysis studies by overexpression and RNAi approaches are required to further elucidate the molecular function of the SPL11 gene in rice resistance to bacterial leaf streak.

5. Conclusions

We have identified a novel spotted leaf mutant, spl11-1, from a rice population through EMS mutagenesis technology and successfully localized its SPL11-1 gene to a 27 kb region on chromosome 12, delimited by Indel markers. In further studies, we confirmed that SPL11-1 is an allele of the rice spotted leaf gene SPL11. Sequence analysis revealed a single base-pair deletion in SPL11-1 compared to the wild-type ‘Shuangkang77009’, suggesting that this mutation may affect protein function. Although the spl11-1 mutant exhibits enhanced disease resistance, it is also associated with undesirable agronomic traits. To overcome this limitation, we further mutagenized and obtained spl11-2, an allelic mutant with improved agronomic traits and potential for disease-resistant breeding. These findings not only highlight the crucial role of the SPL11 gene in conferring important disease resistance traits in rice but also support the effectiveness of marker-assisted breeding strategies in developing rice varieties resistant to bacterial leaf streak disease. Additionally, our research underscores the importance of lesion mimic mutants in enhancing rice disease resistance, particularly against rice blast and bacterial leaf streak diseases. Furthermore, the results demonstrate the efficiency of forward genetic approaches based on map-based cloning in identifying and cloning novel genes, providing powerful tools for future gene functional studies and crop genetic improvement. Future research will necessitate the use of overexpression and RNAi methods to further elucidate the specific molecular mechanisms of SPL11 in rice resistance to bacterial leaf streak disease.