Next Article in Journal
Preliminary Insights into Sustainable Control of Solanum lycopersicum Early Blight: Harnessing Arbuscular Mycorrhizal Fungi and Reducing Fungicide Dose
Next Article in Special Issue
Prokaryotic Expression of Coat Protein Gene of Grapevine Berry Inner Necrosis Virus and Preparation of Its Polyclonal Antibody
Previous Article in Journal
A New Approach to Differentiate the Causes of Excessive Cadmium in Rice: Soil Cadmium Extractability or Rice Variety
Previous Article in Special Issue
Identification and Molecular Characterization of a 16SrII-A Phytoplasma Associated with Cucumber Phyllody in China
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Agave schidigera Transcriptome Reveals Stress-Responsive Phenylalanine ammonia-lyase Genes in Agave

1
Urban Construction College, Wuchang Shouyi University, Wuhan 430064, China
2
National Key Laboratory for Tropical Crop Breeding, Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, China
3
College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070, China
4
Shanghai Key Laboratory of Plant Functional Genomics and Resources, Shanghai Chenshan Botanical Garden, Shanghai 201602, China
5
School of Tropical Agricultural and Forestry, Hainan University, Danzhou 571737, China
6
School of Life Science and Technology, Wuhan Polytechnic University, Wuhan 430023, China
7
Mlingano Centre, Tanzania Agricultural Research Institute (TARI), Tanga P.O. Box 5088, Tanzania
8
Key Laboratory of Integrated Pest Management on Tropical Crops, Ministry of Agriculture and Rural Affairs, Haikou 571101, China
9
Hainan Key Laboratory for Monitoring and Control of Tropical Agricultural Pests, Haikou 571101, China
10
Sanya Research Institute, Chinese Academy of Tropical Agricultural Sciences, Sanya 572025, China
*
Author to whom correspondence should be addressed.
Agronomy 2024, 14(11), 2520; https://doi.org/10.3390/agronomy14112520
Submission received: 22 August 2024 / Revised: 11 October 2024 / Accepted: 24 October 2024 / Published: 26 October 2024
(This article belongs to the Special Issue Molecular Advances in Crop Protection and Agrobiotechnology)

Abstract

:
Agave is a significant fiber crop in tropical regions, known for its high fiber strength. Lignin is closely associated with fiber strength, and phenylalanine ammonia-lyase (PAL) serves as the initial enzyme in biosynthesis of lignin. Hence, it is of considerable significance to study the genes of PAL family to analyze the characteristics and mechanism of sisal fiber development. In this research, we conducted a transcriptomic analysis of Agave schidigera, a widely recognized ornamental plant in agave. Approximately 29.85 million clean reads were acquired through Illumina sequencing. In total, 116,602 transcripts including 72,160 unigenes were assembled, and 22.06~63.56% of those unigenes were annotated in public databases. Two, six, six and six PAL genes were successfully identified and cloned from A. schidigera, A. deserti, A. tequilana and A. H11648, respectively. After phylogenetic analysis, these genes were clustered into two branches. Genes AhPLA2a and AhPLA2c exhibited higher expression levels compared to other genes but had different expression patterns. Moreover, AhPLA2a and AhPLA2c were expressed at high levels under full-nutrient, nitrogen-free and phosphorus-free stresses. Most PAL genes were induced by Phytophthora nicotianae Breda, especially AhPAL1a, AhPAL1b, AhPAL2b and AhPAL2c. This research is the first work to present a de novo transcriptome dataset for A. schidigera, enriching its bioinformation of transcripts. The cloned PAL genes and the expression analyses will form the basis of future research on lignin biosynthesis, the relationship between lignin and fiber strength, and stress resistance in Agave species.

1. Introduction

Agave (Agavaceae) plants are extensively cultivated in tropical regions around the world for their applications in food, beverage, fiber, and pharmaceutical uses [1,2]. Agave is a relatively young genus, estimated to be between 7.8 and 10.1 million years old. It encompasses approximately 210 species, making it the most diverse species in the family Agavaceae [3,4]. They are quintessential CAM (Crassulacean Acid Metabolism) plants, boasting huge biological yield and exhibiting high tolerance to abiotic stresses like drought, cold temperature and elevated heat [5]. Hybrid cultivar A. H11648 is renowned for its robust natural fibers and high tensile strength, and is extensively cultivated in Brazil, Tanzania and Kenya [6,7]. It is also known as “East No. 1” in China, and has been used in production for more than 60 years.
Alternatively, A. schidigera, which is native to Mexico, is not merely an important fiber crop but also possesses ornamental value, making it suitable for gardens or as a potted plant due to its unique morphological traits, with green leaves having curly white hairs on the edges. But the fiber characteristics of A. schidigera are not as favorable as those of A. H11648, hence the former serving as a negative control in the fiber characteristics studies. Sisal fibers are the fibers from the Agave plants. Due to different sources, ages, and measurement methods, there are large variations in the chemical compositions of sisal fibers [8]. Relevant studies indicate that the sisal fiber comprises approximately 43% to 56% cellulose, 7% to 9% lignin, 21% to 24% pentosan and 0.6% to 1.1% ash [9]. Furthermore, studies have shown that the cellulose and lignin contents in sisal can vary between 49.62% and 60.95%, and from 3.75% to 4.40% [8], contingent upon the plant’s developmental stage. Nevertheless, in Agave, the molecular mechanisms governing fiber biosynthesis are still unclear. Up to now, a number of research results concerning fiber characteristics have been reported in Agave plants. In particular, 6 valuable genes associated with fiber traits [10], 9 expansin A genes [11], 24 SAUR family genes [12], and 5 CesA (cellulose synthase A) genes [1] have been revealed and characterized. These studies provide an important basis for the analysis of the Agave fiber synthesis mechanism. However, the large genomes and very long life cycle of these plants have posed significant limitations on genetic research, presenting a big challenge in studying their molecular mechanism of fiber traits. Moreover, studies on the lignin anabolism of Agave have not been reported.
The plant cell wall mainly constitutes cellulose, hemicellulose, pectin, and lignin, along with a minor quantity of proteins and minerals. In a study involving the utilization of corn stalk wastes as reinforcement material for polypropylene (PP), it was demonstrated that the lignin content assumed a crucial role in the intrinsic modulus of the reinforced fiber and directly influenced the ultimate stiffness of the composite [13]. As a potential source of carbon fiber, lignin has attracted the attention of researchers in the field of composite materials, and is also considered a potential biological resource in the fields of concrete additives, thermoplastic materials, and fuel production [14]. Phenylalanine Ammonia-Lyase (PAL, EC 4.3.1.24) is prevalently found in various plants, a few microorganisms and filamentous fungus [15]. It is the first enzyme in the phenylpropanoid pathway that is responsible for regulating the transfer of primary metabolites into the secondary metabolic pathway, including the synthesis of lignin, flavonoids, and various other aromatic metabolites [16,17]. Secondary metabolites can improve plant tolerance to various stresses. Some research results have also confirmed that PAL genes significantly contribute to plant growth, development and tolerance to both biotic and abiotic stresses in the environment [18,19,20].
Consequently, further study of PAL gene family is of considerable significance for analyzing the characteristics and mechanism of sisal fiber strength as well as fiber stiffness and its function in plant growth and stress resistance. It was initially extracted from Hordeum vulgare in 1961. Since then, PAL has been successfully isolated and characterized from various plants, such as Oryza sativa [21], Arabidopsis thaliana [22], bean [23], Nicotiana tabacum [24] and Malus pumila [25]. In recent years, the decipherment of an increasing number of plant genomes and transcriptomes has established the scientific basis for the exploration of the PAL gene family. By employing a bioinformatics-based strategy, a comprehensive analysis has resulted in the identification of 11 GbPAL members of the PAL gene family in Ginkgo [26]. In total, 9 PAL genes from orchids [27] (Apostasia shenzhenica, Dendrobium catenatum and Phalaenopsis equestri), 12 PAL genes in Juglans regia L., 14 StPAL genes in Solanum tuberosum [28] and 8 PAL genes (HbPAL1-HbPAL8) in Hevea brasiliensis [29] were identified using genome-wide bioinformatics analysis. PAL is encoded by a multi-gene family, exhibiting variations observed among different plants. The gene copy number is greater in potatoes, while in species like A. thaliana, O. sativa, Vitis vinifera and N. tabacum, it is comparatively lower [26]. Additionally, we successfully sequenced and obtained full-length transcriptomes of five tissues of Agave leaves by PacBio sequencing [30]. It is the inaugural full-length transcriptome of Agave that constitutes a valuable resource for the identification and characterization of genes in Agave plants.
In this work, we employed Illumina technology to sequence and assemble the leaf transcriptome of A. schidigera, thereby facilitating a comprehensive understanding of gene expression patterns correlated with fiber characteristics. We further conducted a comparative analysis of PAL genes in four Agave species, namely A. H11648, A. schidigera, A. deserti and A. tequilana. The results will offer novel insights into the molecular underpinnings of the underlying lignin traits in Agave. The cloned PAL genes and the expression analyses will provide a basis for future research on lignin biosynthesis, and the relationship between lignin and fiber strength, which is of paramount significance for breeding new Agave varieties with high fiber yield and various resistances against stresses.

2. Materials and Methods

2.1. Plant Materials and Experimental Design

A. schidigera and sisal main cultivar A. H11648 were cultivated and managed normally in the experimental field of Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences (Haikou, Hainan Province, China). Different developmental stages of shoots, unexpanded leaves and expanded leaves (with an angle greater than 45° to the central axis) were separately collected from two-year-old potted A. schidigera plants for transcriptome analysis. Abiotic and biotic stress treatments were carried out on one-year-old A. H11648 plants. In order to study the effect of fertilization on the expression pattern of Agave PAL genes, the following treatments were designed for A. H11648: full-nutrition (F), nitrogen-free (N-), phosphorus-free (P-), and potassium-free (K-) Hoagland nutrient solutions, and sterile water (W). On a different note, zebra disease caused by P. nicotianae Breda is a serious disease that occurs frequently in A. H11648 and has a great impact on its yield and fiber quality [31]. In this study, the young parts of the A. H11648 leaves were inoculated by P. nicotianae Breda through the puncture inoculation approach as the biotic stress [32]. The strain of P. nicotianae Breda utilized for inoculation was previously isolated and preserved in our laboratory. Prior to inoculation, it was imperative to disinfect the inoculated leaves with alcohol, followed by washing them with sterilized water. After the water was completely dried, the leaves were inoculated. The control group merely underwent pricking without inoculation, and sampling was carried out at five days post-inoculation.
Every three A. H11648 individual plants were chosen for each treatment and the negative control, and each A. H11648 strain was repeated for three times. The leaf tissue was collected and promptly frozen in liquid nitrogen for subsequent RNA extraction. The total RNA of collected experimental samples was extracted following the protocol of the Tiangen Biomart RNA extraction kit (Beijing, China). Commercialized RNase-free DNase I (Takara Biomedical Technology, Beijing, China) was used to remove residual DNA from RNA. The RNA was purified and kept in an ultra-low-temperature refrigerator.

2.2. Transcriptome Sequencing, De Novo Assembly and Annotation

Illumina sequencing with the purified RNA samples of A. schidigera was conducted in Genoseq Technology Co., Ltd., located in Wuhan, Hubei province, China. The quality of the extracted RNA was assessed using a NanoDrop 2000 spectrophotometer (Termo Fisher Scientifc, Waltham, MA, USA) and Agilent Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA). Library construction was initiated only when the detection results met the requirements. Once the sample quality and concentration were qualified, the library could be constructed. Firstly, mRNA was enriched with Oligo (dT) magnetic beads.
Then, the mRNA was randomly disrupted through a fragmentation buffer. The mRNA was employed as a template to synthesize the first cDNA strand with six-base random hexamers, followed by the addition of buffer solution dNTPs. The synthesis of the second cDNA strand was carried out using RNase H and DNA polymerase I, followed by purification using AMPure XP beads. Subsequently, the purified double-stranded cDNA underwent end-repair, with the addition of an A-tail and the connection of sequencing joints, with AMPure XP beads being utilized for selecting fragment sizes. The A. schidigera cDNA library was obtained through general PCR technique and agarose gel purification. Qubit 2.0 (Invitrogen, Waltham, MA, USA) was employed for the preliminary quantitative detection of the library, and the Agilent Bioanalyzer 2100 system was utilized to determine the insert size of the library. The library’s effective concentration was precisely measured by qPCR, ensuring it exceeded 2 nM. After the quality assessment, paired-end 150 bp (PE150) sequencing was conducted with the platform of Illumina HiSeq 4000.
The FASTQ-formatted raw data from Illumina sequencing were uploaded into the public Sequence Read Archive (SRA) database [30]. The clean reads were derived through removing the adaptors and low-quality sequences with the help of the Cutadapt and Trimmomatic Version 0.39 software, respectively. The de novo transcriptome of A. schidigera was assembled using Trinity software v2.8.5 (with the parameters --min_kmer_cov2 --min_glue 5), and it was annotated on the basis of some public databases. A total of five databases were selected for functional annotation, namely NCBI non-redundant protein database (NR) [33], Gene Ontology (GO) [34], Kyoto Encyclopedia of Genes and Genomes (KEGG) [35,36], Eukaryotic Ortholog Groups (KOG) [37], and the Swiss-Prot database [38].

2.3. Characterization and Phylogeny of PAL Genes

We employed the PAL sequences Arabidopsis (4) and Oryza sativa (9) to conducte a BLAST [39] search in A. H11648 transcriptome for PAL orthologs in Agave species. ORF-FINDER was used to analyze the coding sequence of the searching genes, and only PAL genes with complete coding sequences were retained for subsequent analysis. Using the complete coding sequences of PAL genes from the A. H11648 transcriptome as the search sequences, homologous sequences of PAL genes were obtained and identified from previously published transcriptomes of A. deserti, A. tequilana [5] and A. schidigera in this work. The full-length PAL gene sequences of Arabidopsis (4), Oryza sativa (9), A. H11648 (6), A. schidigera (2), A. deserti (6) and A. tequilana (6) were aligned for phylogenetic analysis utilizing the ClustalX 2.0 method. A neighbor-joining evolutionary tree was constructed with a bootstrap consensus value derived from 1000 replicates [40].

2.4. Expression Patterns of Agave PAL Genes

Quantitative real-time PCR (qRT-PCR) was employed to test the expression of the Agave PAL genes during different developmental phases, including shoot development, and non-expanding and expanding leaves, and in response to the abiotic and biotic stresses. Using the cDNA obtained by reverse transcription as the template, QuantStudio 6 PCR System (Thermo Fisher Scientific, Waltham, MA, USA) was employed for real-time quantitative PCR analysis. The qRT-PCR reaction mixture totaling 20 µL, comprised 0.5 µL of the forward gene primer (10 µM), 0.5 µL of the reverse gene primer (10 µM), 1 µL of the cDNA template, 10 µL of TransStart Tip Green qPCR Supermix, 0.4 µL of Passive Reference Dye (50×) (Transgen Biotech, Beijing, China) and 7.6 µL of ddH2O. The qRT-PCR procedure consisted of an initial stage of 94 °C for 30 s, 40 cycles of 94 °C 5 s, 58 °C 30 s and a final melt curve analysis. Each sample was subjected to three experimental replications. Six pairs of qRT-PCR primers for Agave PAL genes and two pairs of primers for the phosphatase 2A (PP2A) gene and TUB gene as endogenous genes were designed (Table 1) by Primer v3.0 software [41]. The qRT-PCR results were analyzed through the 2−ΔΔCt method [42].

3. Results

3.1. Transcriptome Analysis of A. schidigera

In the transcriptome sequencing and analysis of A. schidigera, consequently, a total of 29,852,218 clean reads were generated, with a combined length of 8,955,665,400 bp. The GC content of the sequences was 46.77%. Rates of base quality above 20 and 30 were recorded at 98.57% and 96.2%. Exactly 72,160 unigenes were assembled, with a minimum length of 201 bp, an average length of 656.02 bp, a median length of 363 bp and an N50 length of 1082 bp. More than 50% of the unigenes ranged from 201 bp to 400 bp (Figure 1). Approximately 51.52% and 11.34% of the transcript’s sequences were of lengths ≥ 601 bp and ≥2000 bp (additional file1: Table S1), with the retention of the largest sequence being 8949 bp, suggesting a greater likelihood of discovering a homolog with putative functions.
All transcripts were also mapped to the NR, GO, KEGG, KOG and Swiss-Prot databases, and the annotations are shown in Table 2 below and the additional file1 in Table S1. The GO annotation categorizes the function of genes into three main categories: biological processes, cellular components and molecular functions (Figure 2). There are a large number of genes that have been classified into different biological functional processes, including ‘anatomical structure development’, ‘cellular processes’ and ‘metabolic processes’. In particular, the ‘metabolic process’ has the highest number of genes of 3565. The cellular component domain shows that 11,738 genes are involved in the ‘cytoplasm’ and 18,883 are involved in ‘intracellular’ functions. In the molecular function category, a significant number of genes are associated with ‘catalytic activity’ and ‘binding’. The top eight KEGG pathways were found to be ‘Transcription’, ‘Folding, sorting and degradation’, ‘Carbohydrate metabolism’, ‘Transport and catabolism’, ‘Energy metabolism’, ‘Amino acid metabolism’, ‘Translation’ and ‘Lipid metabolism’ (Figure 3). The KOG function classification of transcripts shows that the top eight pathways were ‘Post-translational modification, protein turnover, chaperones’, ’General function prediction only’, ‘Translation, ribosomal structure and biogenesis’, ‘Signal transduction mechanisms’, ‘RNA processing and modification’, ‘Intracellular trafficking, secretion, and vesicular transport’, ‘Transcription’, and ‘Energy production and conversion’ (Figure 4).

3.2. Identification and Cloning of PAL Genes in Agave Species

The PAL genes of Arabidopsis (4) and Oryza sativa (9) [43] were selected for the identification of orthologs within the A. H11648 transcriptome [1] using the TBlastx method [44]. Six genes (AhPAL1a, AhPAL1b, AhPAL1c, AhPAL2a, AhPAL2b, and AhPAL2c) were observed. In addition, the identified genes were utilized to locate orthologs within the transcriptomic datasets of Agave species, encompassing A. schidigera, A. deserti and A. tequilana. Ultimately, two, six and six orthologs with complete coding regions were identified in A. schidigera, A. deserti and A. tequilana, respectively. These whole genes were subsequently amplified in the three Agave species mentioned above, and were named AscPAL1, AscPAL2, AdPAL1a, AdPAL1b, AdPAL1c, AdPAL2a, AdPAL2b, AdPAL2c, AtqPAL1a, AtqPAL1b, AtqPAL1c, AtqPAL2a, AtqPAL2b and AtqPAL2c with the sequence lengths varying from 1818 to 2136 bp (additional file1: Table S2).

3.3. Phylogenetic Analysis of PAL Genes in Agave Species

The 33 PAL genes (referred to in Section 2.3) from Arabidopsis, Oryza sativa and four Agave species were chosen for phylogenetic analysis. Following the analysis, these 33 PAL genes were clustered into two branches (Figure 5). The first branch contain PAL genes from Arabidopsis and rice, while Agave species have PAL sequences clustered in the second branch. The same class of PAL genes from different sisal species were also clustered together.

3.4. Expression Patterns of PAL Genes in A. H11648

To detect expression patterns of PAL genes, six genes (AhPAL1a, AhPAL1b, AhPAL1c, AhPAL2a, AhPAL2b, AhPAL2c) from A. H11648 were selected for further expression analysis. Expression patterns were estimated at different leaf developmental stages (Figure 6). Gene AhPLA2a was highly expressed in the shoot as well as in both unexpanded and expanded leaves. Similarly, the gene AhPLA2c exhibited elevated expression levels in the shoot and unexpanded leaves. The expression levels of gene AhPLA1a, AhPLA1b and AhPLA2a initially increased before experiencing a decrease, while the expression levels of the AhPLA2c gene exhibited a consistent downward trend. Additionally, genes AhPLA1c and AhPLA2b demonstrated low expression levels at all three leaf stages.
In the nutrient deficiency experiment, the full Hoagland nutrient solution was selected as a control (F), while Hoagland nutrient solutions without nitrogen (N-), phosphorus (P-), potassium (K-) and water (W) were used as other treatments. The experimental results indicated that AhPLA2a and AhPLA2c were sensitive to nutrient phosphorus, while other genes were less sensitive under nutrient deficiency treatments (Figure 5). It is worth noting that AhPLA2a and AhPLA2c were expressed at high levels under the full-nutrient, nitrogen-free (N-) and potassium-free (K-) treatments, whereas AhPLA1a, AhPLA1b, AhPLA1c and AhPLA2b were expressed at low levels in each nutrient deficiency treatment.
Guided by the knowledge that A. H11648 is often subjected to pathogenic microorganisms during its growth and development, with P. nicotianae Breda being the most prevalent infectious agent. Our aim was to evaluate the expression of the PAL genes in A. H11684 by inoculating P. nicotianae Breda as one form of biotic stress. The results demonstrated that the expression levels of AhPAL1a, AhPAL1b, AhPAL2b and AhPAL2c increased progressively with the duration of the infection, displaying a significant increase after 48 h. The expression level of AhPAL2a increased first and then decreased, but maintained a high level the whole time. There was no significant expression change in gene AhPAL1c before or after P. nicotiana Breda induction (Figure 6).

4. Discussion

4.1. Characterization of A. schidigera Transcriptome

PAL is the first enzyme of the phenylpropanoid metabolic pathway that exerts a vital role in plant growth, development and environmental adaptability. However, lignin is produced from several metabolites of the phenylpropanoid pathway. Previous studies have affirmed that PAL is directly associated with lignin content [45]. Thus, cloning the PAL gene and analyzing its function in the development of Agave fiber are of great significance for improving the related traits of sisal fiber. Though some chloroplast genomes of Agave were submitted to the GenBank database [6], their large genome and high heterozygosity make them challenging to assemble. The EST sequences of Agave species available in the NCBI database have been limited and scarce, which has impeded the research on the Agave genome and transcriptome, and even the study of the agave fiber development mechanism. Next-generation sequencing (NGS) is an efficient method for acquiring gene sequences in plant species that lack complete genome data. In previous transcriptomic studies of A. H11648 [1], A. deserti [10], A. amanuensis [11], A. angustifolia [46], A. tequilana, and A. sisalana, a collection of potential genes associated with fructans, fiber traits and stress response, were mined and analyzed using Illumina sequencing technology. However, as of now, no genetic sequence or transcriptome information for A. schidigera has been submitted to any public database, which represents a gap that needs to be filled on a molecular basis.
Accordingly, the transcriptome was assembled with 72,160 unigenes, which will serve as the molecular basis for the study of A. schidigera. According to our assembly, the unigene number was higher than that in A. angustifolia (66,314) [46] and A. amaniensis (66,746) [11] but lower than that in A. H11648 (148,046) [1]. Here, we successfully obtained 20 PAL genes from four Agave species with complete coding sequence according to the published transcriptomes of Agave leaves, indicating that the main expression sites of these genes were the leaf. Based on the whole-genome-wide analysis of the Juglans regia L. PAL genes, it is hypothesized that sisal may contain multiple PAL genes [45]. The results of phylogenetic analysis showed that PALs of Agave, Arabidopsis and rice are clustered in different branches or sub-branches, indicating that PAL genes had species-specific evolution. Previous reports have also confirmed the existence of species-specific PAL gene family expansion in Juglans regia and Gramineae [47].

4.2. Candidate PAL Genes in Development of Agave

The genes AhPLA2a and AhPLA2c exhibited high expression levels in the shoot, unexpanded leaf and expanded leaf, though they had different expression patterns (Figure 6). The expression levels of gene AhPLA1a, AhPLA1b, AhPLA2a and AhPLA2b initially increased and subsequently decreased. In ramie, the lignin content of ramie fiber increased gradually from development to maturity, while PAL activity increased first and then decreased. The level of stem lignin development in ramie showed a positive relationship with the expression of genes such as PAL, 4CL1 and C4H within the phenylpropanoid pathway [48]. Sisal leaves were mainly harvested with fully expanded leaves (with an angle greater than 45° to the central axis), and the fibers tended to mature when the leaves were fully unfolded. Therefore, three leaf development stages were selected in this study, corresponding to the first, middle and last three stages of sisal fiber development. During this process, the expression patterns of AhPLA1a, AhPLA1b, AhPLA2a and AhPLA2b in sisal were consistent with those in ramie, indicating that the PAL gene of sisal is closely related to lignin synthesis in sisal.
It was discovered that diverse nitrogen application could enhance the activity of superoxide dismutase (SOD), PAL and polyphenol oxidase (PPO), as well as the expression of defense genes in faba bean [49]. In contrast, in our study, six PAL genes remained insignificantly altered under the nitrogen-free and potassium-free conditions, suggesting post-transcriptional regulation in sisal. While AhPLA2a and AhPLA2c were sensitive to phosphorus nutrient, four other genes (AhPAL1a, AhPAL1b, AhPAL1c, AhPAL2b) were less sensitive under phosphorus deficiency treatments, suggesting that sisal exhibits distinct expression patterns under phosphorus deficiency (Figure 6).

4.3. PAL Genes in Biotic/Abiotic Resistance

Meanwhile, some studies have shown that the rice genome encompasses nine PAL genes, among which OsPAL4 is implicated in mediating broad-spectrum resistance to various fungal diseases [50]. In our research, most of the PAL genes of sisal were significantly up-regulated subsequent to infection by P. nicotianae Breda (Figure 6). Sisal PALs may play a role in the biosynthetic processes of secondary metabolites associated with disease resistance in the phenylpropanoid pathway, as well as in immunity mediated by plant cell walls. Nevertheless, how the PAL genes participate in the disease resistance mechanism by regulating the phenylpropanoid metabolic pathway remains elusive and needs to be further investigated.
Phenylalanine ammonia-lyase (PAL) serves as a crucial enzyme for regulating the transfer of primary metabolites into the secondary metabolic pathway that plays a significant role in the defense mechanisms of plants against pathogens and other forms of insect resistance [51]. On the invasion of pathogens and insects, the configuration of the plant cell wall is compromised easily. In such a situation, the plant triggers an innate defense mechanism and restores its impaired structure caused by its undermined integrity [52]. Additionally, the PAL genes govern lignin biosynthesis for cell wall repair and participate in the synthesis of numerous secondary metabolites related to defense-related phytohormone salicylic acid (SA) and flavonoid-type phytoalexins sakuranetin and naringenin [53].
It is well known that soil pollution is a global problem; however, most solutions are too expensive for large-scale applications or may lead to secondary pollution [54]. In contrast to conventional techniques like chemical solidification, stabilization, or soil washing, phytoremediation is characterized by its low invasiveness and cost-effectiveness. In a study regarding the potential of soil remediation by different plants in mine, A. americana demonstrated a strong enrichment of metals such as Cd, Cr, Pb and Cu aboveground, underground, and in the rhizosphere of soils. Moreover, its biomass and phenotype were not significantly influenced, suggesting that this Agave plant has high tolerance to heavy metals [55]. The Agave plant has very strong tolerance to heavy metals stresses, which is closely related to the secondary metabolites in it, and PAL is the initial enzyme of secondary metabolites. Thus, the study of this PAL gene family is crucial for the future analysis of the mechanism of heavy metal resistance.

5. Conclusions

This research presents a study on the A. schidigera, a prominent fiber crop in tropical regions, and provides the first comprehensive transcriptome data for A. schidigera, revealing 72,160 unigenes and acting as a rich resource for understanding lignin traits in Agave species. The identification and expression pattern analysis of PAL genes may not only deepen the research on the development mechanism of sisal fiber but also enhance the understanding of the disease resistance mechanism in sisal. The up-regulation of PAL genes in response to biotic and abiotic stresses indicates their role in the plant’s defense mechanisms, potentially through the regulation of secondary metabolite biosynthesis by PAL genes. The distinct expression patterns of PAL genes in different developmental stages and under nutrient deficiencies indicate the complexity of their regulation and their significance in the adaptation of Agave species to their environment. The research results will lay a molecular basis for future research on lignin biosynthesis, the relationship between lignin and fiber strength, and stress resistance in Agave species. The results will also provide a basis for breeding sisal varieties with high fiber quality and strong stress resistance, and even support potential applications in heavy metal adsorption and soil remediation work.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agronomy14112520/s1, Table S1: Annotations of all transcripts; Table S2: Identification and cloning of agave PAL genes.

Author Contributions

Conceptualization, X.W., X.H. (Xiaoli Hu) and X.H. (Xing Huang); methodology, X.W., X.H. (Xiaoli Hu), C.L., Q.L., Y.L. and X.H. (Xing Huang); software, X.W., Y.L., D.D. and X.H. (Xing Huang); formal analysis, X.W., X.H. (Xiaoli Hu), D.D., W.Z. and X.H. (Xing Huang); investigation, X.W., X.H. (Xiaoli Hu), Y.L. and W.Z.; resources, C.L. and Q.L.; writing—original draft preparation, X.W.; writing—review and editing, D.M., X.H. (Xing Huang) and K.Y.; supervision, K.Y.; project administration, X.H. (Xing Huang) and K.Y.; funding acquisition, X.H. (Xing Huang) and K.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Hainan Provincial Natural Science Foundation of China (323RC544), National Natural Science Foundation of China (32001598), China Agriculture Research System of MOF, MARA (CARS-16) and Central Public-interest Scientific Institution Basal Research Fund (1630042022005), Scientific research plan of Education Department of Hubei Province of China (B2023360).

Data Availability Statement

All data are contained within the article or Supplementary Materials.

Acknowledgments

We would like to thank Xiaohan Yang from Oak Ridge National Laboratory (Oak Ridge, TN 37831, USA) for his thorough suggestions about the experiment’s design.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Huang, X.; Xiao, M.; Xi, J.; He, C.; Zheng, J.; Chen, H.; Yi, K. De novo transcriptome assembly of Agave H11648 by Illumina sequencing and identification of cellulose synthase genes in Agave species. Genes 2019, 10, 103. [Google Scholar] [CrossRef] [PubMed]
  2. Bermudez-Bazan, M.; Castillo-Herrera, G.A.; Urias-Silvas, J.E.; Escobedo-Reyes, A.; Estarron-Espinosa, M. Hunting bioactive molecules from the Agave genus: An update on extraction and biological potential. Molecules 2021, 26, 6789. [Google Scholar] [CrossRef] [PubMed]
  3. Good-Avila, S.V.; Souza, V.; Gaut, B.S.; Eguiarte, L.E. Timing and rate of speciation in Agave (Agavaceae). Proc. Natl. Acad. Sci. USA 2006, 103, 9124–9129. [Google Scholar] [CrossRef] [PubMed]
  4. Lopez-Romero, J.C.; Ayala-Zavala, J.F.; Gonzalez-Aguilar, G.A.; Pena-Ramos, E.A.; Gonzalez-Rios, H. Biological activities of Agave by-products and their possible applications in food and pharmaceuticals. J. Sci. Food Agric. 2018, 98, 2461–2474. [Google Scholar] [CrossRef]
  5. Gross, S.M.; Martin, J.A.; Simpson, J.; Abraham-Juarez, M.J.; Wang, Z.; Visel, A. De novo transcriptome assembly of drought tolerant CAM plants, Agave deserti and Agave tequilana. BMC Genom. 2013, 14, 563. [Google Scholar] [CrossRef]
  6. Xu, B.; Tan, S.; Qin, X.; Huang, X.; Xi, J.; Chen, H.; Yi, K. The complete chloroplast genome of Agave amaniensis (Asparagales: Asparagaceae: Agavoideae). Mitochondrial DNA B Resour. 2022, 7, 1519–1521. [Google Scholar] [CrossRef]
  7. Lu, Z.; Hou, X.; Ke, Z.; Zhang, Y.; Yang, Z.; Zhou, W. A newly identified glycosyltransferase AsRCOM provides resistance to purple curl leaf disease in agave. BMC Genom. 2023, 24, 669. [Google Scholar] [CrossRef]
  8. Li, Y.; Mai, Y.; Ye, L. Sisal fibre and its composites: A review of recent developments. Compos. Sci. Technol. 2000, 60, 2037–2055. [Google Scholar] [CrossRef]
  9. Schultz, T.P.; Narayan, R.; Rowell, R.M. Emerging Technologies for Materials and Chemicals from Biomass; American Chemical Society: Washington, DC, USA, 1992. [Google Scholar]
  10. Huang, X.; Wang, B.; Xi, J.; Zhang, Y.; He, C.; Zheng, J.; Yi, K. Transcriptome comparison reveals distinct selection patterns in domesticated and wild Agave species, the important CAM plants. Int. J. Genom. 2018, 2018, 5716518. [Google Scholar] [CrossRef]
  11. Wang, X.; Huang, X.; Chen, L.; Xie, Z.; Tan, S.; Qin, X.; Yi, K. Transcriptome sequencing of Agave amaniensis reveals shoot-related expression patterns of Expansin A genes in Agave. Plants 2023, 12, 2020. [Google Scholar] [CrossRef]
  12. Deng, G.; Huang, X.; Xie, L.; Tan, S.; Gbokie, T.J.; Bao, Y.; Yi, K. Identification and expression of SAUR genes in the CAM Plant Agave. Genes 2019, 10, 555. [Google Scholar] [CrossRef] [PubMed]
  13. Serra-Parareda, F.; Tarres, Q.; Espinach, F.X.; Vilaseca, F.; Mutje, P.; Delgado-Aguilar, M. Influence of lignin content on the intrinsic modulus of natural fibers and on the stiffness of composite materials. Int. J. Biol. Macromol. 2020, 155, 81–90. [Google Scholar] [CrossRef] [PubMed]
  14. Chatterjee, S.; Saito, T. Lignin-derived advanced carbon materials. ChemSusChem 2015, 8, 3941–3958. [Google Scholar] [CrossRef]
  15. Lin, W.; Liu, A.; Weng, C.; Li, H.; Sun, S.; Song, A.; Zhu, H. Cloning and characterization of a novel phenylalanine ammonia-lyase gene from Inonotus baumii. Enzym. Microb. Technol. 2018, 112, 52–58. [Google Scholar] [CrossRef] [PubMed]
  16. Huang, X.; Bai, X.; Xie, Z.; Fahad, S.; Gbokie, T., Jr.; Lu, Y.; Guo, T.; Li, J.; Zhang, Z.; Wu, W.; et al. De novo transcriptome assembly of Coffea liberica reveals phylogeny and expression atlas of phenylalanine ammonia-lyase genes in Coffea species. Ind. Crops Prod. 2023, 192, 116029. [Google Scholar] [CrossRef]
  17. Rohde, A.; Morreel, K.; Ralph, J.; Goeminne, G.; Hostyn, V.; De Rycke, R.; Boerjan, W. Molecular phenotyping of the pal1 and pal2 mutants of Arabidopsis thaliana reveals far-reaching consequences on phenylpropanoid, amino acid, and carbohydrate metabolism. Plant Cell. 2004, 16, 2749–2771. [Google Scholar] [CrossRef]
  18. Wu, X.; Cui, Z.; Li, X.; Yu, Z.; Lin, P.; Xue, L.; Yu, F. Identification and characterization of PAL genes involved in the regulation of stem development in Saccharum spontaneum L. BMC Genom. Data 2024, 25, 38. [Google Scholar] [CrossRef]
  19. Zhang, H.; Zhang, X.; Zhao, H.; Hu, J.; Wang, Z.; Yang, G.; Wan, H. Genome-wide identification and expression analysis of phenylalanine ammonia-lyase (PAL) family in rapeseed (Brassica napus L.). BMC Plant Biol. 2023, 23, 481. [Google Scholar] [CrossRef]
  20. Huang, J.; Gu, M.; Lai, Z.; Fan, B.; Shi, K.; Zhou, Y.H.; Chen, Z. Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress. Plant Physiol. 2010, 153, 1526–1538. [Google Scholar] [CrossRef]
  21. Minami, E.; Ozeki, Y.; Matsuoka, M.; Koizuka, N.; Tanaka, Y. Structure and some characterization of the gene for phenylalanine ammonia-lyase from rice plants. Eur. J. Biochem. 1989, 185, 19–25. [Google Scholar] [CrossRef]
  22. Wanner, L.A.; Li, G.; Ware, D.; Somssich, I.E.; Davis, K.R. The phenylalanine ammonia-lyase gene family in Arabidopsis thaliana. Plant Mol. Biol. 1995, 27, 327–338. [Google Scholar] [CrossRef] [PubMed]
  23. Elkind, Y.; Edwards, R.; Mavandad, M.; Hedrick, S.A.; Ribak, O.; Dixon, R.A.; Lamb, C.J. Abnormal plant development and down-regulation of phenylpropanoid biosynthesis in transgenic tobacco containing a heterologous phenylalanine ammonia-lyase gene. Proc. Natl. Acad. Sci. USA 1990, 87, 9057–9061. [Google Scholar] [CrossRef] [PubMed]
  24. Reichert, A.I.; He, X.Z.; Dixon, R.A. Phenylalanine ammonia-lyase (PAL) from tobacco (Nicotiana tabacum): Characterization of the four tobacco PAL genes and active heterotetrameric enzymes. Biochem. J. 2009, 424, 233–242. [Google Scholar] [CrossRef] [PubMed]
  25. Lister, C.E.; Lancaster, J.E.; Walker, J.R.L. Phenylalanine ammonia-lyase (PAL) activity and its relationship to anthocyanin and flavonoid levels in New Zealand-grown apple cultivars. J. Am. Soc. Hortic. Sci. 1996, 2, 281–285. [Google Scholar] [CrossRef]
  26. Gao, X.; Hu, Y.; Xu, Z.; Peng, D.; Guo, Q. Expression profiling of the phenylalanine ammonia-lyase (PAL) gene family in ginkgo biloba L. Plant Signal. Behav. 2023, 18, 2271807. [Google Scholar] [CrossRef]
  27. Vishwakarma, S.K.; Singh, N.; Kumaria, S. Genome-wide identification and analysis of the PAL genes from the orchids Apostasia shenzhenica, Dendrobium catenatum and Phalaenopsis equestris. J. Biomol. Struct. Dyn. 2023, 41, 1295–1308. [Google Scholar] [CrossRef]
  28. Mo, F.; Li, L.; Zhang, C.; Yang, C.; Chen, G.; Niu, Y.; Chen, Y. Genome-wide analysis and expression profiling of the phenylalanine ammonia-lyase gene family in Solanum tuberosum. Int. J. Mol. Sci. 2022, 23, 6833. [Google Scholar] [CrossRef]
  29. Liu, H.; He, Q.; Hu, Y.; Lu, R.; Wu, S.; Feng, C.; Wang, Z. Genome-wide identification and expression profile analysis of the phenylalanine ammonia-lyase gene family in Hevea brasiliensis. Int. J. Mol. Sci. 2024, 25, 5052. [Google Scholar] [CrossRef]
  30. Huang, X.; Hu, X.; Liu, Q.; Xie, Z.; Tan, S.; Qin, X.; Yi, K. Full-length agave transcriptome reveals candidate glycosyltransferase genes involved in hemicellulose biosynthesis. Int. J. Biol. Macromol. 2024, 274, 133508. [Google Scholar] [CrossRef]
  31. Gao, J.; Luoping; Guo, C.; Li, J.; Liu, Q.; Chen, H.; Yi, K. AFLP analysis and zebra disease resistance identification of 40 sisal genotypes in China. Mol. Biol. Rep. 2012, 39, 6379–6385. [Google Scholar] [CrossRef]
  32. Wang, P.; Gao, J.; Yang, F.; Zheng, J.; Liu, Q.; Chen, H.; Yi, K. Transcriptome of sisal leaf pretreated with Phytophthora nicotianae Breda. Chin. J. Trop. Crops 2014, 35, 576–582. [Google Scholar]
  33. Pruitt, K.D.; Tatusova, T.; Maglott, D.R. NCBI reference sequence (RefSeq): A curated non-redundant sequence database of genomes, transcripts and proteins. Nucleic Acids Res. 2005, 33, D501–D504. [Google Scholar] [CrossRef]
  34. Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Sherlock, G. Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [PubMed]
  35. Ogata, H.; Goto, S.; Sato, K.; Fujibuchi, W.; Bono, H.; Kanehisa, M. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 1999, 27, 29–34. [Google Scholar] [CrossRef]
  36. Kanehisa, M.; Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef] [PubMed]
  37. Tatusov, R.L.; Fedorova, N.D.; Jackson, J.D.; Jacobs, A.R.; Kiryutin, B.; Koonin, E.V.; Natale, D.A. The COG database: An updated version includes eukaryotes. BMC Bioinformatics 2003, 4, 41. [Google Scholar] [CrossRef] [PubMed]
  38. Bairoch, A.; Apweiler, R. The SWISS-PROT protein sequence database: Its relevance to human molecular medical research. J. Mol. Med. 1997, 75, 312–316. [Google Scholar] [PubMed]
  39. Mount, D.W. Using the basic local alignment search tool (BLAST). CSH Protoc. 2007, 2007, pdb.top17. [Google Scholar] [CrossRef]
  40. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Higgins, D.G. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef]
  41. Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interface. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
  42. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  43. Yu, X.Z.; Fan, W.J.; Lin, Y.J.; Zhang, F.F.; Gupta, D.K. Differential expression of the PAL gene family in rice seedlings exposed to chromium by microarray analysis. Ecotoxicology 2018, 27, 325–335. [Google Scholar] [CrossRef] [PubMed]
  44. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
  45. Lu, J.; Shi, Y.; Li, W.; Chen, S.; Wang, Y.; He, X.; Yin, X. RcPAL, a key gene in lignin biosynthesis in Ricinus communis L. BMC Plant Biol. 2019, 19, 181. [Google Scholar] [CrossRef]
  46. Huang, X.; Xu, B.; Tan, S.; Huang, Y.; Xi, J.; Qin, X.; Yi, K. Transcriptome sequencing of Agave angustifolia reveals conservation and diversification in the expression of cinnamyl alcohol dehydrogenase genes in Agave Species. Agriculture 2022, 12, 1003. [Google Scholar] [CrossRef]
  47. Yan, F.; Li, H.; Zhao, P. Genome-wide identification and transcriptional expression of the PAL gene family in common walnut (Juglans Regia, L.). Genes 2019, 10, 46. [Google Scholar] [CrossRef]
  48. Tang, Y.; Liu, F.; Xing, H.; Mao, K.; Chen, G.; Guo, Q.; Chen, J. Correlation analysis of lignin accumulation and expression of key genes involved in lignin biosynthesis of ramie (Boehmeria nivea). Genes 2019, 10, 389. [Google Scholar] [CrossRef]
  49. Hu, B.; Zheng, Y.; Wang, D.; Guo, Y.; Dong, Y. Managing faba bean wilt disease through intercropping with wheat and reasonable nitrogen application: Enhancing nutrient absorption and biochemical resistance in faba beans. Physiol. Mol. Biol. Plants 2014, 30, 1029–1046. [Google Scholar] [CrossRef]
  50. Wang, R.; Wang, G.L.; Ning, Y. PALs: Emerging key players in broad-spectrum disease resistance. Trends Plant Sci. 2019, 24, 785–787. [Google Scholar] [CrossRef]
  51. He, J.; Liu, Y.; Yuan, D.; Duan, M.; Liu, Y.; Shen, Z.; Wan, J. An R2R3 MYB transcription factor confers brown planthopper resistance by regulating the phenylalanine ammonia-lyase pathway in rice. Proc. Natl. Acad. Sci. USA 2020, 117, 271–277. [Google Scholar] [CrossRef]
  52. Bacete, L.; Melida, H.; Miedes, E.; Molina, A. Plant cell wall-mediated immunity: Cell wall changes trigger disease resistance responses. Plant J. 2018, 93, 614–636. [Google Scholar] [CrossRef] [PubMed]
  53. Duan, L.; Liu, H.; Li, X.; Xiao, J.; Wang, S. Multiple phytohormones and phytoalexins are involved in disease resistance to Magnaporthe oryzae invaded from roots in rice. Physiol Plant. 2014, 152, 486–500. [Google Scholar] [CrossRef] [PubMed]
  54. Jiang, M.; Wang, K.; Wang, Y.; Zhao, Q.; Wang, W. Technologies for the cobalt-contaminated soil remediation: A review. Sci. Total Environ. 2022, 813, 151908. [Google Scholar] [CrossRef] [PubMed]
  55. Niu, X.; Jia, Y.; Wu, X.; Wang, S.; Hou, J.; Zhang, W. Phytoremediation potential of indigenous plants growing in soils affected by mine activities in Gejiu City, Yunnan Province. Int. J. Phytoremediation 2023, 25, 880–888. [Google Scholar] [CrossRef]
Figure 1. The length distribution of all transcripts. The chart presents data categorized by DNA sequence lengths of all transcripts (bp). The sequences are grouped into the following length ranges: 201–400, 401–600, 801–1000, 1001–1200, 1201–1400, 1401–1600, 1601–1800, 1801–2000, and greater than 2000. The y-axis, labeled as “count”, indicates the number of sequences within each length category.
Figure 1. The length distribution of all transcripts. The chart presents data categorized by DNA sequence lengths of all transcripts (bp). The sequences are grouped into the following length ranges: 201–400, 401–600, 801–1000, 1001–1200, 1201–1400, 1401–1600, 1601–1800, 1801–2000, and greater than 2000. The y-axis, labeled as “count”, indicates the number of sequences within each length category.
Agronomy 14 02520 g001
Figure 2. GO annotation of all transcripts. The GO annotation categorizes the function of genes into three main categories, denoted by green (biological processes), blue (cellular components), and purple (molecular functions).
Figure 2. GO annotation of all transcripts. The GO annotation categorizes the function of genes into three main categories, denoted by green (biological processes), blue (cellular components), and purple (molecular functions).
Agronomy 14 02520 g002
Figure 3. KEGG annotation of all transcripts.
Figure 3. KEGG annotation of all transcripts.
Agronomy 14 02520 g003
Figure 4. KOG functional classification of the transcripts.
Figure 4. KOG functional classification of the transcripts.
Agronomy 14 02520 g004
Figure 5. Phylogenetic tree of the PAL gene family. The PAL genes of Arabidopsis thaliana (At), Oryza sativa (Os), Agave tequilana (Atq); Agave H11648 (Ah), Agave deserti (Ad) and Agave schidigera (Asc) are marked in blue, green, red, pink, purple and yellow, respectively.
Figure 5. Phylogenetic tree of the PAL gene family. The PAL genes of Arabidopsis thaliana (At), Oryza sativa (Os), Agave tequilana (Atq); Agave H11648 (Ah), Agave deserti (Ad) and Agave schidigera (Asc) are marked in blue, green, red, pink, purple and yellow, respectively.
Agronomy 14 02520 g005
Figure 6. The relative expression of PAL genes in A. H11648 at different leaf developmental stages and under different stresses. Y-axis: expression level. X-axis: L0 (shoot), L1 (unexpanded leaf), L2 (expanded leaf). F (full nutrient), N- (nitrogen free), P- (phosphorus free), K- (potassium free) and W (Sterile water); T0 (Negative control), T1 (P. nicotianae Breda inoculation stress 24 h) and T2 (P. nicotianae Breda inoculation stress 48 h). The relative expression quantities were obtained with PP2A as an endogenous reference gene under the qRT-PCR technique. All data were generated from three biological replicates. The error bar represents the standard error. In each column of the bar charts, L0, F and T0 of the X-axis indicate the control. The expression values of L0, F and T0 were normalized as 1. “*”and “**” demonstrate differences at the 0.05 and 0.01 probability levels, respectively.
Figure 6. The relative expression of PAL genes in A. H11648 at different leaf developmental stages and under different stresses. Y-axis: expression level. X-axis: L0 (shoot), L1 (unexpanded leaf), L2 (expanded leaf). F (full nutrient), N- (nitrogen free), P- (phosphorus free), K- (potassium free) and W (Sterile water); T0 (Negative control), T1 (P. nicotianae Breda inoculation stress 24 h) and T2 (P. nicotianae Breda inoculation stress 48 h). The relative expression quantities were obtained with PP2A as an endogenous reference gene under the qRT-PCR technique. All data were generated from three biological replicates. The error bar represents the standard error. In each column of the bar charts, L0, F and T0 of the X-axis indicate the control. The expression values of L0, F and T0 were normalized as 1. “*”and “**” demonstrate differences at the 0.05 and 0.01 probability levels, respectively.
Agronomy 14 02520 g006
Table 1. Primers utilized for qRT-PCR analysis.
Table 1. Primers utilized for qRT-PCR analysis.
GenesForward Primer (5′-3′)Reverse Primer (5′-3′)Product Size (bp)
AhPAL1aTCGCTCTGCCTCGCCAAGGAGACAGCTCCACCGTCACCTC194
AhPAL1bCTCCTCTCTTCTCCGTTGTGCTCCACCGGCTTCCTGAACTCCC189
AhPAL1cCCTTTCCGTTCCACCTACACAATCTAGTCTTACTGGTCGCTGT226
AhPAL2aCATCAAACACCTCTCGCTCAGCTGCCTGAAATCCCTCACC198
AhPAL2bTCATCCAACGCCTCTCGCTCAGCTGCCTGAAGTCCCTCACC196
AhPAL2cAAAGGCAACTGCGCTGCTAACCAGTCGCTGCTCGCCTTG237
PP2ACCTCCTCCTCCTTCGGTTTGGCCATGAATGTCACCGCAGA235
TUBTTCCCATCACCAAAGGTCTCCGCTCATTGTGGCAGAGATA196
Notes: Primers for Agave PAL genes and endogenous genes were designed by Primer 3 software.
Table 2. Annotation rates of all transcripts against public databases.
Table 2. Annotation rates of all transcripts against public databases.
DatabaseNumber of Transcripts
NR74,117 (63.56%)
GO50,228 (43.08%)
KEGG39,144 (33.57%)
KOG25,721 (22.06%)
Swiss-Prot54,024 (46.33%)
Note: The full names of the public databases were shown in Section 2.2.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, X.; Hu, X.; Lin, C.; Liu, Q.; Li, Y.; Du, D.; Mkapa, D.; Zhang, W.; Huang, X.; Yi, K. Agave schidigera Transcriptome Reveals Stress-Responsive Phenylalanine ammonia-lyase Genes in Agave. Agronomy 2024, 14, 2520. https://doi.org/10.3390/agronomy14112520

AMA Style

Wang X, Hu X, Lin C, Liu Q, Li Y, Du D, Mkapa D, Zhang W, Huang X, Yi K. Agave schidigera Transcriptome Reveals Stress-Responsive Phenylalanine ammonia-lyase Genes in Agave. Agronomy. 2024; 14(11):2520. https://doi.org/10.3390/agronomy14112520

Chicago/Turabian Style

Wang, Xuxia, Xiaoli Hu, Chen Lin, Qingqing Liu, Yubo Li, Dengxiang Du, Dietram Mkapa, Weiyi Zhang, Xing Huang, and Kexian Yi. 2024. "Agave schidigera Transcriptome Reveals Stress-Responsive Phenylalanine ammonia-lyase Genes in Agave" Agronomy 14, no. 11: 2520. https://doi.org/10.3390/agronomy14112520

APA Style

Wang, X., Hu, X., Lin, C., Liu, Q., Li, Y., Du, D., Mkapa, D., Zhang, W., Huang, X., & Yi, K. (2024). Agave schidigera Transcriptome Reveals Stress-Responsive Phenylalanine ammonia-lyase Genes in Agave. Agronomy, 14(11), 2520. https://doi.org/10.3390/agronomy14112520

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop