Abstract
Plant proline-rich proteins (PRPs) are cell wall proteins that are widely distributed in plants. Previous studies have shown that these proteins play a crucial role in adversity stress processes, but their function in the regulation of pollen fertility in rice remains unknown. In this study, we identified that OsPRP1 contains a Pollen_Ole-e_I allergenic structural domain, obtained the OsPRP1 quadruple mutant named osprp1.1/1.2/1.3/1.4, and observed significant reductions in pollen fertility, seed-setting rates, and the deformation and collapse of microspores during the late stages of pollen development. RNA-Seq analysis indicated the down-regulation of genes involved in anther development in osprp1.1/1.2/1.3/1.4, suggesting that OsPRP1 plays a role in regulating pollen fertility. In conclusion, a loss of function in OsPRP1.1/1.2/1.3/1.4 leads to decreased pollen fertility and seeding rates, which not only expands the functional spectrum of plant PRP genes but also provides new theoretical insight into the mechanism of fertility regulation in rice.
1. Introduction
Proline-rich proteins (PRPs), ubiquitously found in plant cell walls, play pivotal roles in maintaining cellular structural stability and resisting adversity stress and biotic stress, among other processes. However, their influence on pollen fertility remains elusive. PRP proteins have been documented in various plants, including Arabidopsis, soybean, and cotton. For instance, SICKLE encodes a PRP protein in Arabidopsis, and mutant plants exhibit enhanced sensitivity to cold and salt stresses when compared to the wild type [1]. AtPRP1 is intricately linked to cell elongation, and its overexpression promotes the elongation of root hairs [2]. Mutations in AtPRP3 lead to aberrant root hair morphology and altered branching, indicating its involvement in root hair morphogenesis [3]. Similarly, AtPRP4 mutant plants exhibit reduced lateral roots, smaller leaves, and suppressed seed growth [4]. The knockdown of AtPRPL1 results in significantly shorter root hairs, whereas its overexpression enhances root hair elongation, indicating its positive regulation in this process [2]. In cotton, most PRP genes are associated with fiber cell development and elongation [5,6]. Recent findings further suggest that PRP in sorghum exhibits numerous methylation and acetylation sites [7], indicating the diverse functions of PRP genes and the need for further exploration.
The rice genome harbors four copies of OsPRP1, named OsPRP1.1, OsPRP1.2, OsPRP1.3, and OsPRP1.4 [8]. At the seedling stage, various factors, including low temperature, growth hormones, and salicylic acid, influence the expression levels of these OsPRP1 copies [8]. Currently, research on PRP1 function primarily focuses on its response to abiotic stresses in rice. Loss-of-function mutant plants of OsPRP1.4 exhibit greater vulnerability to cold stress and lower survival rates when compared to the wild type. When exposed to cold stress, these mutant strains display decreased antioxidant enzyme activities and lower levels of proline, chlorophyll, abscisic acid, and ascorbic acid when compared to the wild type [9]. Furthermore, the overexpression of OsPRP3 significantly enhances cold tolerance by accumulating OsPRP3 protein under cold-treated conditions, thereby improving cell wall integrity. However, this overexpression also leads to serious disorders in the development of floral organs [10].
Anther development is a complex process that relies on the intricate regulation of numerous genes, and any perturbations to these genes can potentially affect pollen fertility. MIL1, for instance, plays a pivotal role in the meiosis of microspore mother cells and the differentiation of anther wall cells [11]. Other genes, such as TDR and EAT1, regulate the programmed cell death (PCD) of the anther tapetum [12,13]. CYP703A3, CYP704B2, OsGELP3, and OsPTC1 are among the key factors that govern the development of the anther surface cuticle and the pollen outer wall [14,15,16,17]. Additionally, OsINP1 and OsDAF1 are crucial for the formation of the pollen germination pore [18]. Allergen genes that are specifically expressed in anthers may be intricately linked to the formation of pollen [19]. Proteins containing the Pollen_Ole-e_I domain can be considered a type of allergen gene [20], leading us to hypothesize that they may be associated with pollen development.
In this study, we discovered that OsPRP1 harbors the allergenic structural domain of Pollen_Ole-e_I. Further investigation revealed a marked decline in pollen fertility and the seeding rate in the OsPRP1 quadruple mutant. Notably, during the later stages of pollen development, microspores exhibited deformation and collapse, while the expression levels of genes associated with rice anther development were down-regulated. These observations strongly indicate that OsPRP1 plays a role in regulating pollen fertility. Unexpectedly, we also observed that the OsPRP1 quadruple mutant influenced the rice plant height. In summary, the knockout of OsPRP1 led to decreased pollen fertility and seeding rates, thereby broadening our understanding of the functions of plant PRPs genes and providing novel theoretical insights for the investigation of rice fertility mechanisms.
2. Materials and Methods
2.1. Sequence Analysis
The sequence numbers correspond to distinct copies of OsPRP1, namely Os10g0150800 (OsPRP1.4), Os10g0150700 (OsPRP1.3), Os10g0150600 (OsPRP1.2), and Os10g0150400 (OsPRP1.1); the sequences were obtained from Rice Genome Annotation Project (http://rice.uga.edu/index.shtml, accessed on 31 October 2011). Utilizing ESPript 3 (https://espript.ibcp.fr/ESPript/ESPript/index.php, accessed on 31 October 2011) [21], we compared the coding sequences and protein sequences. For cis-acting element prediction, we extracted 2000 bp sequences upstream of the ATG of each gene from the rice IRGSP-1.0 reference genome using PlantCARE (https://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 31 October 2011) [22], and the results were subsequently presented using TBtools v2.069. The protein sequences of OsPRP1.4, OsPRP1.3, OsPRP1.2, and OsPRP1.1 were retrieved from the rice IRGSP-1.0 reference genome using DIAMOND version 2.0.13 [23]. The protein functional structure domains were predicted through SMART (https://smart.embl.de/, accessed on 31 October 2011) [24]. We performed an ultra-sensitive comparison with the reference genome using the parameters −e and 1 × 10−5, respectively, to identify homologous protein sequences. The same analysis was conducted for AtPRP1 in the Arabidopsis TAIR10 genome. The phylogenetic relationships were visualized through the construction of a Neighbor-Joining (NJ) evolutionary tree with 1000 bootstrap replications using MEGA 11 [25], and was further optimized with iTOL (https://itol.embl.de/, accessed on 31 October 2011) [26]. For a comprehensive comparison between the rice IRGSP-1.0 and Arabidopsis TAIR10 reference genomes, we employed diamond version 2.0.13. The intra- and intergenomic covariates were analyzed using MCScanX (https://github.com/wyp1125/MCScanX, accessed on 31 October 2011), and the covariance maps were visualized using R 4.4.0 with the circlize package [27].
2.2. Plant Materials and Growth Conditions
Rice (Oryza sativa ssp. japonica) variety 9522 (Wuyun Japonica 7) was used as the wild type (WT) and the background for all subsequent mutants. Using CCTCGAGGACTAGTTCTCCT as the target sequence for OsPRP1, the mutant was obtained using CRISPR/Cas9 technology, as previously described [28]. The primer PRP1-csa9-F: GGCACCTCGAGGACTAGTTCTCCT and PRP1-csa9-R: AAACAGGAGAACTAGTCCTCGAGG were used for the construction of gene-editing vectors. The genetic transformation was completed by Wuhan Boyuan Biotechnology Co., Ltd., Wuhan, China. All mutants were grown in a paddy field in Changsha County, Hunan Province (111°53′~114°5′ E, 27°51′~28°40′ N). The specific primers were used to detect mutations in the different copies shown in Table S1.
2.3. Phenotypic Characterization
The plant height was measured from the above-ground portion to the top of panicle. The mature pollen was stained using I2-KI. Upon reaching maturity, the seeding rate of each individual plant was determined. For each type of mutation, three individual plants were measured. The seed size was measured by Wanshen Rice Appearance and Quality Tester (Wanshen Testing Technology Co., Ltd., Hangzhou, China). The seeds from individual plants were thoroughly mixed, and a total of 100 seeds were randomly chosen for measurement, with each measurement serving as a biological replication.
Microscopic observations of anthers occurred as follows: Glomus flowers were stripped of their glumes, and the intact anthers were carefully removed, fixed in FAA fixative, and processed in a vacuum device until the anthers sank to the bottom of the tube, and follow-up experiments were completed by Wuhan Sevier Technology Co., Ltd. (Wuhan, China). The period of anther development and characteristic morphological judgments were made as previously described [29].
2.4. RNA Extraction and qRT-PCR
Total RNA was isolated from rice tissues (root, stem, leaf, and panicle) at different stages with the Trizol Reagent kit (Invitrogen) according to the manufacturer’s protocol. P3-P8 represents the stages of panicle development as follows: young panicle length 1–2 mm (P3), 5–10 mm (P4), 15–50 mm (P5), 50–100 mm (P6), panicle turning green (P7). Furthermore, 2 μg RNA was reversely transcribed to synthesize first-strand cDNA using the PrimerScriptTM RT reagent Kit with gDNA Eraser (TAKARA, RR047A). The reverse transcription products were used as templates in the following qRT-PCR. The quantitative PCR analysis of OsPRP1.1, OsPRP1.2, OsPRP1.3, and OsPRP1.4 were performed with TB Green Premix Ex TaqTM (TAKARA, RR820A) on the Roch 480 system. Samples were normalized using ACTIN1 expression as described previously [30].
2.5. RNA-Seq Analysis of Anthers in osprp1.2/1.3/1.4
osprp1.1/1.2/1.3/1.4 anthers were subjected to RNA-seq with three biological replicates using wild-type 9522 as a control, and subsequent sequencing was performed by Huada Gene Science and Technology Service Co., Ltd. (Shenzhen, China); further analysis, including the Volcano plot, heatmap clustering, and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis, was performed using BGI Dr. Tom 2.0. Volcano plot with |log2FC| > 1.0 and Q value ≤ 0.5; KEGG analysis with Q value ≤ 0.3. The expression levels of anther development-related genes were analyzed using qRT-PCR, and the primers used were listed in Supplemental Table S2.
3. Results
3.1. Protein Structure Analysis of OsPRP1
The four copies of OsPRP1 are tandemly arranged on chromosome 10. Upon analyzing their sequences, we observed significant similarities not only in their coding sequences but also in their protein sequences (Figures S1 and S2). Specifically, OsPRP1.1 comprises 224 amino acids, while OsPRP1.2, OsPRP1.3, and OsPRP1.4 each contain 229 amino acids. Notably, all four copies possess a signal peptide and a conserved Pollen_Ole-e_I allergenic domain at their N-termini (Figure S2). Subsequent homology analysis comparing OsPRP1 with AtPRP1 from rice and Arabidopsis, respectively, revealed that AtPRP2 exhibited the highest similarity to AtPRP4, both of which harbor signal peptides and the Pollen_Ole-e_I allergenic domain. However, AtPRP1 and AtPRP3, in addition to featuring signal peptides and Pollen_Ole-e_I allergenic domain, also possess an RPT1 domain, distinguishing them from AtPRP2, AtPRP4 (Figure 1a,b). Conversely, the four copies of OsPRP1 clustered together, exhibiting the highest degree of similarity, and were associated with pollen allergen and extended family protein genes such as Os10g0148700, Os10g0150300, and Os07g0484900 (Figure 1a,b).
Figure 1.
Protein structure analysis of PRPs gene in different species. (a) Homology analysis of the PRP1 gene in rice and Arabidopsis using the neighbor-joining (NJ) method with bootstrap replications 1000. (b) Protein domain prediction: the red box signifies the signal peptide, the green box designates the Pollen_Ole-e_I allergenic domain, the yellow box identifies the RPT1 domain, and the black line depicts the remaining amino acid sequences. (c) Collinearity analysis offering a comprehensive comparison between OsPRP1 and AtPRP1 as well as their conserved homologs across the rice and Arabidopsis genomes. The four copies of OsPRP1 marked in red.
Based on a collinearity analysis of OsPRP1 and its homologous genes, it was inferred that OsPRP1 likely underwent gene duplication events on chromosomes 3 and 10 in rice. Interestingly, OsPRP1 and its homologs are clustered on chromosome 10, whereas in Arabidopsis thaliana, this clustering pattern is absent. Instead, AtPRP1 and its homologs are distributed across different chromosomes, with amplification events observed on chromosomes 2, 3, and 4, but without the formation of chromosomal clusters of homologous genes (Figure 1c).
Allergens specifically expressed in pollen play a pivotal role in cell wall organization and metabolic processes, potentially linked to pollen formation and functionality [19]. Upon searching for the Pollen_Ole-e_I domain, we discovered a total of 41 genes in rice harboring this structural domain, six of which have been previously reported: OsPRP1.1, OsPRP1.2, OsPRP1.3, OsPRP1.4, OsPRP3, and COG2. Notably, several of the remaining genes were annotated as pollen allergens and precursors of the stretch protein family (Table S1). Furthermore, our analysis revealed that most of these 41 genes are expressed in spikes and anthers (as per information from NCBI and the Rice Genome Annotation Project website). Based on these observations, we hypothesize that the genes harboring the Pollen_Ole-e_I domain might also contribute to the development of spikes or anthers in rice (Table S1).
3.2. Expression Pattern Analysis of OsPRP1 in Rice
The expression patterns of PRPs genes have been observed to exhibit distinct tissue-specificity and developmental-stage-specificity in soybean and cotton [31,32]. In rice, our analysis of the predicted cis-acting elements within the promoters of the four OsPRP1 copies revealed notable differences among their respective sequences. Specifically, the promoter sequence of OsPRP1.1 contains 24 cis-acting elements, including those responsive to light, MeJA, anaerobic induction, and abscisic acid. Similarly, the promoter of OsPRP1.3 exhibits similar characteristics to that of OsPRP1.1. However, the promoters of OsPRP1.2 and OsPRP1.4 differ significantly from each other and also from those of OsPRP1.1 and OsPRP1.3. The OsPRP1.2 promoter comprises 25 cis-acting elements, including those responsive to light, MeJA, and salicylic acid, while the OsPRP1.4 promoter contains 20 cis-acting elements responsive to light, low temperatures, and seed-specificity. We hypothesize that these differences in cis-acting elements could potentially lead to distinct transcriptional levels of the respective genes (Figure 2a).
Figure 2.
Expression pattern of different copies of OsPRP1. (a) Predictive analysis of promoter elements in different copies of OsPRP1, Os10g0150800 (OsPRP1.4), Os10g0150700 (OsPRP1.3), Os10g0150600 (OsPRP1.2), and Os10g0150400 (OsPRP1.1); (b) Relative expression of different copies of OsPRP1 in the plants tissue. Gene expression was determined by quantitative real-time PCR and was normalized against the expression of Actin1. VR, VS and VL refers to root, stem, and leaf at the vegetative stage; RR, RN, RS and RL refers to root, node, stem and leaf at the reproductive stage; and P3 to P7 represent panicle development length 1–2 mm (P3), 5–10 mm (P4), 15–50 mm (P5), 50–100 mm (P6); panicle turning green (P7).
To investigate the expression tissues, we designed primers and employed qRT-PCR. The results indicated that during the seedling stage, OsPRP1 genes are primarily expressed in the stem. During the reproductive development period, their expression is relatively low in the early stages of spikelet development but significantly increases in the middle and late stages (Figure 2b).
3.3. Mutant Creation and Characterization
Given the remarkable similarity in coding sequences and amino acids among various copies of OsPRP1, we deliberately targeted four common copies for knockout experiments (Figure S1) to achieve diverse editing events and thereby gain insights into the roles of OsPRP1 in anther development in rice. The results were consistent with our expectations, yielding nine editing events, and culminated in the acquisition of six distinct types of mutant plants. Sequencing analysis revealed a quadruple-deletion mutant named osprp1.1/1.2/1.3/1.4, where all four copies led to premature stop codons. Additionally, we observed a triple-deletion mutant in osprp1.2/1.3/1.4, with mutations resulting in premature stop codons except for OsPRP1.1 (OsPRP1.1 lacks only two amino acids). A double-deletion mutant exhibited premature termination in osprp1.1/1.2. We also identified osprp1.4 and osprp1.3, single-copy deletion mutants (that osprp1.1/1.2 self-crossed to obtain). Lastly, a single-copy deletion mutant with premature translation termination in osprp1.2 was observed, where osprp1.4 exhibited heterozygous mutations, and osprp1.1 lacked only two amino acids (Table 1).
Table 1.
Analysis of mutant sequences.
The combination of these diverse mutations provides robust material for subsequent functional studies, thereby enhancing our understanding of the functional roles of rice PRP proteins.
3.4. Quadruple Mutation of OsPRP1 Leads to a Decrease in Plant Height
By analyzing the plant and leaf morphology, we observed that plant height was reduced in osprp1.1/1.2/1.3/1.4 (Figure 3b); the average plant height of the wild type was 83.38 ± 1.19 cm. However, the average plant height of osprp1.1/1.2/1.3/1.4 declined to 76.99 ± 2.56 cm, and there was no significant decrease in the mutants except for osprp1.1/1.2/1.3/1.4 (Figure 3b). In addition, we found that the grain size changed in different copies of OsPRP1 loss-of-function mutants. Compared with the wild type, the average grain length of the wild type was 7.55 ± 0.02 mm, an increase in grain length occurred in osprp1.1/1.2/1.3/1.4 (7.80 ± 0.08 mm) and osprp1.2/1.3/1.4 (7.74 ± 0.07 mm), and a striking increase in grain length occurred in osprp1.1/1.2 (7.94 ± 0.09 mm) and osprp1.2 (7.86 ± 0.07 mm) (Figure 3c,d). As far as grain width was concerned, only osprp1.3 (3.56 ± 0.09 mm) was significantly increased compared to the wild type (3.26 ± 0.06 mm), while the other mutants were similar to the wild type (Figure 3c,e). These results suggest that OsPRP1 plays a role in plant height and grain morphology.
Figure 3.
Identification of agronomic traits of the wild type (WT) and mutants. (a) Identification and analysis of the OsPRP1 quadruple mutant, the gray boxes depict other protein sequences, the green boxes signify Pollen_Ole-e_I allergenic domain, and the yellow boxes indicate the recoded protein sequences. (b) plant morphological character of the WT and mutants. Bars, 20 cm; determination of plant height (c), grain length (d) and grain width (e). Data represent the mean ± SD. *, p < 0.05; **, p < 0.01 from a Student’s t-test.
3.5. Functional Redundancy in Different Copy Variants of OsPRP1 and Abnormal Pollen Development in Quadruple Mutants
To investigate what role the PRP protein plays in the anthers’ development, we carefully observed the mutants and found that the simultaneous deletion of four copies of OsPRP1 significantly affected the pollen fertility in rice. We observed the morphology of the mutant glumes and found that all the mutants had normal development of the floral organs, and the number of pistils, stamens, stigmas and other organs were normal, indicating that the OsPRP1 mutation did not affect the development of floral organs (Figure 4a). Further observation of anther morphology revealed that only in the quadruple mutant osprp1.1/1.2/1.3/1.4 did the anther morphology and leaf color differ significantly from that of the wild type, and anthers of osprp1.1/1.2/1.3/1.4 appeared to be distinctly whitish and wrinkled (Figure 4a). Subsequently, all mutants were tested for pollen stainability rate with I2-KI staining, and the results showed that the pollen stainability rate of the wild type was above 95%, and only the pollen stainability rate of osprp1.1/1.2/1.3/1.4 decreased to 56.91% (Figure 4b). However, the pollen stainability rate of the other mutants was comparable to that of the wild type. The seed setting rates and pollen stainability of the wild type were similarly higher than those of the mutants. The wild type’s seeding rates exceeded 85%, while the rate decreased only to 39.72% in osprp1.1/1.2/1.3/1.4 (Figure 4b,d). These data suggest that a single-copy deletion of OsPRP1 does not affect pollen fertility, but only a simultaneous defect in four copies affects pollen fertility and seed setting rate, and that there is functional redundancy in pollen fertility, and fruiting rate among the individual copies.
Figure 4.
The phenotype analysis of the wild type (WT) and the mutants. (a) Morphological characterization of WT and mutants in anthers. Bars, 1 mm. (b) Pollen stained with I2-KI rate and seeding rate (c), data represent the mean ± SD. **, p < 0.01 from a Student’s t-test. (d) spike morphology and seeding rate demonstration. Bars, 5 cm. (e) Microscopic observation of anthers, corresponding to stages 11 to stages 13 of anther development from left to right. Bars, 50 μm.
In order to further substantiate the cause behind the decline in the stainability rate of osprp1.1/1.2/1.3/1.4 pollen, we conducted microscopic observations on its anther developmental process. Our findings revealed that during the stage of mature pollen, the wild type exhibited rounded pollen grains within the anther chamber, whereas the osprp1.1/1.2/1.3/1.4 pollen displayed deformities and collapse (Figure 4e). This observation suggests that the development of osprp1.1/1.2/1.3/1.4 pollen is impaired, potentially resulting in a reduction in its stainability rate.
3.6. Anther Development-Related Genes Were Down-Regulated in OsPRP1 Quadruple Mutant
To analyze transcription in anthers of osprp1.1/1.2/1.3/1.4, we performed RNA-seq analysis and found that there were 1134 differential genes in the mutant compared with the wild type. Of these, 887 genes (78.2%) were down-regulated, while 247 genes (21.8%) were up-regulated (Figure 5a). Further KEGG pathway enrichment analysis revealed that the differentially expressed genes were primarily concentrated in inositol phosphate metabolism, endocytosis, pentose and glucuronate interconversions, as well as the phosphatidylinositol signaling system (Figure 5b).
Figure 5.
RNA-Seq analysis in the osprp1.1/1.2/1.3/1.4. (a) Distribution of differential genes; (b) differential gene KEGG enrichment analysis; (c) comparison of expression levels of anther development-related genes in the wild type and osprp1.1/1.2/1.3/1.4.
A large number of genes involved in anther development were down-regulated in osprp1.1/1.2/1.3/1.4; among them were RTS, an expression gene associated with anther development [33]; OsINV4, a cell wall invertase associated with anthers [34,35]; and OsMS1 [17], a persistent tapetal cell gene (Figure 5c). Additionally, we found that the expression levels of sugar transporter protein-related genes OsSWEETs and OsMSTs were also altered to varying degrees. qRT-PCR analysis with RNA from osprp1.1/1.2/1.3/1.4 anthers indicated that anther development-related genes (OsMS1, OsDPW) and sugar transporter protein-related genes (OsMST3, OsMST5, OsMST8, OsSWEET5, OsSWEET15) and OsTMT2 were significantly down-regulated in osprp1.1/1.2/1.3/1.4 (Figure 6). Those results confirm that OsPRP1 is involved in regulating the expression of anther development-related genes.
Figure 6.
The expression of anther development-related genes. Error bars indicate standard deviation of three biological replicates; *, p < 0.05; **, p < 0.01 from a Student’s t-test.
4. Discussion
The development of anthers is an intricate and delicate process that is closely linked to the fertility and reproductive behavior of the plant. Four copies of OsPRP1 are found in the rice genome, exhibiting high similarity with genes related to pollen allergens and extended protein family proteins (Figure 1). These genes are clustered together on rice chromosome 10. Based on our hypothesis, OsPRP1.1, OsPRP1.2, OsPRP1.3, OsPRP1.4 and its associated genes play a pivotal role in maintaining or enhancing the normal function of certain genes during rice growth and development, ultimately resulting in an amplification of the rice genome. Previous studies have shown that pollen allergen genes have a higher rate of gene duplication events than other genes and may play crucial roles in plants throughout evolution [19]. This may partly explain why four copies of OsPRP1 exist in the rice genome.
Studies on soybean and cotton have revealed significant tissue-specific and developmental-stage-specific expression of PRP genes [31,32]. However, in contrast to these findings, OsPRP1 exhibits little significant tissue-specific differentiation in the expression of its four copies, despite variations in their promoter sequences. We postulate that the expression of OsPRP1 is contingent upon specific environmental or physiological conditions. During the vegetative stage, OsPRP1.1 is predominantly expressed in the roots and stems, potentially serving as a cell wall protein that maintains the structural integrity of cells. Moreover, when confronted with environmental stressors such as low temperatures or abiotic stresses, OsPRP1 enhances the plant’s resilience by maintaining the integrity of its cell walls. Previous studies have shown that OsPRP3 overexpression enhances the cold tolerance of plants by preserving the integrity of the cell wall [10], indicating that OsPRP1 plays a role in promoting normal anther development.
Through a thorough analysis of various OsPRP1 mutants, it was observed that all mutants exhibited normal floral organs, indicating that OsPRP1 does not impact floral organs’ formation and development. However, when four copies of OsPRP1 were simultaneously mutated, the anthers of osprp1.1/1.2/1.3/1.4 appeared whitish, and the pollen fertility was reduced compared with the wild type. We hypothesized that the anther development process in osprp1.1/1.2/1.3/1.4 might be defective. Combined with microscopic observations of anther development in osprp1.1/1.2/1.3/1.4, it was observed that the pollen was deformed and collapsed, indicating that OsPRP1 does indeed affect anther development. Subsequently, we analyzed the transcriptome data and found that there are a lot of genes related to anther development, and monosaccharide transport genes were down-regulated in osprp1.1/1.2/1.3/1.4 (Figure 5c and Figure 6). The results of anther RNA-Seq and qRT-PCR showed that genes related to anther development such as OsPTC1/OsMS1 and OsMST8 were down-regulated in the quadruple mutation. OsPTC1/OsMS1 plays a key role in regulating PCD in the tapetum, osms1 exhibits complete male sterility with invisible pollen grains, and the expression of genes related to the PCD process of the tapetum and pollen wall biosynthesis, such as EAT1, AP37, AP25, OsC6, and OsC4, were significantly reduced in osms1 [17]. Cell wall invertases effectively break down sucrose into fructose and glucose within sink organs [36], whereas OsMSTs facilitate the translocation of diverse monosaccharides, including fructose, glucose, and raffinose [37,38]. By modulating the expression of OsMSTs and associated sugar transporter proteins, plants can regulate sugar allocation, thereby significantly impacting sugar delivery to sink organs. OsMST3 may be involved in the accumulation of monosaccharides required for cell wall synthesis during cell thickening [39]. OsMST8 is a direct downstream gene of CSA, which is a photoperiod-sensitive fertility gene, and under short-day conditions, the CSA mutation resulted in an obstacle in sugar allocation during the process of anther development; csa showed complete sterility, and OsMST8 was down-regulated [40]. Recent studies have shown that OsMS1 interacts with TDR to enhance the regulation of expression of downstream genes such as EAT1 [41]. In this study, OsPTC1/OsMS1, OsMST5 and OsMST8 were down-regulated in the quadruple mutation, and this result indicated that the OsPRP1 affects the expression of potentially functional downstream genes and thus exhibits reduced pollen fertility.
In addition, we speculated that OsPRP1 may have undergone functional differentiation during gene duplication. The OsPRP1.3 mutation prompted an increase in grain width; the OsPRP1.2 mutation significantly increased grain length. The changes in these traits are favorable in the crop breeding process and if combined with production applications, beneficial for rice yield traits. Therefore, the potential favorable phenotypes can be subsequently mined for different copy mutants, which is conducive to further expanding our understanding of PRP proteins.
5. Conclusions
In this study, we found that the quadruple mutation in OsPRP1 leads to a significant decline in pollen fertility, reduced seeding rates, and the occurrence of microspore deformation and collapse. The results of the present study revealed that OsPRP1 plays a role in pollen fertility by regulating the expression of anther development-related genes. This finding not only expands the function of plant PRP genes but also provides a new theoretical reference for the study of the mechanisms of rice fertility.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy14061323/s1, Figure S1: Sequence analysis; Figure S2: Protein sequence analysis; Table S1: Genes containing the pollen-Ole-e_I domain in rice; Table S2: Primer list.
Author Contributions
L.L. (Li Li) and J.W. conceived of the project; M.Q. and Z.H. performed the experiments with the help of B.L., Y.L., S.S., L.L. (Lei Li) and M.G.; L.L. (Lei Li) and M.G. analyzed the sequencing data. B.L., Y.L. and S.S. have provided help for the revision of the article. M.Q. and L.L. (Li Li) wrote the manuscript. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Biological Breeding-Major Projects (2023ZD04076), the Special Funds for Construction of Innovative Provinces in Hunan Province (2021NK1002), the Hunan Agricultural Sicence and Technology Innovation Project (No.2022CX116,2022CX84-02), and the Hunan Natural Science Foundation (2023JJ30442).
Data Availability Statement
The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.
Acknowledgments
We are grateful to Chenyang Li and Na Xu for their assistance in sequence analyses and to Qingsong Luo for rice plant growth.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Zhan, X.; Wang, B.; Li, H.; Liu, R.; Kalia, R.K.; Zhu, J.K.; Chinnusamy, V. Arabidopsis Proline-rich Protein Important for Development and Abiotic Stress Tolerance is Involved in MicroRNA Biogenesis. Proc. Natl. Acad. Sci. USA 2012, 109, 18198–18203. [Google Scholar] [CrossRef]
- Boron, A.K.; Van, O.J.; Markakis, M.N.; Mouille, G.; Adriaensen, D.; Verbelen, J.P.; Höfte, H.; Vissenberg, K. Proline-rich Protein Like PRPL1 Controls Elongation of Root Hairs in Arabidopsis thaliana. J. Exp. Bot. 2014, 65, 5485–5495. [Google Scholar] [CrossRef]
- Bernhardt, C.; Tierney, M.L. Expression of AtPRP3, a Proline-rich Structural Cell Wall Protein from Arabidopsis, Is Regulated by Cell-type-specific Developmental Pathways Involved in Root Hair Formation. Plant Physiol. 2000, 122, 705–714. [Google Scholar] [CrossRef]
- Raab, S.; Hoth, S. A Mutation in the AtPRP4 Splicing Factor Gene Suppresses Seed Development in Arabidopsis. Plant Biol. 2007, 9, 447–452. [Google Scholar] [CrossRef]
- Xu, W.L.; Huang, G.Q.; Wang, X.L.; Wang, H.; Li, X.B. Molecular Characterization and Expression Analysis of Five Novel Genes Encoding Proline-rich Proteins in Cotton (Gossypium hirsutum). Prog. Biochem. Biophys. 2007, 34, 509–517. [Google Scholar]
- Xu, W.L.; Zhang, D.J.; Wu, Y.F.; Qin, L.X.; Huang, G.Q.; Li, J.; Li, L.; Li, X.B. Cotton PRP5 Gene Encoding a Proline-rich Protein is Involved in Fiber Development. Plant Mol. Biol. 2013, 82, 353–365. [Google Scholar] [CrossRef]
- Rajasheker, G.; Nagaraju, M.; Varghese, R.P.; Jalaja, N.; Somanaboina, A.K.; Singam, P.; Ramakrishna, C.; Penna, S.; Sreenivasulu, N.; Kavi, K.P.B. Identification and Analysis and Proline-rich Proteins and Hybrid Proline-rich Protein Super Family Genes from Sorghum Bicolor and their Expression Patterns to Abiotic Stress and Zinc Stimuli. Front. Plant Sci. 2022, 13, 952732. [Google Scholar] [CrossRef]
- Wang, R.; Chong, K.; Wang, T. Divergence in Spatial Expression Patterns and in Response to Stimuli of Tandem-repeat Paralogues Encoding a Novel Class of Proline-rich Proteins in Oryza sativa. J. Exp. Bot. 2006, 57, 2887–2897. [Google Scholar] [CrossRef][Green Version]
- Nawaz, G.; Han, Y.; Usman, B.; Liu, F.; Qin, B.X.; Li, R.B. Knockout of OsPRP1, a Gene Encoding Proline Rich Protein, Confers Enhanced Cold Sensitivity in Rice (Oryza sativa L.) at the Seedling Stage. Biosci. Biotechnol. Biochem. 2019, 9, 254. [Google Scholar] [CrossRef]
- Gothandam, K.M.; Nalini, E.; Karthikeyan, S.; Shin, J.S. OsPRP3, a Flower Dpecific Proline-rich Protein of Rice, Determines Extracellular Matrix Structure of Floral Organs and Its Overexpression Confers Cold-tolerance. Plant Mol. Biol. 2010, 72, 125–135. [Google Scholar] [CrossRef]
- Hong, L.L.; Tang, D.; Zhu, K.M.; Wang, K.J.; Li, M.; Cheng, Z.K. Somatic and Reproductive Cell Development in Rice Anther Is Regulated by a Putative Glutaredoxin. Plant Cell 2012, 24, 577–588. [Google Scholar] [CrossRef]
- Li, N.; Zhang, D.S.; Liu, H.S.; Yin, C.S.; Li, X.X.; Liang, W.Q.; Yuan, Z.; Xu, B.; Chu, H.W.; Wang, J.; et al. The Rice Tapetum Degeneration Retardation Gene Is Required for Tapetum Degradation and Anther Development. Plant Cell 2006, 18, 2999–3014. [Google Scholar] [CrossRef]
- Niu, N.N.; Liang, W.Q.; Yang, X.J.; Jin, W.L.; Wilson, Z.A.; Hu, J.P.; Zhang, D.B. EAT1 Promotes Tapetal Cell Death by Regulating Aspartic Proteases during Male Reproductive Development in Rice. Nat. Commun. 2013, 4, 1445. [Google Scholar] [CrossRef]
- Yang, X.J.; Wu, D.; Shi, J.X.; He, Y.; Pinot, F.; Grausem, B.; Yin, C.S.; Zhu, L.; Chen, M.J.; Luo, Z.J.; et al. Rice CYP703A3, a Cytochrome P450 Hydroxylase, is Essential for Development of Anther Cuticle and Pollen Exine. J. Integr. Plant Biol. 2014, 56, 979–994. [Google Scholar] [CrossRef]
- Li, H.; Pinot, F.; Sauveplane, V.; Werck-Reichhart, D.; Diehl, P.; Schreiber, L.; Franke, R.; Zhang, P.; Chen, L.; Gao, Y.W.; et al. Cytochrome P450 Family Member CYP704B2 Catalyzes the ω-Hydroxylation of Fatty Acids and Is Required for Anther Cutin Biosynthesis and Pollen Exine Formation in Rice. Plant Cell 2010, 22, 173–190. [Google Scholar] [CrossRef]
- Zhang, H.H.; Wang, M.L.; Li, Y.Q.; Yan, W.; Chang, Z.Y.; Ni, H.L.; Chen, Z.F.; Wu, J.X.; Xu, C.J.; Deng, X.W.; et al. GDSL Esterase/Lipases OsGELP34 and OsGELP110/OsGELP115 are Essential for Rice Pollen Development. J. Integr. Plant Biol. 2020, 62, 1574–1593. [Google Scholar] [CrossRef]
- Yang, Z.F.; Liu, L.; Sun, L.P.; Yu, P.; Zhang, P.P.; Abbas, A.; Xiang, X.J.; Wu, W.X.; Zhang, Y.X.; Cao, L.Y.; et al. OsMS1 Functions as a Transcriptional Activator to Regulate Programmed. Plant Mol. Biol. 2019, 99, 175–191. [Google Scholar] [CrossRef]
- Zhang, X.; Zhao, G.C.; Tan, Q.; Yuan, H.; Betts, N.; Zhu, L.; Zhang, D.B.; Liang, W.Q. Rice Pollen Aperture Formation is Regulated by the Interplay Between OsINP1 and OsDAF1. Nat. Plants 2020, 6, 394–403. [Google Scholar] [CrossRef]
- Chen, M.L.; Xu, J.; Devis, D.; Shi, J.X.; Ren, K.; Searle, I.; Zhang, D.B. Origin and Functional Prediction of Pollen Allergens in Plants. Plant Physiol. 2016, 172, 341–357. [Google Scholar] [CrossRef]
- Jiang, S.Y.; Jasmin, P.X.H.; Ting, Y.Y.; Ramachandran, S. Genome-wide Identification and Molecular Characterization of Ole_e_I, Allerg_1 and Allerg_2 Domain-containing Pollen-Allergen-like Genes in Oryza sativa. DNA Res. 2005, 12, 167–179. [Google Scholar] [CrossRef]
- Robert, X.; Gouet, P. Deciphering Key Features in Protein Structures with the New ENDscript Server. Nucleic Acids Res. 2014, 42, W320–W324. [Google Scholar] [CrossRef]
- Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE: A Database of Plant Cis-acting Regulatory Elements and a Portal to Tools for in Silico Analysis of Promoter Sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
- Buchfink, B.; Reuter, K.; Drost, H.G. Sensitive Protein Alignments at Tree-of-life Scale using DIAMOND. Nat. Methods 2021, 18, 366–368. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. 20 Years of the SMART Protein Domain Annotation Resource. Nucleic Acids Res. 2018, 46, 493–496. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA 11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v5: An Online Tool for Phylogenetic Tree Display and Annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef]
- Gu, Z.G.; Gu, L.; Eils, R.; Schlesner, M.; Brors, B. Circlize Implements and Enhances Circular Visualization in R. Bioinformatics 2014, 30, 2811–2812. [Google Scholar] [CrossRef]
- Ma, X.L.; Zhang, Q.Y.; Zhu, Q.L.; Liu, W.; Chen, Y.; Qiu, R.; Wang, B.; Yang, Z.F.; Li, H.Y.; Lin, Y.R.; et al. A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol. Plant 2015, 8, 1274–1284. [Google Scholar] [CrossRef]
- Zhang, B.D.; Luo, X.; Zhu, L. Cytological Analysis and Genetic Control of Rice Anther Development. J. Genet. Genom. 2011, 38, 379–390. [Google Scholar] [CrossRef]
- Zhou, Y.B.; Liu, H.; Zhou, X.C.; Yan, Y.Z.; Du, C.Q.; Li, Y.X.; Liu, D.R.; Zhang, C.S.; Deng, X.L.; Tang, D.Y.; et al. Over-expression of a Fungal NADP(H)-dependent Glutamate Dehydrogenase PcGDH Improves Nitrogen Assimilation and Growth Quality in Rice. Mol. Breed. 2014, 34, 335–349. [Google Scholar] [CrossRef]
- Wyatt, R.E.; Nagao, R.T.; Key, J.L. Patterns of Soybean Proline-rich Protein Gene Expression. Plant Cell 1992, 4, 99–110. [Google Scholar]
- Fowler, T.J.; Bernhardt, C.; Tierney, M.L. Characterization and Expression of Four Proline-rich Cell Wall Protein Genes in Arabidopsis Encoding Two Distinct Subsets of Multiple Domain Proteins. Plant Physiol. 1999, 121, 1081–1091. [Google Scholar] [CrossRef]
- Luo, H.; Lee, J.Y.; Hu, Q.; Nelson-Vasilchik, K.; Eitas, T.K.; Lickwar, C.; Kausch, A.P.; Chandlee, J.M.; Hodges, T.K. RTS, a Rice Anther-specific Gene Is Required for Male Fertility and Its Promoter Sequence Directs Tissue-specific Gene Expression in Different Plant Species. Plant Mol. Biol. 2006, 62, 397–408. [Google Scholar] [CrossRef]
- Oliver, S.N.; Van-Dongen, J.T.; Alfred, S.C.; Mamun, E.A.; Zhao, X.C.; Saini, H.S.; Fernandes, S.F.; Blanchard, C.L.; Sutton, B.G.; Geigenberger, P.; et al. Cold-induced Repression of the Rice Anther-specific Cell Wall Invertase Gene OSINV4 Is Correlated with Sucrose Accumulation and Pollen Sterility. Plant Cell Environ. 2005, 28, 1534–1551. [Google Scholar] [CrossRef]
- Mamun, E.A.; Alfred, S.; Cantrill, L.C.; Overall, R.L.; Sutton, B.G. Effects of Chilling on Male Gametophyte Development in Rice. Cell Biol. Int. 2006, 30, 583–591. [Google Scholar] [CrossRef]
- Slewinski, T.-L. Diverse Functional Roles of Monosaccharide Transporters and their Homologs in Vascular Plants: A Physiological Perspective. Mol. Plant 2011, 4, 641–662. [Google Scholar] [CrossRef]
- Klepek, Y.S.; Geiger, D.; Stadler, R.; Klebl, F.; Landouar-Arsivaud, L.; Lemoine, R.; Hedrich, R.; Sauer, N. Arabidopsis POLYOL TRANSPORTER5, a New Member of the Monosaccharide Transporter-Like Superfamily, Mediates H+-Symport of Numerous Substrates, Including myo-Inositol, Glycerol, and Ribose. Plant Cell 2005, 17, 204–218. [Google Scholar] [CrossRef]
- Turgeon, R.; Medville, R. Phloem Loading. A Reevaluation of the Relationship between Plasmodesmatal Frequencies and Loading Strategies. Plant Physiol. 2004, 136, 3795–3803. [Google Scholar] [CrossRef]
- Toyofuku, K.; Kasahara, M.; Yamaguchi, J. Characterization and Expression of Monosaccharide Transporters (OsMSTs) in Rice. Plant Cell Physiol. 2000, 41, 940–947. [Google Scholar] [CrossRef]
- Zhang, H.; Liang, W.Q.; Yang, X.J.; Luo, X.; Jiang, N.; Ma, H.; Zhang, B.D. Carbon Starved Anther Encodes a MYB Domain Protein That Regulates Sugar Partitioning Required for Rice Pollen Development. Plant Cell 2010, 22, 672–689. [Google Scholar] [CrossRef]
- Wu, L.Y.; Jing, X.H.; Zhang, B.L.; Chen, S.J.; Xu, R.; Duan, P.G.; Zou, D.N.; Huang, S.J.; Zhou, T.B.; An, C.C.; et al. A Natural Allele of OsMS1 Responds to Temperature Changes and Confers Thermosensitive Genic Male Sterility. Nat. Commun. 2022, 13, 2055. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).





