Developing Novel Microsatellite Markers for Kaempferia parviflora by Microsatellite Capture Sequencing (MiCAPs)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. DNA Isolation, Library Establishment and Sequencing
2.3. Pre-Processing, In Silico Polymorphic Detection, and Phylogenetic Analysis
2.4. SSR Marker Development and In Silico Evaluation
2.5. PCR Validation of Novel SSR Markers
2.6. Flow Cytometry Analysis
3. Results
3.1. Estimating 2C Value and Genome Size Using Flow Cytometry
3.2. Sequencing Results Statistics
3.3. Phylogenetic Study Based on Sequence Mapping
3.4. Novel SSR Marker Development and Evaluation
3.5. Diversity Analysis Using Novel SSR Markers
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Agu, J.C.; Hee-Jeon, Y.; Steel, A.; Adams, J. A Systematic Review of Traditional, Complementary and Alternative Medicine Use Amongst Ethnic Minority Populations: A Focus Upon Prevalence, Drivers, Integrative Use, Health Outcomes, Referrals and Use of Information Sources. J. Immigr. Minor. Health 2019, 21, 1137–1156. [Google Scholar] [CrossRef]
- Shelley, B.M.; Sussman, A.L.; Williams, R.L.; Segal, A.R.; Crabtree, B.F. ’They Don’t Ask Me so I Don’t Tell Them’: Patient-Clinician Communication about Traditional, Complementary, and Alternative Medicine. Ann. Fam. Med. 2009, 7, 139–147. [Google Scholar] [CrossRef] [PubMed]
- Hwang, J.H.; Han, D.W.; Yoo, E.K.; Kim, W.-Y. The Utilisation of Complementary and Alternative Medicine (CAM) among Ethnic Minorities in South Korea. BMC Complement. Altern. Med. 2014, 14, 103. [Google Scholar] [CrossRef] [PubMed]
- Barnes, P.M.; Bloom, B.; Nahin, R.L. Complementary and Alternative Medicine Use among Adults and Children: United States, 2007; Centers for Disease Control and Prevention: Atlanta, GA, USA, 2008.
- Saokaew, S.; Wilairat, P.; Raktanyakan, P.; Dilokthornsakul, P.; Dhippayom, T.; Kongkaew, C.; Sruamsiri, R.; Chuthaputti, A.; Chaiyakunapruk, N. Clinical Effects of Krachaidum (Kaempferia parviflora): A Systematic Review. J. Evid.-Based Complement. Altern. Med. 2017, 22, 413–428. [Google Scholar] [CrossRef]
- Sirirugsa, P. Taxonomy of the Genus Kaempferia (Zingiberaceae) in Thailand. Thai For. Bull. Bot. 1991, 19, 1–15. [Google Scholar]
- Labrooy, C.D.; Abdullah, T.L.; Abdullah, N.A.P.; Stanslas, J. Optimum Shade Enhances Growth and 5,7-Dimethoxyflavone Accumulation in Kaempferia parviflora Wall. Ex Baker Cultivars. Sci. Hortic. 2016, 213, 346–353. [Google Scholar] [CrossRef]
- Devi, N.B.; Das, A.K.; Singh, P.K. Kaempferia parviflora (Zingiberaceae): A New Record in the Flora of Manipur. Int. J. Innov. Sci. Eng. Technol. 2016, 3, 661–665. [Google Scholar]
- Akase, T.; Shimada, T.; Terabayashi, S.; Ikeya, Y.; Sanada, H.; Aburada, M. Antiobesity Effects of Kaempferia parviflora in Spontaneously Obese Type II Diabetic Mice. J. Nat. Med. 2011, 65, 73–80. [Google Scholar] [CrossRef]
- Yee, T.T.; War, K.; Lwin, Y. Study of Phytochemical Composition on Kaempferia parviflora Wall. ex Baker. IEEE Pers. Commun. 2019, 7, 128–136. [Google Scholar]
- Sawasdee, P.; Sabphon, C.; Sitthiwongwanit, D.; Kokpol, U. Anticholinesterase Activity of 7-methoxyflavones Isolated from Kaempferia parviflora. Phytother. Res. 2009, 23, 1792–1794. [Google Scholar] [CrossRef]
- Yenjai, C.; Prasanphen, K.; Daodee, S.; Wongpanich, V.; Kittakoop, P. Bioactive Flavonoids from Kaempferia parviflora. Fitoterapia 2004, 75, 89–92. [Google Scholar] [CrossRef] [PubMed]
- Rujjanawate, C.; Kanjanapothi, D.; Amornlerdpison, D.; Pojanagaroon, S. Anti-Gastric Ulcer Effect of Kaempferia parviflora. J. Ethnopharmacol. 2005, 102, 120–122. [Google Scholar] [CrossRef]
- Tewtrakul, S.; Subhadhirasakul, S.; Karalai, C.; Ponglimanont, C.; Cheenpracha, S. Anti-Inflammatory Effects of Compounds from Kaempferia parviflora and Boesenbergia Pandurata. Food Chem. 2009, 115, 534–538. [Google Scholar] [CrossRef]
- Kobayashi, S.; Kato, T.; Azuma, T.; Kikuzaki, H.; Abe, K. Anti-Allergenic Activity of Polymethoxyflavones from Kaempferia parviflora. J. Funct. Foods 2015, 13, 100–107. [Google Scholar] [CrossRef]
- Paramee, S.; Sookkhee, S.; Sakonwasun, C.; Na Takuathung, M.; Mungkornasawakul, P.; Nimlamool, W.; Potikanond, S. Anti-Cancer Effects of Kaempferia parviflora on Ovarian Cancer SKOV3 Cells. BMC Complement. Altern. Med. 2018, 18, 178. [Google Scholar] [CrossRef]
- Hashiguchi, A.; San Thawtar, M.; Duangsodsri, T.; Kusano, M.; Watanabe, K.N. Biofunctional Properties and Plant Physiology of Kaempferia Spp.: Status and Trends. J. Funct. Foods 2022, 92, 105029. [Google Scholar] [CrossRef]
- Theanphong, O.; Jenjittikul, T.; Mingvanish, W.; Rungsihirunrat, K. Phylogenetic Relationships of Kaempferia Plants Based on Inter-Simple Sequence Repeat Fingerprints. Songklanakarin J. Sci. Technol. 2018, 40, 617–622. [Google Scholar]
- Joothamongkhon, J.; Susantikarn, P.; Kongkachana, W.; Ketngamkum, Y.; Batthong, S.; Jomchai, N.; Yingyong, P.; Asawapirom, U.; Tangphatsornruang, S.; Paemanee, A.; et al. Quantitative Analysis of Methoxyflavones Discriminates between the Two Types of Kaempferia parviflora. Phytochem. Anal. 2022, 33, 670–677. [Google Scholar] [CrossRef]
- Labrooy, C.D.; Abdullah, T.L.; Stanslas, J. Identification of Ethnomedicinally Important Kaempferia L. (Zingiberaceae) Species Based on Morphological Traits and Suitable DNA Region. Curr. Plant Biol. 2018, 14, 50–55. [Google Scholar] [CrossRef]
- Tautz, D.; Renz, M. Simple Sequences Are Ubiquitous Repetitive Components of Eukaryotic Genomes. Nucleic Acids Res. 1984, 12, 4127–4138. [Google Scholar] [CrossRef]
- Foster, J.T.; Bull, R.L.; Keim, P. Chapter 16-Ricin Forensics: Comparisons to Microbial Forensics. In Microbial Forensics, 3rd ed.; Budowle, B., Schutzer, S., Morse, S., Eds.; Academic Press: Cambridge, MA, USA, 2020; pp. 241–250. [Google Scholar] [CrossRef]
- Grover, A.; Sharma, P.C. Development and Use of Molecular Markers: Past and Present. Crit. Rev. Biotechnol. 2016, 36, 290–302. [Google Scholar] [CrossRef]
- Zalapa, J.E.; Cuevas, H.; Zhu, H.; Steffan, S.; Senalik, D.; Zeldin, E.; McCown, B.; Harbut, R.; Simon, P. Using Next-generation Sequencing Approaches to Isolate Simple Sequence Repeat (SSR) Loci in the Plant Sciences. Am. J. Bot. 2012, 99, 193–208. [Google Scholar] [CrossRef] [PubMed]
- Senan, S.; Kizhakayil, D.; Sasikumar, B.; Sheeja, T.E. Methods for Development of Microsatellite Markers: An Overview. Not. Sci. Biol. 2014, 6, 1–13. [Google Scholar] [CrossRef]
- Tanaka, K.; Ohtake, R.; Yoshida, S.; Shinohara, T. Microsatellite Capture Sequencing. In Genotyping; Abdurakhmonov, I., Ed.; InTech: London, UK, 2018. [Google Scholar] [CrossRef]
- Singh, H.; Deshmukh, R.K.; Singh, A.; Singh, A.K.; Gaikwad, K.; Sharma, T.R.; Mohapatra, T.; Singh, N.K. Highly Variable SSR Markers Suitable for Rice Genotyping Using Agarose Gels. Mol. Breed. 2010, 25, 359–364. [Google Scholar] [CrossRef]
- Schuler, G.D. Sequence Mapping by Electronic PCR. Genome Res. 1997, 7, 541–550. [Google Scholar] [CrossRef]
- Rotmistrovsky, K.; Jang, W.; Schuler, G.D. A Web Server for Performing Electronic PCR. Nucleic Acids Res. 2004, 32, W108–W112. [Google Scholar] [CrossRef]
- Cantarella, C.; D’Agostino, N. PSR: Polymorphic SSR Retrieval. BMC Res. Notes 2015, 8, 525. [Google Scholar] [CrossRef]
- Thawtar, M.S.; Kusano, M.; Yingtao, L.; Wunna; Thein, M.S.; Tanaka, K.; Rivera, M.; Shi, M.; Watanabe, K.N. Exploring Volatile Organic Compounds in Rhizomes and Leaves of Kaempferia parviflora Wall. ex Baker Using HS-SPME and GC–TOF/MS Combined with Multivariate Analysis. Metabolites 2023, 13, 651. [Google Scholar] [CrossRef]
- Doyle, J.J.; Doyle, J.L. A Rapid DNA Isolation Procedure for Small Amounts of Fresh Leaf Material. Photochem Bull 1987, 19, 11–15. [Google Scholar]
- Ando, T.; Matsuda, T.; Goto, K.; Hara, K.; Ito, A.; Hirata, J.; Yatomi, J.; Kajitani, R.; Okuno, M.; Yamaguchi, K.; et al. Repeated Inversions within a Pannier Intron Drive Diversification of Intraspecific Colour Patterns of Ladybird Beetles. Nat. Commun. 2018, 9, 3843. [Google Scholar] [CrossRef]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An Ultra-Fast All-in-One FASTQ Preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Magoc, T.; Salzberg, S.L. FLASH: Fast Length Adjustment of Short Reads to Improve Genome Assemblies. Bioinformatics 2011, 27, 2957–2963. [Google Scholar] [CrossRef]
- Li, W.; Godzik, A. Cd-Hit: A Fast Program for Clustering and Comparing Large Sets of Protein or Nucleotide Sequences. Bioinformatics 2006, 22, 1658–1659. [Google Scholar] [CrossRef]
- Temnykh, S.; DeClerck, G.; Lukashova, A.; Lipovich, L.; Cartinhour, S.; McCouch, S. Computational and Experimental Analysis of Microsatellites in Rice (Oryza sativa L.): Frequency, Length Variation, Transposon Associations, and Genetic Marker Potential. Genome Res. 2001, 11, 1441–1452. [Google Scholar] [CrossRef] [PubMed]
- Populations. Available online: http://bioinformatics.org/populations/ (accessed on 5 January 2023).
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- Beier, S.; Thiel, T.; Münch, T.; Scholz, U.; Mascher, M. MISA-Web: A Web Server for Microsatellite Prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef] [PubMed]
- Thiel, T.; Michalek, W.; Varshney, R.; Graner, A. Exploiting EST Databases for the Development and Characterization of Gene-Derived SSR-Markers in Barley (Hordeum vulgare L.). Theor. Appl. Genet. 2003, 106, 411–422. [Google Scholar] [CrossRef] [PubMed]
- Langmead, B.; Salzberg, S.L. Fast Gapped-Read Alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [PubMed]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic Analysis in Excel. Population Genetic Software for Teaching and Research--an Update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
- Smouse, P.E.; Banks, S.C.; Peakall, R. Converting Quadratic Entropy to Diversity: Both Animals and Alleles Are Diverse, but Some Are More Diverse than Others. PLoS ONE 2017, 12, e0185499. [Google Scholar] [CrossRef]
- Koressaar, T.; Remm, M. Enhancements and Modifications of Primer Design Program Primer3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef] [PubMed]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New Capabilities and Interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [PubMed]
- Blacket, M.J.; Robin, C.; Good, R.T.; Lee, S.F.; Miller, A.D. Universal Primers for Fluorescent Labelling of PCR Fragments—An Efficient and Cost-Effective Approach to Genotyping by Fluorescence. Mol. Ecol. Resour. 2012, 12, 456–463. [Google Scholar] [CrossRef]
- Šmarda, P.; Bureš, P.; Horová, L.; Leitch, I.J.; Mucina, L.; Pacini, E.; Tichý, L.; Grulich, V.; Rotreklová, O. Ecological and Evolutionary Significance of Genomic GC Content Diversity in Monocots. Proc. Natl. Acad. Sci. USA 2014, 111, E4096–E4102. [Google Scholar] [CrossRef]
- Doležel, J.; Greilhuber, J.; Suda, J. Estimation of Nuclear DNA Content in Plants Using Flow Cytometry. Nat. Protoc. 2007, 2, 2233–2244. [Google Scholar] [CrossRef]
- Dolezel, J. Nuclear DNA Content and Genome Size of Trout and Human. Cytometry A 2003, 51, 127–128. [Google Scholar] [PubMed]
- Chromosome Numbers and Genome Size Variation in Indian Species of Curcuma (Zingiberaceae) | Annals of Botany | Oxford Academic. Available online: https://academic.oup.com/aob/article/100/3/505/165957 (accessed on 7 May 2024).
- Kress, W.J.; Prince, L.M.; Williams, K.J. The Phylogeny and a New Classification of the Gingers (Zingiberaceae): Evidence from Molecular Data. Am. J. Bot. 2002, 89, 1682–1696. [Google Scholar] [CrossRef]
- Cheng, S.-P.; Jia, K.-H.; Liu, H.; Zhang, R.-G.; Li, Z.-C.; Zhou, S.-S.; Shi, T.-L.; Ma, A.-C.; Yu, C.-W.; Gao, C.; et al. Haplotype-Resolved Genome Assembly and Allele-Specific Gene Expression in Cultivated Ginger. Hortic. Res. 2021, 8, 188. [Google Scholar] [CrossRef]
- Li, H.-L.; Wu, L.; Dong, Z.; Jiang, Y.; Jiang, S.; Xing, H.; Li, Q.; Liu, G.; Tian, S.; Wu, Z. Haplotype-Resolved Genome of Diploid Ginger (Zingiber officinale) and Its Unique Gingerol Biosynthetic Pathway. Hortic. Res. 2021, 8, 189. [Google Scholar] [CrossRef]
- Chen, Z.; Zhang, L.; Lv, Y.; Qu, S.; Liu, W.; Wang, K.; Gao, S.; Zhu, F.; Cao, B.; Xu, K. A Genome Assembly of Ginger (Zingiber officinale Roscoe) Provides Insights into Genome Evolution and 6-Gingerol Biosynthesis. Plant J. 2024, 118, 682–695. [Google Scholar] [CrossRef]
- Srivastava, S.; Kushwaha, B.; Prakash, J.; Kumar, R.; Nagpure, N.S.; Agarwal, S.; Pandey, M.; Das, P.; Joshi, C.G.; Jena, J.K. Development and Characterization of Genic SSR Markers from Low Depth Genome Sequence of Clarias Batrachus (Magur). J. Genet. 2016, 95, 603–609. [Google Scholar] [CrossRef] [PubMed]
- Vidya, V.; Prasath, D.; Snigdha, M.; Gobu, R.; Sona, C.; Maiti, C.S. Development of EST-SSR Markers Based on Transcriptome and Its Validation in Ginger (Zingiber officinale Rosc.). PLoS ONE 2021, 16, e0259146. [Google Scholar] [CrossRef] [PubMed]
- Sahoo, A.; Jena, S.; Kar, B.; Sahoo, S.; Ray, A.; Singh, S.; Joshi, R.K.; Acharya, L.; Nayak, S. EST-SSR Marker Revealed Effective over Biochemical and Morphological Scepticism towards Identification of Specific Turmeric (Curcuma longa L.) Cultivars. 3 Biotech 2017, 7, 84. [Google Scholar] [CrossRef] [PubMed]
- Senan, S.; Kizhakayil, D.; Sheeja, T.E.; Sasikumar, B.; Bhat, A.I.; Parthasarathy, V.A. Novel Polymorphic Microsatellite Markers from Turmeric, Curcuma longa L. (Zingiberaceae). Acta Bot. Croat. 2013, 72, 407–412. [Google Scholar] [CrossRef]
- Sae-wong, C.; Tansakul, P.; Tewtrakul, S. Anti-Inflammatory Mechanism of Kaempferia parviflora in Murine Macrophage Cells (RAW 264.7) and in Experimental Animals. J. Ethnopharmacol. 2009, 124, 576–580. [Google Scholar] [CrossRef] [PubMed]
Species | Accession Number | Mean 2C Value (pg) | Genome Size (Mbp) | Number of Cells | CV (%) | Ploidy |
---|---|---|---|---|---|---|
K. parviflora | Z1064 | 3.16 ± 0.03 | 3090.48 | 565 | 2.1 | 2× |
Z. officinale | Z012-1 | 3.23 ± 0.00 | 3158.94 | 1372 | 3.1 | 2× |
Average All Accessions | Average K. parviflora | Total | ||
---|---|---|---|---|
Raw data | Total Reads (K) | 133.34 | 128.37 | 2800.22 |
Total Bases (M) | 32.00 | 30.02 | 671.98 | |
Q30 Bases (%) | 92.42 | 93.35 | N/A | |
After fastp | Total Reads (K) | 130.21 | 126.01 | 2734.46 |
Total Bases (M) | 30.57 | 28.79 | 641.91 | |
Q30 Bases (%) | 94.09 | 94.79 | N/A |
Accession | Z 1034 | Z 1062 | Z 1064 | Z 1082 | Z 1094 | Z 1113 | Z 1113A | Z 1113B |
---|---|---|---|---|---|---|---|---|
Examined sequences (Mbp) | 14.62 | 12.13 | 14.42 | 19.19 | 14.09 | 13.49 | 17.26 | 15.55 |
Identified SSRs | 1607 | 1362 | 1568 | 2233 | 1654 | 1479 | 1936 | 1805 |
SSR density (per Mbp) | 109.91 | 112.33 | 108.77 | 116.34 | 117.41 | 109.67 | 112.20 | 116.05 |
ID | Motif | Forward Primer | Reverse Primer | Expected Size (bp) | PIC |
---|---|---|---|---|---|
Kp01 | GA | TGGCGAAGAAATCCAAGGATG | AGGAATCAAAACTTGAGCTTTCTTCT | 101 | 0.19 |
Kp02 | GA | TGGGCAACAATTATAGGAGAGGA | TGTCTATGCTCCGTTGACACA | 103 | 0.29 |
Kp03 | TCCCTC | CCTCCATCTCTGCTAGCTCTC | AAAGCAGAGGAAATGGCCGA | 112 | 0.36 |
Kp04 | TC | GGAGGGGTTTCCACCGAAAT | TCGAAGAAGCAGCCGAAGAG | 141 | 0.44 |
Kp05 | CCTCT | CTCAATTCCCTCACCCGACC | TAGAGCTCCCTTTGCTTGGC | 164 | 0.21 |
Kp06 | GGAGAG | CCGGATCCCAAGGGTGTAAG | TCCCTCATTCAACACATTCTCT | 176 | 0.30 |
Kp07 | AG | GGACTGATGTGCGCTAGTGA | TCGTACTCCTAGAACATCCACCT | 186 | 0.61 |
Kp08 | GA | ACTCGGTGAAGTTAGGCGTG | CGGAAAGGTGGAAAATCGGC | 206 | 0.30 |
Kp09 | CT | GCTCGAAATCCACCACCTCA | TTCATAGGTCAGCCGTTGCA | 214 | 0.51 |
Kp10 | AG | AGGTGTCCACTAAACATACTAGCA | CGGGAGCCTAGTGACAAAGT | 217 | 0.38 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, M.; Tanaka, K.; Rivera, M.P.; Ngure, G.M.; Watanabe, K.N. Developing Novel Microsatellite Markers for Kaempferia parviflora by Microsatellite Capture Sequencing (MiCAPs). Agronomy 2024, 14, 1984. https://doi.org/10.3390/agronomy14091984
Shi M, Tanaka K, Rivera MP, Ngure GM, Watanabe KN. Developing Novel Microsatellite Markers for Kaempferia parviflora by Microsatellite Capture Sequencing (MiCAPs). Agronomy. 2024; 14(9):1984. https://doi.org/10.3390/agronomy14091984
Chicago/Turabian StyleShi, Miao, Keisuke Tanaka, Marlon P. Rivera, Godfrey M. Ngure, and Kazuo N. Watanabe. 2024. "Developing Novel Microsatellite Markers for Kaempferia parviflora by Microsatellite Capture Sequencing (MiCAPs)" Agronomy 14, no. 9: 1984. https://doi.org/10.3390/agronomy14091984